이 작품은 NIH AI099854 및 AI126742 키에 의해 지원 되었다.

1. 어 닐 링 vDNA의
<ol><li>결합 1 X 10 버퍼 (10 X 10 재고: 100 mM Tris HCl, pH 8.0, 1 M NaCl, 10 mM EDTA), 10 µ M (5' 3' ATTGTCATGGAATTTTGTATATTGAGTGGCGCCCGAACAG, 100 µ M 재고), 올리고 1과 10 µ M 1.5 mL의 최종 볼륨에 올리고 2 (5' 3' CTGTTCGGGCGCCACTCAATATACAAAATTCCATGACA, 100 µ M 재고) . Aliquot 25 µ L 60 0.2 mL 중 합 효소 연쇄 반응 (PCR) 튜브로. 참고: 응용 프로그램에 따라 올리고 fluorophores 또는 5'-끝에 올리고 2의 또는 태그 기본 13 5'-끝 올리고 1에서 내부 아미노 T으로 수정할 수 있습니다. 수정 된 올리고 어 닐 링 전에 고성능 액체 크로마토그래피 (HPLC)에 의해 정화 한다. 우리는 intasome 어셈블리 효율을 10 배 감소 5'-끝 Cy3 또는 Cy5 fluorophore의 라벨 올리고 2 나타났습니다. 내부 fluorophore 라벨 어셈블리 효율을 감소 하지 않습니다.</li>
	<li>다음 시간과 온도 thermocycler를 사용 하 여 anneal: 1에서 99 주기 94.0 ˚C 3 분에 주기 (94.0 ˚C 1 분, 93.6 ˚C 1 분) 주기 당 0.8 ˚C 두 온도 감소 (마지막 주기는 14.8 ˚C 1 분, 14.4 ˚C 1 분) 4.0 ˚C에 저장 하 고.</li>
	<li>모든 60 튜브에서 어 닐 링 반응 결합. 2 0.5 mL 3 kDa 분자량 컷오프 (MWCO) ultracentrifugal 필터 농도 단위 500 µ L을 로드 합니다. 실 온 (RT)에서 10 분 동안 14000 x g에서 microcentrifuge 원심 분리에 의해 단련 된 vDNA을 집중 한다. 참고: retentate 볼륨 각 농도 단위 µ L ~ 50 이어야 한다.</li>
	<li>삭제를 통해 흐름. 각 필터 단위를 나머지 단련된 vDNA의 250 µ L를 추가 합니다. 스핀을 반복 하 고 삭제를 통해 흐름. 450 µ L 테로 세 번 세척 하 여 테 버퍼 (10 mM Tris HCl, pH 8.0, 1 mM EDTA)에 exchange를 버퍼링 합니다.</li>
	<li>필터 장치 및 실시간에 2 분 동안 1000 x g에서 스핀 반전 각 필터 단위에 대 한 최종 retentate 볼륨 ~ 50 µ L. retentates과 1.5 mL 스크류 캡 튜브에 결합 해야 합니다.</li>
	<li>vDNA의 260 nm 자외선 (UV) 흡 광도 측정 합니다. 마지막 어 금 니 DNA 농도 계산 하기 위해이 값을 사용 합니다. 이 vDNA의 소멸 계수 (ε260) 622,803 c m-1 M-1 이며 그 분자량은-20 ˚C에 23,972 검사 저장소.</li>
</ol>2. Intasome 어셈블리
<ol><li>가능 하면 변수 온도와 작은 방에 intasome 어셈블리를 수행 합니다. 약 18-22 ˚C를 온도 조정 합니다. 참고: 우리의 경험 4 ˚C에서 intasome 어셈블리 비효율적입니다.</li>
	<li>저 어 접시에 볶음 바 2 리터 비 커에 투 석 버퍼 (20 mM 두번째-트리 스 프로 판, pH 7.5, 200 m NaCl, 2 m m dithiothreitol (DTT), 25 µ M ZnCl2m)의 1 리터를 준비 합니다. 적어도 6 h에 대 한 18-22 ˚C 방에 버퍼 equilibrate</li>
	<li>intasomes를, 50 mM 두번째-트리 스 프로 판, pH 7.5, 500 mM NaCl, 120 µ M PFV에, 및 150 µ L의 전체 볼륨에 50 µ M vDNA 결합. 참고: PFV에 오염 nuclease 활동7,8의 무료 되어야 합니다. PFV에서 농도 경우 너무 희석 120 µ M에서 150 µ L 볼륨에 맞게 다음 200 µ L 최종 볼륨을 증가 하는 것이 가능 하다. 이 단계는 중요 한 요소는 vDNA (2.4:1) 하에서의 어 금 니 비율을 유지 하 고 충분 한 복잡 한 착 색 인쇄기는 동안 시각화 있습니다.</li>
	<li>10 m m 6-8 kDa MWCO 투 석 튜브와 두 배 증류수 (ddH2O), 또는 높은 순도 물을 사용할 수 있는 클립의 ~ 10 cm 긴 조각을 청소. 튜브의 한쪽 끝을 클립. 참고: 투 석 배관 주의 실험실 공간에서 어떤 가능한 오염 든 지 방지 하기 위해 처리 되어야 합니다.</li>
