Este trabajo fue apoyado por NIH AI099854 y AI126742 a la clave.

1. recocido de vDNA
<ol><li>Combinar 1 X Buffer 10 (10 X 10 stock: 100 mM Tris-HCl, pH 8,0, 1 M NaCl, 10 mM EDTA), 10 μm 1 Oligo (5' ATTGTCATGGAATTTTGTATATTGAGTGGCGCCCGAACAG 3', 100 acciones μm) y 10 μm 2 Oligo (5' CTGTTCGGGCGCCACTCAATATACAAAATTCCATGACA 3', 100 acciones μm) en un volumen final de 1.5 mL . Alícuota de 25 μL en tubos de reacción en cadena (PCR) de 0.2 mL polimerasa sesenta. Nota: Dependiendo de la aplicación, oligómeros pueden modificarse con fluoróforos o etiquetas en el extremo 5'-2 Oligo o como un interno amino-T 13 base desde el extremo 5' de Oligo 1. Oligómeros modificados deben ser purificados por cromatografía líquida de alto rendimiento (HPLC) antes del recocido. Hemos encontrado que 5'-end Cy3 o Cy5 fluoróforo etiquetado de Oligo 2 reduce la eficacia de la Asamblea de intasome 10 veces. Fluoróforo interno etiquetado no reduce la eficiencia de montaje.</li>
	<li>Recueza utilizando un termociclador con los siguientes tiempos y temperaturas: 1 ciclo a 94.0 ° c 3 min, 99 ciclos en (94.0 ° c 1 min, ° c 93,6 1 min) disminuyendo ambas temperaturas por 0,8 ° c por ciclo (el último ciclo es de 14,8 ° c 1 min, 14,4 ° c 1 min) y conservarlo a 4.0 ° c.</li>
	<li>Se combinan las reacciones recocidas de sesenta todos los tubos. Carga de 500 μl a dos 0.5 mL 3 kDa peso molecular límite (MWCO) filtro ultracentrífugo concentración unidades. El recocido vDNA se concentran mediante centrifugación en una microcentrífuga a 14.000 x g por 10 min a temperatura ambiente (RT). Nota: El volumen retenido debe ser ~ 50 μL en cada unidad de concentración.</li>
	<li>Deseche el flujo a través. Añadir 250 μl de la restante vDNA recocido a cada unidad de filtro. Repetir la vuelta y desechar el flujo a través. De búfer lavándola tres veces con 450 μl TE intercambio en buffer TE (10 mM Tris-HCl, pH 8.0, 1 mM EDTA).</li>
	<li>Invierta la unidad de filtrado y centrifugado a 1.000 x g durante 2 min a TA. El volumen retenido final para cada unidad de filtro debe ser ~ 50 μl. combinar el retentates y transfiéralo a un tubo de tapón de rosca de 1.5 mL.</li>
	<li>Medir la absorbancia de 260 nm ultravioleta (UV) de la vDNA. Utilice este valor para calcular la concentración molar final de la DNA. El coeficiente de extinción (ε260) de este vDNA es 622.803 cm-1 M-1 y su peso molecular es 23.972 da. tienda a-20 ° c.</li>
</ol>2. Intasome Asamblea
<ol><li>Si es posible, realizar la Asamblea de intasome en una pequeña habitación con un termostato variable. Ajuste el termostato entre 18-22 grados centígrados. Nota: En nuestra experiencia, montaje de intasome a 4 ° c es ineficiente.</li>
	<li>Preparar 1 L de tampón de diálisis (Bis-tris propano de 20 mM, pH 7,5, 200 mM NaCl, 2 mM Ditiotreitol (DTT), 25 μm vivencias2) en un vaso de precipitados de 2 L con una barra de agitación en una placa de agitación. Equilibrar el búfer en la sala de 18-22 ° c durante al menos 6 h.</li>
	<li>Para montar el intasomes, combinan propano 50 mM Bis-tris, pH 7,5, 500 mM NaCl, 120 μm en PFV y 50 μm vDNA en un volumen total de 150 μL. Nota: El en PFV debe estar libre de contaminantes actividad nucleasa de7,8. Si la concentración de PFV es demasiado diluida para dar cabida a 120 μm IN en volumen de 150 μL, entonces es posible aumentar el volumen final a 200 μl. Los factores críticos de este paso son para mantener la proporción molar de IN a vDNA (2.4:1) y tener suficiente complejo visualizar durante la cromatografía.</li>
	<li>Limpiar un pedazo largo de ~ 10 cm de tubo de diálisis de 10 mm 6-8 kDa MWCO y clips con agua bidestilada (ddH2O), o agua de pureza más alto disponible. Clip de uno de los extremos de la tubería. Nota: La tubería de la diálisis debe manejarse con cuidado para evitar cualquier posible contaminación del espacio lab.</li>
	<li>Tomar 15 mL de solución de enjuague de tubo de diálisis (propano 50 mM Bis-tris, pH 7,5, 500 mM NaCl). Enjuague el interior de la tubería de la diálisis tres veces con 1-2 mL de tampón de enjuague. Eliminar gran parte de la solución de enjuague como sea posible con una pipeta y gel fina punta de carga.</li>
	<li>Si es necesario, use una limpia hoja de afeitar o bisturí para cortar el tubo de diálisis de forma que una carga de gel fina punta puede alcanzar el extremo de la tubería.</li>
	<li>Transferir el conjunto de intasome de paso 2.3 a la tubería de la diálisis con una pipeta y un gel fino carga punta. Enganche el extremo abierto del tubo de diálisis, minimizando la cantidad de aire introducido en el tubo. Coloque el tubo en el buffer de diálisis.</li>
	<li>Dializarse durante la noche (16-20 h) con agitación suave para que el tubo gira, pero no es en un vórtice. Asegúrese que el tubo de diálisis sumergida y móviles. Después de aproximadamente una hora, observar un precipitado visible dentro de la tubería. Nota: Con Cy3 y Cy5 fluorescencia etiquetada vDNA el precipitado es más obvio. Esto es cierto para finalizar etiquetado e internamente etiquetado vDNA fluorescente.</li>
</ol>3. Intasome solubilización
<ol><li>Preparar dos alesaje ancho puntas de pipeta mediante la eliminación de 2-4 mm del extremo de una punta de 200 μL con una cuchilla de afeitar o bisturí nuevo sobre una superficie limpia. Nota: Las puntas se utilizará en el paso 3.3 y 3.5.</li>
	<li>Quite los tubos de diálisis desde el buffer de diálisis. Con el fin de evitar la dilución de la muestra intasome con buffer de diálisis que puede permanecer en el extremo de la tubería cerca del clip, utilice una micropipeta con una pequeña pipeta para quitar cualquier buffer de diálisis exceso. Retire el clip de uno de los extremos de la tubería de la diálisis.</li>
	<li>Uso una amplia agujereada pipeta de paso 3.1 para transferir la muestra incluyendo el precipitado dentro de la tubería de la diálisis a un tubo de 1,5 mL en hielo. Tenga en cuenta el volumen total del material recuperado; el volumen total es típicamente ~ 140 μl.</li>
	<li>La muestra con precipitado es a 200 mM de NaCl; aumentar la sal a una concentración final de 320 mM de NaCl añadiendo el volumen adecuado de una solución de NaCl de 5 M madre. Por ejemplo, para una muestra de 150 μL, añadir μl 3,9 5 M NaCl y 1,1 μl ddH2O para un volumen final de 155 μl. transferencia de cubo de hielo con la muestra en una cámara fría de 4 ° c.</li>
	<li>Uso una amplia agujereada pipeta de paso 3.1 a suspender y solubilizar el precipitado mediante pipeteo. Repetir cada 20 min para por lo menos 1 h. Observe que la mayor parte del precipitado en solución. Nota: Pipeteo para Resuspender el precipitado puede suspenderse cuando es evidente que el precipitado no perceptiblemente se reduce entre puntos de tiempo. Cuando vDNA internamente es indicado o no está etiquetado, el precipitado se reduce por el ~ 90% basado en la inspección visual. En el caso de Cy5 final etiquetado vDNA, el precipitado se reduce sólo ~ 20%; la mayor parte del precipitado con el fluoróforo final etiquetado vDNA no se solubilizan. La cantidad de precipitado que efectivamente es solubilizado es variable y debe determinarse empíricamente.</li>