	<li>투 석 배관 린스 버퍼 (50mm 두번째-트리 스 프로 판, pH 7.5, 500 mM NaCl)의 15 mL를 확인 합니다. 1-2 mL 린스 버퍼와 3 번 투 석 튜브의 내부를 헹 굴. 피 펫과 얇은 젤 팁 로드 가능한 린스 버퍼의 제거.</li>
	<li>필요한 경우 사용 하 여 깨끗 한 면도날 또는 메스 얇은 젤 로드 팁 튜브의 끝에 도달할 수 있도록 투 석 튜브를 잘라.</li>
	<li>피 펫 및 얇은 젤 팁 로드 투 석 튜브에 2.3 단계에서 intasome 어셈블리를 전송. 투 석 배관, 튜브 내에서 도입 하는 공기의 양을 최소화의 오픈 엔드 클립. 투 석 버퍼 튜브를 놓습니다.</li>
	<li>Dialyze 부드러운 교 반 튜브 회전 하지만 소용돌이와 하룻밤 (16-20 h). 투 석 배관 침수 및 모바일 인지 확인 합니다. 약 1 시간 후 튜브 안에 보이는 침전을 관찰 합니다. 참고: Cy3와 Cy5 붙일 표시 vDNA 침전 더 분명 하다. 이것은 끝 표시와 내부적으로 레이블이 형광 vDNA 마찬가지입니다.</li>
</ol>3. Intasome 가용 화
<ol><li>2 준비 넓은 깨끗 한 표면에 새로운 메스 또는 면도칼 블레이드와 2-4 m m 200 µ L 팁의 끝에서 제거 하 여 피 펫 팁을 낳았다. 참고: 도움말 3.3-3.5 단계에서 사용 됩니다.</li>
	<li>투 석 버퍼에서 투 석 튜브를 제거 합니다. 클립 근처 튜빙의 끝에 남아 있을 수 있습니다 투 버퍼 intasome 샘플의 희석을 방지 하기 위해 작은 피 펫 팁는 micropipette을 사용 하 여 모든 초과 투 버퍼를 제거 하. 투 석 튜브의 한쪽 끝에서 클립을 제거 합니다.</li>
	<li>사용 넓은 얼음에 1.5 mL 튜브에 투 석 배관 내부 침전 물의 포함 하 여 샘플을 전송 하려면 3.1 단계에서 피 펫 팁을 낳았다. 참고 복구 된 자료;의 총 볼륨 총 볼륨은 일반적으로 ~ 140 µ L.</li>
	<li>침전 된 샘플은 200 m m NaCl; 320 mM NaCl의 최종 농도에 소금 재고 5 M NaCl 솔루션의 적절 한 볼륨을 추가 하 여 증가. 예를 들어 150 µ L의 샘플을 추가 3.9 µ L 5 M NaCl과 1.1 µ L ddH2O 155 µ L. 전송 얼음 양동이와 마지막 볼륨에 대 한 샘플 4 ˚C 찬 방으로.</li>
	<li>사용 넓은 단계 resuspend를 pipetting으로 침전을 solubilize 3.1에서에서 피 펫 팁을 낳았다. 적어도 1 h. 침전의 대부분 솔루션에가 서 관찰에 대 한 모든 20 분을 반복 합니다. 참고: resuspend 침전에 Pipetting 수 중지 때 명백한 침전 시간 점 사이 더 이상 눈에 띄게 감소. VDNA는 레이블이 또는 내부적으로 분류 때 침전 육안 검사에 따라 ~ 90%로 감소 된다. Cy5 끝 vDNA를 표시, 경우 침전 감소만 ~ 20%; vDNA 라는 fluorophore 엔드와 침전의 대부분 solubilize 하지 것 이다. 효과적으로 solubilized 침전의 양 변수 이며, 실험적으로 결정 되어야 합니다.</li>
</ol>4. Intasome 정화
<ol><li>버퍼 (20 mM 두번째-트리 스 프로 판, pH 7.5, 320 mM NaCl, 10% 글리세롤)를 실행 하는 크기 배제 크로마토그래피 (SEC)의 250 mL를 준비 합니다. 살 균 필터 버퍼 0.2 µ m와 단위 필터와 4 ˚C에 저장 합니다. 참고: 모든 정화 단계 4 ˚C 차가운 방에 수행 됩니다.</li>
	<li>복사해올된 agarose 초 열 equilibrate (직경 = 10 밀리미터; 길이 = 300 mm; 볼륨 침대 24 mL =; 샘플 량 = 25-500 µ L, 최대 압력 = 1.5 MPa; 제외 제한 = 4 x 107 다; 분자 무게 분리 5, 5000 kDa 사이의 참조 테이블 매트 erials) 0.4 mL/min의 유량에서 초 실행 버퍼. 참고:이 정화 그들이 효과적으로 Superose 12 10/300 GL 또는 Superose 6 증가 등 44 kDa에서 300 kDa 분리 수 있다면 다른 크기 제외 열에 적응 시킬 수 있습니다. Superose 12 10/300 GL는 낮은 해상도, 봉우리의 더 많은 중복을 선도. 반대로, Superose 6 증가 높은 해상도 하 고 더 나은 분리를 제공 합니다.</li>
	<li>펠 렛의 모든 나머지 침전을 4 ˚C에서 10 분 동안 14000 x g에서 microfuge에서 intasome 샘플 원심 조심 스럽게 제거는 상쾌한. 200 µ L 주입 루프 (~ 200 μ를 저장할 수 있는 튜브) 상쾌한을 로드 합니다. SEC 열에 샘플을 적용 됩니다. 참고: 작은 로드 볼륨 수 초에 의해 더 큰 해상도</li>
	<li>25 mL 초 실행 버퍼 및 수집 270 µ L. 95 분수와 함께 elute 관찰 SEC 크로마 세 A280/A260 봉우리 (그림 1)를 표시 합니다. 참고: 첫 번째 집계 (~9.0-11.5 mL 차입), PFV tetramer intasome 피크 (~12.0-14.75 mL 차입) 및 무료 vDNA 피크 (~15.0-18.0 mL)와 모노 머 PFV에 이어야 한다.</li>
</ol>5. 통합 가닥 전송 분석 결과, 분수 선택 및 저장
<ol><li>각 intasome 피크 분수 및 50의 2 µ L 결합 ng 3 kb supercoiled 플라스 미드 DNA (재고 농도 50 ng / µ L) 15 µ L의 최종 반응 볼륨에서 반응 버퍼 (10 mM tris 두번째 프로 판, pH 7.5, 110 m NaCl, 5mm MgSO4, 4 µ M ZnCl2, 10 m DTT m m)에. 5 분 동안 37 ˚C에서 품 어.</li>
	<li>아니 추가 PFV intasome와 부정적인 컨트롤을 포함 합니다. (20 mg/mL 재고 솔루션) 0.75 µ L 성분 K와 반응 및 0.75 µ L SDS 중지 (10% 주식 솔루션). 1 헤 게 샘플 나중 분석-20 ˚C에서 필요에 따라 55 ˚C에서 품 어. 참고:이 분석 결과 통합 활동의 질적 평가. 각 분수의 intasome 어 금 니 농도이 분석 결과 이전 결정 되지 않습니다. 분수 통합 가닥 전송 분석 결과에 포함 되어 저장 될 수 있다 통합까지 (를 포함 하 여 하룻밤 저장) 얼음에 활동은 확인 되 고 선택한 분수는 aliquoted. 여기 우리는 pMP2, pUC19 파생9를 사용합니다. 우리는 또한 성공적으로 5.4 kb 플라스 미드 pcDNA 3.1을 사용 했습니다. 으로 확인 될 수 있는 모든 플라스 미드 원형, 선형, 편안 하 고 supercoiled 형태의 통합을 위한 대상으로 사용할 수 있습니다.</li>
	<li>1의 X 태 버퍼 (40 m m 트리 아세테이트, 1 mM EDTA) 0.1 μ g/mL ethidium 평범한 사람 (EtBr, 10 mg/mL 재고 솔루션)10에서 볼륨 (w/v) agarose 젤 당 120 mL 1% 무게를 준비 합니다. Agarose 솔루션을 용 해 하 고 15 cm x 10 cm 젤 캐스팅 쟁반에 부 어. 5 밀리미터 넓은, 0.75 m m 두께 웰 스도 15 잘 빗을 삽입 합니다. 참고: 좁은 우물 1.5 m m 두꺼운 우물에 비해 더 나은 밴드 해상도 얻을.</li>
	<li>허용 주위 온도에서 응고 하 젤. 0.1 μ g/mL EtBr로 1 X 태에서 젤 담가.</li>
	<li>5.2 단계에서 각 통합 반응 3 µ L 50% 글리세롤을 추가 합니다. 전체 반응 볼륨 젤을 로드 합니다. 마커의 10 kb DNA 크기 (150 ng / µ L 재고 농도); 샘플의 양쪽에 차선 1 µ L 로드 즉, DNA 크기 마커 샘플 레인 측면 해야 합니다.</li>
	<li>외부 레인에서 6 µ L 오렌지 G 염료 (0.25% 오렌지 G, 30% 글리세롤)을 로드 합니다. 정 전압, 1 시간, 또는 오렌지 G 염료 전면 젤의 끝에 도달할 때까지 주위 온도에 10 V/cm (100 V)에서 젤을 실행 합니다.</li>
	<li>바로 형광 스캐너 (532 nm 여기, 610 nm 방출 필터) EtBr을 감지로 설정 agarose 젤 이미지. Fluorophore vDNAs 라는 사용 된 경우 또한 해당 fluorophore 설정으로 이미지. 참고: 예를 들어 감지 Cy5 DNA, 633 nm 여기 및 670 nm 방출 필터를 사용 하 여 이미지 표시. 공동된 통합 제품 (CI, 선형 DNA) ~ 3 kb 크기 true로 실행 한다, unreacted supercoiled 플라스 미드 (SC) 빠른 (~ 2 kb), 실행 해야 하 고 반 사이트 통합 제품 (HSI, 편안한 원형 DNA) 느린 (~3.5 kb)를 실행 해야 합니다. Unreacted vDNA ~ 40 크기 true로 실행 해야 혈압.</li>