</ol>4. Intasome purificación
<ol><li>Preparar 250 mL de cromatografía por exclusión de tamaño (SEC) funcionamiento tampón (propano 20 mM Bis-tris, pH 7,5, 320 mM NaCl, 10% glicerol). Filtro estéril el buffer con un 0.2 μm filtro unidad y almacenar a 4 ° c. Nota: Todos los pasos de purificación se realizan en una cámara fría de 4 ° c.</li>
	<li>Equilibrar una columna de agarosa reticulado SEC (diámetro = 10 mm; longitud = 300 mm, volumen de la cama = 24 mL, volumen de muestra = 25-500 μl; presión máxima = 1,5 MPa, límite de exclusión = 4 x 107 Da; separa pesos moleculares entre 5.000 y 5 kDa, ver la de la estera de tabla erials) con el almacenador intermediario corriente seg con un caudal de 0,4 mL/min. Nota: Esta purificación puede adaptarse a columnas de exclusión de diverso tamaño si son capaces de separar eficazmente 300 kDa de 44 kDa, como Superose 12 10/300 GL Superose 6 aumentar. Superose 12 10/300 GL tiene menor resolución, llevando a más superposición de picos. Por el contrario, Superose 6 aumentar ofrece mayor resolución y mejor separación.</li>
	<li>Centrifugue la muestra de intasome en una microcentrífuga a 14.000 x g durante 10 min a 4 ° c a cualquier precipitado restante de pellets. Retire con cuidado el sobrenadante. Cargar el sobrenadante a un bucle de inyección de 200 μl (tubería que puede contener ~ 200 μL). Aplicar la muestra a la columna de seg. Nota: Volúmenes más pequeños de la carga permiten una mayor resolución de la SEC.</li>
	<li>Eluir con 25 mL seg funcionando del almacenador intermediario y cobrar 95 fracciones de 270 μl. observar que el cromatograma de la SEC muestra picos de260 A280/A (figura 1) tres. Nota: La primera debe ser un agregado (~9.0 - elución mL 11,5), seguido de la PFV tetrámero intasome pico (~12.0 - elución mL 14,75) y monómero en PFV con pico vDNA libre (~15.0 - 18,0 mL).</li>
</ol>5. integración del filamento transferencia ensayo, selección de la fracción y almacenamiento
<ol><li>Combinar 2 μl de cada fracción de pico intasome y 50 ng superenrollado 3 kb ADN plásmido (stock concentración es de 50 ng/μL) en buffer de reacción (gas propano 10 mM Bis-tris, pH 7,5, 110 mM NaCl, 5 mM MgSO4, 4 μm vivencias2, 10 mM DTT) en un volumen de reacción final de 15 μl. Incubar a 37 ° c durante 5 minutos.</li>
	<li>Incluir un control negativo con ningún agregado intasome PFV. Detener la reacción con proteinasa μl 0.75 K (20 mg/mL de solución stock) y 0,75 μl SDS (solución stock al 10%). Incubar a 55 ° c para las muestras de la tienda 1 h. según sea necesario en-20 ° c para posteriores análisis. Nota: Este ensayo es una evaluación cualitativa de la actividad de integración. Antes este análisis no es determinar la concentración molar de intasome de cada fracción. Fracciones incluidas en el análisis de transferencia de cadena de integración pueden ser almacenados en hielo (incluido el almacenamiento durante la noche) hasta integración actividad es confirmada y las fracciones alícuotas. Aquí utilizamos pMP2, un derivado de pUC199. Hemos utilizado también con éxito el 5,4 kb plásmido pcDNA 3.1. Cualquier plásmido que puede resolverse a relajado círculo, lineal, y superenrolladas formas pueden utilizarse como un objetivo de integración.</li>
	<li>Preparar un peso de 1% de 120 mL por gel de agarosa de volumen (p/v) en tampón de TAE X 1 (40 mM Tris acetato, EDTA 1 mM) con 0,1 μg/mL etidio bromuro (EtBr, solución stock de 10 mg/mL)10. La solución de agarosa del derretimiento y vierta en una bandeja de fundición de gel de 15 cm x 10 cm. Inserte un peine de 15 pozos con 5 mm ancho, 0,75 mm espesor pozos. Nota: Pozos de menos rendimiento mejor resolución de banda en comparación con los pozos de espesor 1,5 mm.</li>
	<li>Permita que el gel se solidifique a temperatura ambiente. Sumergir el gel en 1 X TAE con EtBr de 0.1 μg/mL.</li>
	<li>Agregar 3 μl 50% de glicerol a cada reacción de integración del paso 5.2. El volumen de reacción todo el gel de la carga. Carga 1 μl del marcador de tamaño de DNA de 10 kb (concentración stock de 150 ng/μL) a carriles a ambos lados de las muestras; en otras palabras, el marcador del tamaño de ADN debe flanquean las calles de la muestra.</li>
	<li>En un carril exterior, carga tinte de G anaranjado de 6 μl (0,25% naranja G, glicerol 30%). Correr el gel a tensión constante, 10 V/cm (100 V) a temperatura ambiente durante 1 hora o hasta que el frente de tinte naranja G llega al final del gel.</li>
	<li>Inmediatamente la imagen del gel de agarosa con un analizador fluorescente para detectar EtBr (532 nm excitación, filtro de emisión de 610 nm). Si se utilizaron fluoróforo con la etiqueta vDNAs, también imagen con ajustes de fluoróforo adecuado. Nota: por ejemplo detectar Cy5 etiquetado ADN, imagen con 633 nm excitación y filtros de emisión de 670 nm. Productos de integración concertada (CI, ADN lineal) deben ejecutar tallaje a ~ 3 kb plásmido superenrollado (SC) debe correr más rápido (~ 2 kb) y productos de integración de media página (HSI, círculo relajado DNA) deben ejecutar más lento (~3.5 kb). VDNA debe ejecutarse tallaje en ~ 40 bp.</li>
	<li>Cuantificar las bandas en cada carril con proyección de imagen de software7. Calcular la fracción de ADN en cada carril CI, HSI o SC; vDNA no está incluido en este cálculo. Nota: Eficiencia de la integración o la fracción de SC convertida en un producto lineal, se calculó dividiendo el volumen de píxeles de productos de integración concertada (IC) por el volumen total de píxeles de tres bandas (HSI + CI + SC). Si intasomes son fluoróforo con la etiqueta, los productos de HSI y CI pueden cuantificarse por fluorescencia.</li>
	<li>Seleccione fracciones que tienen la actividad de integración más concertada. Nota: En nuestra experiencia, la actividad de integración concertada de pico coincide con el pico de la proteína identificado como intasomes PFV tetramérica. Mida A280 de cada una de estas fracciones y calcular la concentración final de intasome. Ε280 por un tetrámero de tipo salvaje en PFV con dos vDNAs descrito aquí es 908.339 cm-1M-1 y el peso molecular es 225,5 kDa. Las concentraciones deben seguir el mismo patrón como el pico del cromatograma de SEC y en el análisis de transferencia de cadena.</li>
	<li>Distribuir cada fracción en 5 alícuotas μl y snap congelar en nitrógeno líquido. Guardar alícuotas a-80 ° c. Fracciones seleccionadas para el almacenamiento son típicamente entre 200-600 nM.</li>
</ol>