	<li>이미징 소프트웨어7각 레인에서 밴드를 계량. CI, HSI, 또는 SC; 각 레인에 DNA의 분수를 계산 vDNA이이 계산에 포함 되지 않습니다. 참고: 통합 효율성, 또는 선형 제품으로 변환 하는 SC의 분수 3 밴드 (HSI + CI + SC)의 총 픽셀 볼륨에 의해 공동된 통합 제품 (CI)의 픽셀 볼륨을 나누어 계산 했다. Intasomes 라는 fluorophore 있다면, HSI와 CI 제품 형광으로 quantitated 또한 수 있습니다.</li>
	<li>가장 공동 통합 활동 분수를 선택 합니다. 참고: 우리의 경험에서 공동으로 행 한 피크 통합 활동 tetrameric PFV intasomes로 식별 단백질 피크와 일치 합니다. 이 분수의 각각의 A280 을 측정 하 고 최종 intasome 농도 계산. Ε280 의 야생 PFV에 여기에 설명 된 두 개의 vDNAs tetramer에 대 한 908,339 c m-1M-1 이며 분자 무게는 225.5 kDa. 농도 SEC 크로마 피크로 가닥 전송 분석 결과에 같은 패턴을 따라야 한다.</li>
	<li>5 µ L aliquots 각 분수를 배포 하 고 스냅 액체 질소에서 동결. Aliquots-80 ˚C에 저장 합니다. 저장을 위해 선택 하는 분수는 일반적으로 200-600 nM 사이.</li>
</ol>

<ol>
	<li>Coffin, J. M., Hughes, S. H., Varmus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Retroviruses. , (1997).</li><li>Valkov, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+and+structural+characterization+of+the+integrase+from+the+prototype+foamy+virus.">Functional and structural characterization of the integrase from the prototype foamy virus.</a> Nucleic Acids Res. 37 (1), 243-255 (2009).</li><li>Hare, S., Gupta, S. S., Valkov, E., Engelman, A., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasome+assembly+and+inhibition+of+DNA+strand+transfer.">Retroviral intasome assembly and inhibition of DNA strand transfer.</a> Nature. 464 (7286), 232-236 (2010).</li><li>Li, M., Lin, S., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Outer+domains+of+integrase+within+retroviral+intasomes+are+dispensible+for+catalysis+of+DNA+integration.">Outer domains of integrase within retroviral intasomes are dispensible for catalysis of DNA integration.</a> Protein Sci. 25 (2), 472-478 (2016).</li><li>Gupta, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solution+conformations+of+prototype+foamy+virus+integrase+and+its+stable+synaptic+complex+with+U5+viral+DNA.">Solution conformations of prototype foamy virus integrase and its stable synaptic complex with U5 viral DNA.</a> Structure. 20 (11), 1918-1928 (2012).</li><li>Jones, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasomes+search+for+a+target+DNA+by+1D+diffusion+which+rarely+results+in+integration.">Retroviral intasomes search for a target DNA by 1D diffusion which rarely results in integration.</a> Nat Commun. 7, 11409 (2016).