<ol>
	<li>Coffin, J. M., Hughes, S. H., Varmus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Retroviruses. , (1997).</li><li>Valkov, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+and+structural+characterization+of+the+integrase+from+the+prototype+foamy+virus.">Functional and structural characterization of the integrase from the prototype foamy virus.</a> Nucleic Acids Res. 37 (1), 243-255 (2009).</li><li>Hare, S., Gupta, S. S., Valkov, E., Engelman, A., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasome+assembly+and+inhibition+of+DNA+strand+transfer.">Retroviral intasome assembly and inhibition of DNA strand transfer.</a> Nature. 464 (7286), 232-236 (2010).</li><li>Li, M., Lin, S., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Outer+domains+of+integrase+within+retroviral+intasomes+are+dispensible+for+catalysis+of+DNA+integration.">Outer domains of integrase within retroviral intasomes are dispensible for catalysis of DNA integration.</a> Protein Sci. 25 (2), 472-478 (2016).</li><li>Gupta, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solution+conformations+of+prototype+foamy+virus+integrase+and+its+stable+synaptic+complex+with+U5+viral+DNA.">Solution conformations of prototype foamy virus integrase and its stable synaptic complex with U5 viral DNA.</a> Structure. 20 (11), 1918-1928 (2012).</li><li>Jones, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasomes+search+for+a+target+DNA+by+1D+diffusion+which+rarely+results+in+integration.">Retroviral intasomes search for a target DNA by 1D diffusion which rarely results in integration.</a> Nat Commun. 7, 11409 (2016).</li><li>Lopez, M. A., Mackler, R. M., Altman, M. P., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+and+removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Detection and removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Vis Exp. , (2017).</li><li>Lopez, M. A., Mackler, R. M., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Virol Methods. 235, 134-138 (2016).</li><li>Poirier, M. G., Bussiek, M., Langowski, J., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+access+to+DNA+target+sites+in+folded+chromatin+fibers.">Spontaneous access to DNA target sites in folded chromatin fibers.</a> J Mol Biol. 379 (4), 772-786 (2008).</li><li>Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments.">Agarose gel electrophoresis for the separation of DNA fragments.</a> J Vis Exp. (62), (2012).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+reveals+a+novel+octameric+integrase+structure+for+betaretroviral+intasome+function.">Cryo-EM reveals a novel octameric integrase structure for betaretroviral intasome function.</a> Nature. 530 (7590), 358-361 (2016).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+supramolecular+assembly+mediates+lentiviral+DNA+integration.">A supramolecular assembly mediates lentiviral DNA integration.</a> Science. 355 (6320), 93-95 (2017).</li><li>Passos, D. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+structures+and+atomic+model+of+the+HIV-1+strand+transfer+complex+intasome.">Cryo-EM structures and atomic model of the HIV-1 strand transfer complex intasome.</a> Science. 355 (6320), 89-92 (2017).</li><li>Yin, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Rous+sarcoma+virus+intasome.">Crystal structure of the Rous sarcoma virus intasome.</a> Nature. 530 (7590), 362-366 (2016).</li><li>Maertens, G. N., Hare, S., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mechanism+of+retroviral+integration+from+X-ray+structures+of+its+key+intermediates.">The mechanism of retroviral integration from X-ray structures of its key intermediates.</a> Nature. 468 (7321), 326-329 (2010).</li><li>Maskell, D. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+for+retroviral+integration+into+nucleosomes.">Structural basis for retroviral integration into nucleosomes.</a> Nature. 523 (7560), 366-369 (2015).</li></ol>

Los autores no tienen nada que revelar.

Retroviral INs forman un complejo con DNA genómica viral para realizar integración y continuar el ciclo de vida viral multimérica. El número de monómeros por intasome puede ser tetrámeros, octamers o posiblemente mayor orden Multímeros11,12,13,14. Intasomes PFV son un tetrámero de recombinante con oligómeros de ADN bicatenario que imitan la DNA genomic viral termina3<...

Integración del genoma viral en el genoma del anfitrión es un paso obligatorio en el ciclo de vida de todos los retrovirus1. La enzima viral integrasa (IN) cataliza la unión covalente de los extremos del genoma viral de la DNA al anfitrión DNA. Durante una infección celular, en forma parte de un complejo de pre-integración que media integración. Recombinante en complexed con oligómeros de ADN de doble trenzados mímico los extremos del ADN virales también puede realizar la integración en un ADN en vitrode objetivo2. Un común integración análisis en vitro utiliza un plásmido superenrollado como el ADN diana. Integración de ambos oligómeros de ADN virales (vDNA) para el plásmido da lugar a un producto lineal y se denomina integración concertada (figura 2A). La integración análisis de vitro también se pueden producir productos con sólo un vDNA covalentemente unido al plásmido de blanco dando como resultado un círculo relajado. Este producto de la integración de medio sitio parece ser un artefacto del ensayo in vitro.
Recombinante en y vDNA pueden realizar integración en vitro, pero no son reactivos ideal para el estudio de la dinámica o estructura de los complejos de integración cuando IN monomérica oscurecería visualización pertinente. Complejos de integración purificado, o "intasomes," son necesarios para estudios de análisis o estructural dinámico a la sola molécula. EN PFV y vDNAs puede ser montada por diálisis de un búfer relativamente alta concentración de sal a una baja concentración de sal3,4. Durante la diálisis, un precipitado formas. Este precipitado se elimina de la diálisis y se aumenta la concentración de sal. La mayor concentración de sal solubiliza el precipitado que contiene intasomes PFV. El intasomes entonces se purifican por cromatografía por exclusión de tamaño (SEC). Prototipo recombinante virus espumoso (PFV) IN se ha demostrado que existe como monómero en solución a concentraciones de hasta 225 μm5. Fraccionamiento s efectivamente separa la intasomes PFV (225,5 kDa), que incluye un tetrámero en PFV y dos vDNAs, PFV monomérica en (44,4 kDa) y vDNA gratis (24.0 kDa). La intasomes PFV pueden congelar y conservar actividad de integración para al menos seis meses de almacenamiento a-80 ° c.
Recombinante intasomes PFV también puede ser modificada para incluir en las substituciones del aminoácido o mutaciones de truncamiento o vDNAs con fluoróforos o biotina4,6. Las intasomes PFV purificados fácilmente realizar integración en un objetivo de plásmido superenrollado ADN en vitro. Ensayos de integración bioquímica a granel con intasomes pueden probar los efectos de en mutaciones, inhibidores, o otros aditivos químicos. Biotinilado intasomes puede utilizarse para sonda afinidad con proteínas o ácidos nucleicos. Intasomes PFV funcionan a temperatura ambiente permitiendo análisis de microscopia sola molécula por pinza magnética para medir el tiempo entre la Unión de los dos extremos de vDNA o fluorescencia de la reflexión interna total para visualizar la búsqueda intasome en blanco De ADN6. Además, PFV intasomes fueron los primeros en ser estructuralmente caracterizan impactando significativamente el campo de la integración retroviral3.