</li><li>Lopez, M. A., Mackler, R. M., Altman, M. P., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+and+removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Detection and removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Vis Exp. , (2017).</li><li>Lopez, M. A., Mackler, R. M., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Virol Methods. 235, 134-138 (2016).</li><li>Poirier, M. G., Bussiek, M., Langowski, J., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+access+to+DNA+target+sites+in+folded+chromatin+fibers.">Spontaneous access to DNA target sites in folded chromatin fibers.</a> J Mol Biol. 379 (4), 772-786 (2008).</li><li>Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments.">Agarose gel electrophoresis for the separation of DNA fragments.</a> J Vis Exp. (62), (2012).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+reveals+a+novel+octameric+integrase+structure+for+betaretroviral+intasome+function.">Cryo-EM reveals a novel octameric integrase structure for betaretroviral intasome function.</a> Nature. 530 (7590), 358-361 (2016).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+supramolecular+assembly+mediates+lentiviral+DNA+integration.">A supramolecular assembly mediates lentiviral DNA integration.</a> Science. 355 (6320), 93-95 (2017).</li><li>Passos, D. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+structures+and+atomic+model+of+the+HIV-1+strand+transfer+complex+intasome.">Cryo-EM structures and atomic model of the HIV-1 strand transfer complex intasome.</a> Science. 355 (6320), 89-92 (2017).</li><li>Yin, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Rous+sarcoma+virus+intasome.">Crystal structure of the Rous sarcoma virus intasome.</a> Nature. 530 (7590), 362-366 (2016).</li><li>Maertens, G. N., Hare, S., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mechanism+of+retroviral+integration+from+X-ray+structures+of+its+key+intermediates.">The mechanism of retroviral integration from X-ray structures of its key intermediates.</a> Nature. 468 (7321), 326-329 (2010).</li><li>Maskell, D. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+for+retroviral+integration+into+nucleosomes.">Structural basis for retroviral integration into nucleosomes.</a> Nature. 523 (7560), 366-369 (2015).</li></ol>

저자는 공개 없다.