<table>
	<tbody>
		<tr>
			<td>DNA Oligomers</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>Custom DNA Oligos</td>
		</tr>
		<tr>
			<td>Tris Ultra Pure</td>
			<td>Gojira Fine Chemicals</td>
			<td>UTS1003</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>P212121</td>
			<td>RP-S23020</td>
			<td></td>
		</tr>
		<tr>
			<td>UltraPure EDTA</td>
			<td>Invitrogen/Gibco</td>
			<td>15575</td>
			<td></td>
		</tr>
		<tr>
			<td>Amicon Ultra 0.5 mL centrifugal filters</td>
			<td>Sigma-Aldrich</td>
			<td>Z677094-24EA</td>
			<td>3 kDa MWCO</td>
		</tr>
		<tr>
			<td>DTT&#160;</td>
			<td>P212121</td>
			<td>SV-DTT</td>
			<td></td>
		</tr>
		<tr>
			<td>BIS-TRIS propane,&#62;=99.0% (titration)</td>
			<td>Sigma-Aldrich</td>
			<td>B6755-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>ZnCl2</td>
			<td>Sigma-Aldrich</td>
			<td>208086</td>
			<td></td>
		</tr>
		<tr>
			<td>MgSO4</td>
			<td>Amresco</td>
			<td>0662</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>G37-20</td>
			<td></td>
		</tr>
		<tr>
			<td>Gel-loading tips, 1 - 200 &#956;L</td>
			<td>Corning</td>
			<td>CLS4853-400EA</td>
			<td></td>
		</tr>
		<tr>
			<td>Razor blade; Single-edged; 100/Pk.; Pack of 100</td>
			<td>Fisher Scientific</td>
			<td>12-640</td>
			<td></td>
		</tr>
		<tr>
			<td>Sterile Disposable Filter Units with PES Membrane &#62; 250mL</td>
			<td>Thermo Fisher Scientific</td>
			<td>568-0020</td>
			<td></td>
		</tr>
		<tr>
			<td>Dialysis tubing clips</td>
			<td>Spectrum Labs</td>
			<td>132734</td>
			<td></td>
		</tr>
		<tr>
			<td>6-8 kDa 10 mm Dialysis Tubing</td>
			<td>Spectrum Medical</td>
			<td>132645</td>
			<td></td>
		</tr>
		<tr>
			<td>Superose 6 10/300 GL</td>
			<td>GE Healthcare Life Sciences</td>
			<td>17517201</td>
			<td></td>
		</tr>
		<tr>
			<td>Hi-Res Standard Agarose</td>
			<td>AGTC Bioproducts</td>
			<td>AG500D1</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethidium bromide</td>
			<td>Thermo Fisher Scientific</td>
			<td>BP1302</td>
			<td></td>
		</tr>
		<tr>
			<td>Orange G</td>
			<td>Fisher Scientific</td>
			<td>0-267</td>
			<td></td>
		</tr>
		<tr>
			<td>Hyladder 10kb, 500 lanes</td>
			<td>Denville Scientific</td>
			<td>CB4225-4</td>
			<td></td>
		</tr>
	</tbody>
</table>

assembly and purification of prototype foamy virus intasomes

A definición de función y paso necesario del ciclo de vida de retrovirus es la integración del genoma viral en el genoma del anfitrión. Los retrovirus codifican enzima integrasa (IN) que cataliza la unión covalente de viral a anfitrión DNA, que se conoce como transferencia de cadena. Integración puede ser modelada en vitro con IN retrovirus recombinante y oligómeros de ADN mímico los extremos del genoma viral. Con el fin de recapitular más de cerca la reacción de integración que se presenta en vivo, integración complejos son ensamblados de oligómeros sintéticos y recombinante IN por diálisis en un tampón de menor concentración de sal. La integración compleja, llamada un intasome, puede ser purificada por cromatografía por exclusión de tamaño. En el caso de virus espumoso de los prototipos (PFV), el intasome es un tetrámero de IN y oligómeros de ADN dos y se separa fácilmente en monomérica y oligómero gratuito ADN. La eficacia de la integración de intasomes PFV puede ensayarse bajo una variedad de condiciones experimentales para comprender mejor la dinámica y la mecánica de integración retroviral.

Intasomes PFV son ensamblados de IN recombinante y vDNA. Después del montaje, intasomes son purificadas por segundos (figura 1). Actividad de integración de cada fracción se ensayaron con un superenrollado ADN blanco y agarosa electroforesis en gel (figura 2). Este gel es reflejado con un analizador fluorescente para detectar EtBr (y fluoróforo, si se utiliza el fluoróforo vDNA). Usando software de análisis de imagen, volú...

Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

Assembly and Purification of Prototype Foamy Virus Intasomes

Integrasa de retrovirus recombinante y oligómeros de ADN mímico extremos de DNA virales pueden formar un complejo enzimático activo conocido como un intasome. Intasomes puede ser usada para estudios bioquímicos, estructurales y cinéticos. Este protocolo detalla cómo montar y purificar el prototipo virus espumoso de los intasomes.

Asamblea y purificación del prototipo Virus espumoso de los Intasomes

A defining feature and necessary step of the retrovirus life cycle is the integration of the viral genome into the host genome. All retroviruses encode an ...

assembly-and-purification-of-prototype-foamy-virus-intasomes

Research

JoVE Journal

Immunology and Infection

5.4K vistas.  The Ohio State University College of Medicine. Integrasa de retrovirus recombinante y oligómeros de ADN mímico extremos de DNA virales pueden formar un complejo enzimático activo conocido como un intasome. Intasomes puede ser usada para estudios bioquímicos, estructurales y cinéticos. Este protocolo detalla cómo montar y purificar el prototipo virus espumoso de los intasomes.

Video: Assembly and Purification of Prototype Foamy Virus Intasomes

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal phase during establishment of infection in a given host. Consequently, study of encapsidation deciphers the information regarding the know-how of the mechanism regulating virus assembly to form infectious virions. Such information is vital in formulating novel methods of curbing virus spread and disease control. Virus encapsidation can be studied in vivo and in vitro. Genome encapsidation in vivo is a highly regulated selective process involving macromolecular interactions and subcellular compartmentalization. Therefore, study leading to dissect events encompassing virus encapsidation in vivo would provide basic knowledge to understand how viruses proliferate and assemble. Recently in vitro encapsidation has been exploited for the research in the area of biomedical imaging and therapeutic applications. Non-enveloped plant viruses stand far ahead in the venture of in vitro encapsidation of the negatively charged foreign material. Brome mosaic virus (BMV), a non-enveloped multicomponent RNA virus pathogenic to plants, has been used as a model system for studying genome packaging in vivo and in vitro. For encapsidation assays in Nicotiana benthamiana plants, Agrobacterium -mediated transient expression, refer to as agroinfiltration, is an efficient and robust technique for the synchronized delivery and expression of multiple components to the same cell. In this approach, a suspension of Agrobacterium tumefaciens cells carrying binary plasmid vectors carrying cDNAs of desiredviral mRNAs is infiltrated into the intercellular space withina leaf using nothing more sophisticated than a 1 ml disposable syringe (without needle). This process results in the transfer of DNA insert into plant cells; the T-DNA insert remains transiently in the nucleus and is then transcribed by the host polymerase II, leading to the transient expression. The resulting mRNA transcript (capped and polyadenylated) is then exported to the cytoplasm for translation. After approximately 24 to 48 hours of incubation,sections of infiltrated leaves can be sampled for microscopyor biochemical analyses. Agroinfiltration permits large numbers (hundreds to thousands) of cells to be transfected simultaneously. For in vitro encapsidation, purified virions of BMV are dissociated into capsid protein by dialyzing against dissociation buffer containing calcium chloride followed by removal of RNA and un-dissociated virions by centrifugation. Genome depleted capsid protein subunits are then reassembled with desired viral genome components or non-viral components such as indocyanine dye.

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

A simple, efficient and robust way to synchronize the delivery of multiple viral components to plant cells via Agrobacterium-mediated transient expression is described. This approach is amenable for studying replication, encapsidation followed by in vitro reassembly of non-viral components into genome depleted optical viral ghosts suitable for biomedical applications.

Simple y robusto En vivo Y In vitro Enfoque para el estudio de ensamblaje del virus

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal ...

Investigación

Inmunología e Infección

Affinity Purification of Influenza Virus Ribonucleoprotein Complexes from the Chromatin of Infected Cells

Like all negative-strand RNA viruses, the genome of influenza viruses is packaged in the form of viral ribonucleoprotein complexes (vRNP), in which the single-stranded genome is encapsidated by the nucleoprotein (NP), and associated with the trimeric polymerase complex consisting of the PA, PB1, and PB2 subunits. However, in contrast to most RNA viruses, influenza viruses perform viral RNA synthesis in the nuclei of infected cells. Interestingly, viral mRNA synthesis uses cellular pre-mRNAs as primers, and it has been proposed that this process takes place on chromatin1. Interactions between the viral polymerase and the host RNA polymerase II, as well as between NP and host nucleosomes have also been characterized1,2.
Recently, the generation of recombinant influenza viruses encoding a One-Strep-Tag genetically fused to the C-terminus of the PB2 subunit of the viral polymerase (rWSN-PB2-Strep3) has been described. These recombinant viruses allow the purification of PB2-containing complexes, including vRNPs, from infected cells. To obtain purified vRNPs, cell cultures are infected, and vRNPs are affinity purified from lysates derived from these cells. However, the lysis procedures used to date have been based on one-step detergent lysis, which, despite the presence of a general nuclease, often extract chromatin-bound material only inefficiently. 
Our preliminary work suggested that a large portion of nuclear vRNPs were not extracted during traditional cell lysis, and therefore could not be affinity purified. To increase this extraction efficiency, and to separate chromatin-bound from non-chromatin-bound nuclear vRNPs, we adapted a step-wise subcellular extraction protocol to influenza virus-infected cells. Briefly, this procedure first separates the nuclei from the cell and then extracts soluble nuclear proteins (here termed the "nucleoplasmic" fraction). The remaining insoluble nuclear material is then digested with Benzonase, an unspecific DNA/RNA nuclease, followed by two salt extraction steps: first using 150 mM NaCl (termed "ch150"), then 500 mM NaCl ("ch500") (Fig. 1). These salt extraction steps were chosen based on our observation that 500 mM NaCl was sufficient to solubilize over 85% of nuclear vRNPs yet still allow binding of tagged vRNPs to the affinity matrix.
After subcellular fractionation of infected cells, it is possible to affinity purify PB2-tagged vRNPs from each individual fraction and analyze their protein and RNA components using Western Blot and primer extension, respectively. Recently, we utilized this method to discover that vRNP export complexes form during late points after infection on the chromatin fraction extracted with 500 mM NaCl (ch500)3.

Influenza viruses replicate their RNA genome in association with host-cell chromatin. Here, we present a method to purify intact viral ribonucleoprotein complexes from the chromatin of infected cells. Purified viral complexes can be analyzed by both Western blot and primer extension of protein and RNA content, respectively.

Purificación por afinidad de los complejos de ribonucleoproteína Influenza Virus de la cromatina de las células infectadas

Like all negative-strand RNA viruses, the genome of influenza viruses is packaged in the form of viral ribonucleoprotein complexes (vRNP), in which the ...

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

The opportunistic pathogen Legionella pneumophila is an amoeba-resistant bacterium, which also replicates in alveolar macrophages thus causing the severe pneumonia "Legionnaires' disease"1. In protozoan and mammalian phagocytes, L. pneumophila employs a conserved mechanism to form a specific, replication-permissive compartment, the "Legionella-containing vacuole" (LCV). LCV formation requires the bacterial Icm/Dot type IV secretion system (T4SS), which translocates as many as 275 "effector" proteins into host cells. The effectors manipulate host proteins as well as lipids and communicate with secretory, endosomal and mitochondrial organelles2-4.
The formation of LCVs represents a complex, robust and redundant process, which is difficult to grasp in a reductionist manner. An integrative approach is required to comprehensively understand LCV formation, including a global analysis of pathogen-host factor interactions and their temporal and spatial dynamics. As a first step towards this goal, intact LCVs are purified and analyzed by proteomics and lipidomics.
The composition and formation of pathogen-containing vacuoles has been investigated by proteomic analysis using liquid chromatography or 2-D gel electrophoresis coupled to mass-spectrometry. Vacuoles isolated from either the social soil amoeba Dictyostelium discoideum or mammalian phagocytes harboured Leishmania5, Listeria6, Mycobacterium7, Rhodococcus8, Salmonella9 or Legionella spp.10. However, the purification protocols employed in these studies are time-consuming and tedious, as they require e.g. electron microscopy to analyse LCV morphology, integrity and purity. Additionally, these protocols do not exploit specific features of the pathogen vacuole for enrichment.
The method presented here overcomes these limitations by employing D. discoideum producing a fluorescent LCV marker and by targeting the bacterial effector protein SidC, which selectively anchors to the LCV membrane by binding to phosphatidylinositol 4-phosphate (PtdIns(4)P)3,11 . LCVs are enriched in a first step by immuno-magnetic separation using an affinity-purified primary antibody against SidC and a secondary antibody coupled to magnetic beads, followed in a second step by a classical Histodenz density gradient centrifugation12,13 (Fig. 1).
A proteome study of isolated LCVs from D. discoideum revealed more than 560 host cell proteins, including proteins associated with phagocytic vesicles, mitochondria, ER and Golgi, as well as several GTPases, which have not been implicated in LCV formation before13. LCVs enriched and purified with the protocol outlined here can be further analyzed by microscopy (immunofluorescence, electron microscopy), biochemical methods (Western blot) and proteomic or lipidomic approaches.

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

This article describes a method for the isolation and purification of intact Legionella-containing vacuoles (LCVs) from amoeba and macrophages. The two-step protocol comprises LCV enrichment by immuno-magnetic separation using an antibody against a bacterial LCV marker and further purification by density gradient centrifugation.

La purificación del patógeno a partir de vacuolas<em&gt; Legionella</em&gt; Infectados por fagocitos

The opportunistic pathogen Legionella pneumophila is an amoeba-resistant bacterium, which also replicates in alveolar macrophages thus causing the severe ...

Rescue of Recombinant Newcastle Disease Virus from cDNA

Newcastle disease virus (NDV), the prototype member of the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented, negative-sense, single-stranded, enveloped RNA virus (Figure 1) with potential applications as a vector for vaccination and treatment of human diseases. In-depth exploration of these applications has only become possible after the establishment of reverse genetics techniques to rescue recombinant viruses from plasmids encoding their complete genomes as cDNA2-5. Viral cDNA can be conveniently modified in vitro by using standard cloning procedures to alter the genotype of the virus and/or to include new transcriptional units. Rescue of such genetically modified viruses provides a valuable tool to understand factors affecting multiple stages of infection, as well as allows for the development and improvement of vectors for the expression and delivery of antigens for vaccination and therapy. Here we describe a protocol for the rescue of recombinant NDVs.

Newcastle disease virus (NDV) has been extensively studied in the last few years in order to develop new vectors for vaccination and therapy, among others. These studies have been possible due to techniques to rescue recombinant virus from cDNA, such as those we describe here.

Rescate del virus de la enfermedad de Newcastle recombinante a partir de cDNA

Newcastle disease virus (NDV), the prototype member of  the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented,  negative-sense, ...

Isolation, Identification, and Purification of Murine Thymic Epithelial Cells

The thymus is a vital organ for T lymphocyte development. Of thymic stromal cells, thymic epithelial cells (TECs) are particularly crucial at multiple stages of T cell development: T cell commitment, positive selection and negative selection. However, the function of TECs in the thymus remains incompletely understood. In the article, we provide a method to isolate TEC subsets from fresh mouse thymus using a combination of mechanical disruption and enzymatic digestion. The method allows thymic stromal cells and thymocytes to be efficiently released from cell-cell and cell-extracellular matrix connections and to form a single-cell suspension. Using the isolated cells, multiparameter flow cytometry can be applied to identification and characterization of TECs and dendritic cells. Because TECs are a rare cell population in the thymus, we also describe an effective way to enrich and purify TECs by depleting thymocytes, the most abundant cell type in the thymus. Following the enrichment, cell sorting time can be decreased so that loss of cell viability can be minimized during purification of TECs. Purified cells are suitable for various downstream analyses like Real Time-PCR, Western blot and gene expression profiling. The protocol will promote research of TEC function and as well as the development of in vitro T cell reconstitution.

Here we describe an efficient method for isolation, identification, and purification of mouse thymic epithelial cells (TECs). The protocol can be utilized for studies of thymus function for normal T cell development, thymus dysfunction, and T cell reconstitution.

El aislamiento, la identificación y purificación de células epiteliales del timo murino

The thymus is a vital organ for T lymphocyte development. Of thymic stromal cells, thymic epithelial cells (TECs) are particularly crucial at multiple ...

Neutrophil Isolation and Analysis to Determine their Role in Lymphoma Cell Sensitivity to Therapeutic Agents

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of inflammation. They are key players in the innate immune system and play major roles in cancer biology. Neutrophils have been proposed as key mediators of malignant transformation, tumor progression, angiogenesis and in the modulation of the antitumor immunity; through their release of soluble factors or their interaction with tumor cells. To characterize the specific functions of neutrophils, a fast and reliable method is coveted for in vitro isolation of neutrophils from human blood. Here, a density gradient separation method is demonstrated to isolate neutrophils as well as mononuclear cells from the blood. The procedure consists of layering the density gradient solution such as Ficoll carefully above the diluted blood obtained from patients diagnosed with chronic lymphocytic leukemia (CLL), followed by centrifugation, isolation of mononuclear layer, separation of neutrophils from RBCsby dextran then lysis of residual erythrocytes. This method has been shown to isolate neutrophils &#8805; 90 % pure. To mimic the tumor microenvironment, 3-dimensional (3D) experiments were performed using basement membrane matrix such as Matrigel. Given the short half-life of neutrophils in vitro, 3D experiments with fresh human neutrophils cannot be performed. For this reason promyelocytic HL60 cells are differentiated along the granulocytic pathway using the differentiation inducers dimethyl sulfoxide (DMSO) and retinoic acid (RA). The aim of our experiments is to study the role of neutrophils on the sensitivity of lymphoma cells to anti-lymphoma agents. However these methods can be generalized to study the interactions of neutrophils or neutrophil-like cells with a large range of cell types in different situations.

Neutrophils are the most abundant type of white blood cells. The isolation of neutrophils from human blood by density gradient separation method and the differentiation of human promyelocytic (HL60) cells along the granulocytic pathway are described here; to test their role on sensitivity of lymphoma cells to anti-lymphoma agents.

Aislamiento de neutrófilos y análisis para determinar su papel en el linfoma de células sensibles a los agentes terapéuticos

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of ...

Evaluation of the Efficacy And Toxicity of RNAs Targeting HIV-1 Production for Use in Gene or Drug Therapy

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential to be used as drug therapies for HIV-1 infection. Post-integration inhibitors include ribozymes, short hairpin (sh) RNAs, small interfering (si) RNAs, U1 interference (U1i) RNAs and RNA aptamers. Many of these have been identified using transient co-transfection assays with an HIV-1 expression plasmid and some have advanced to clinical trials. In addition to measures of efficacy, small RNAs have been evaluated for their potential to affect the expression of human RNAs, alter cell growth and/or differentiation, and elicit innate immune responses. In the protocols described here, a set of transient transfection assays designed to evaluate the efficacy and toxicity of RNA molecules targeting post-integration steps in the HIV-1 replication cycle are described. We have used these assays to identify new ribozymes and optimize the format of shRNAs and siRNAs targeting HIV-1 RNA. The methods provide a quick set of assays that are useful for screening new anti-HIV-1 RNAs and could be adapted to screen other post-integration inhibitors of HIV-1 replication.

Methods to evaluate the efficacy and toxicity of RNA molecules targeting post-integration steps of the HIV-1 replication cycle are described. These methods are useful for screening new molecules and optimizing the format of existing ones.

Evaluación de la eficacia y la toxicidad de los ARN del VIH-1 Orientación de la producción para uso en terapia génica o de drogas

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential ...

Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral evolution. Here we describe the construction of an infectious clone for Zika virus (ZIKV), which is currently causing an explosive outbreak in the Americas. To prevent toxicity to bacteria that is commonly observed with flavivirus-derived plasmids, we generated a two-plasmid system which separates the genome at the NS1 gene and is more stable than full-length constructs that could not be successfully recovered without mutations. After digestion and ligation to join the two fragments, full-length viral RNA can be generated by in vitro transcription with T7 RNA polymerase. Following electroporation of transcribed RNA into cells, virus was recovered that exhibited similar in vitro growth kinetics and in vivo virulence and infection phenotypes in mice and mosquitoes, respectively.

This protocol describes the recovery of infectious Zika virus from a two-plasmid infectious cDNA clone.

Rescate y Caracterización del Virus Recombinante de un Nuevo Mundo Zika Virus Infectious Clone

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral ...

Detection and Removal of Nuclease Contamination During Purification of Recombinant Prototype Foamy Virus Integrase

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared to IN from other retroviruses, PFV IN is more soluble and more amenable to experimental manipulation. Additionally, it is sensitive to clinically relevant human immunodeficiency virus (HIV-1) IN inhibitors, suggesting that the catalytic mechanism of PFV IN is similar to that of HIV-1 IN. IN catalyzes the covalent joining of viral complementary DNA (cDNA) to target DNA in a process called strand transfer. This strand transfer reaction introduces nicks to the target DNA. Analysis of integration reaction products can be confounded by the presence of nucleases that similarly nick DNA. A bacterial nuclease has been shown to co-purify with recombinant PFV IN expressed in Escherichia coli (E. coli). Here we describe a method to isolate PFV IN from the contaminating nuclease by heparin affinity chromatography. Fractions are easily screened for nuclease contamination with a supercoiled plasmid and agarose gel electrophoresis. PFV IN and the contaminating nuclease display alternative affinities for heparin sepharose allowing a nuclease-free preparation of recombinant PFV IN suitable for bulk biochemical or single molecule analysis of integration.

Recombinant prototype foamy virus integrase protein is often contaminated with a bacterial nuclease during purification. This method identifies nuclease contamination and removes it from the final preparation of the enzyme.

Detección y eliminación de nucleasa contaminación durante la purificación de prototipo recombinante Virus Espumoso integrasa

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared ...

Rapid, Safe, and Simple Manual Bedside Nucleic Acid Extraction for the Detection of Virus in Whole Blood Samples

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for the rapid bedside inactivation of the Ebola virus during blood sampling for safe nucleic acid (NA) tests by adding a commercial lysis/binding buffer directly into the vacuum blood collection tubes. Using this bedside inactivation approach, we have developed a safe, rapid, and simplified bedside NA extraction method for the subsequent detection of a virus in lysis/binding buffer-inactivated whole blood. The NA extraction is directly performed in the blood collection tubes and requires no equipment or electricity. 
After the blood is collected into the lysis/binding buffer, the contents are mixed by flipping the tube by hand, and the mixture is incubated for 20 min at room temperature. Magnetic glass particles (MGPs) are added to the tube, and the contents are mixed by flipping the collection tube by hand. The MGPs are then collected on the side of the blood collection tube using a magnetic holder or a magnet and a rubber band. The MGPs are washed three times, and after the addition of elution buffer directly into the collection tube, the NAs are ready for NA tests, such as qPCR or isothermal loop amplification (LAMP), without the removal of the MGPs from the reaction. The NA extraction method is not dependent on any laboratory facilities and can easily be used anywhere (e.g., in field hospitals and hospital isolation wards). When this NA extraction method is combined with LAMP and a portable instrument, a diagnosis can be obtained within 40 min of the blood collection.

Here, we present a protocol for the rapid virus nucleic acid extraction from the virus-inactivated whole blood. The extraction is performed directly in the blood collection tubes and requires no equipment or electricity. The method is not dependent on laboratory facilities and can be used anywhere (e.g., in field hospitals).

Extracción rápido, seguro y sencillo Manual cabecera de ácido nucleico para la detección del Virus en muestras de sangre entera

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for ...