Retroviral 기능 통합을 수행 하 고 바이러스 성 수명 주기를 계속 하는 바이러스 성 게놈 DNA와 복잡 한 multimeric를 형성 한다. Intasome 당 단위체에의 수는 tetramers, octamers, 또는 가능 하 게 더 높은 순서 multimers11,12,,1314수 있습니다. PFV intasomes는 모방 하는 바이러스 성 게놈 DNA 이중 가닥 DNA 올리고도 재조합 ...

호스트 게놈으로 바이러스 성 게놈의 통합 모든 레트로 바이러스1의 라이프 사이클에는 필수 단계입니다. 바이러스 성 효소 integrase (IN) catalyzes 호스트 DNA에 바이러스 성 DNA 게놈의 각 끝의 공유 결합. 세포 감염 동안에 통합을 중재 하는 사전 통합 복잡 한의 일부가입니다. 재조합에 더블 좌초 DNA 올리고 흉내 낸 바이러스 성 DNA 끝에 complexed는 대상 DNA 생체 외에서2에 통합을 수행할 수 있습니다. 일반적인 통합 분석 결과 생체 외에서 supercoiled 플라스 미드 DNA 대상으로 사용합니다. 플라스 미드를 모두 바이러스 성 DNA 올리고 (vDNA)의 통합 선형 제품 귀착되 고 공동된 통합 (그림 2A) 이라고 불린다. 통합 분석 결과 생체 외에서 covalently 편안한 원에서 결과 대상 플라스 미드에 참가 한 vDNA와 제품을 얻을 또한 수 있습니다. 이 반 사이트 통합 제품 분석 결과 체 외의 인 것 처럼 보인다.
재조합에 및 vDNA 통합에서 생체 외에서수행할 수 있습니다 하지만 그들은 역학의 연구 또는 통합 복합물의 구조에 대 한 이상적인 약 단위체에 관련 시각화 모호한 것 때. 순화 통합 복합물, 또는 "intasomes," 동적 단일 분자 분석 또는 구조 연구에 필요한 있습니다. PFV에 및 vDNAs 수 있습니다 조립 될 투 석 하 여 상대적으로 높은 소금 농도 버퍼에서 낮은 염 농도3,4. 투 석, 한 침전 동안 양식. 이 침전 물은 투 석에서 제거 되 고 소금 농도 증가. 더 높은 소금 농도 촉진 포함 PFV intasomes solubilizes. intasomes 다음 크기 배제 크로마토그래피 (SEC)에 의해 정화 된다. 재조합 프로토 타입 거품 바이러스 (PFV)에 225 µ M5농도에서 솔루션에 단위체로 존재 하기 위하여 보였다. 초 분류 (44.4 kDa) 단위체 PFV와 무료 vDNA (24.0 kDa)에서 효과적으로 tetramer PFV에 및 2 개의 vDNAs를 포함 하는 PFV intasomes (225.5 kDa)를 구분 합니다. PFV intasomes 냉동 수 있습니다 그리고-80 ˚C에 저장의 적어도 6 개월에 대 한 통합 활동을 유지 합니다.
재조합 PFV intasomes 아미노산 대체 또는 잘림 돌연변이 또는 fluorophores 또는 biotin4,6으로 표시 하는 vDNAs에 포함 하도록 수정할 수 있습니다. 순화 PFV intasomes는 쉽게 DNA에서 생체 외에서supercoiled 플라스 미드 대상으로 통합을 수행합니다. Intasomes과 대량 생 화 확 적인 통합 분석 돌연변이, 억제제, 또는 다른 화학 첨가제에의 효과 테스트할 수 있습니다. Biotinylated intasomes는 핵 산 또는 단백질 선호도 조사를 사용할 수 있습니다. PFV intasomes는 두 vDNA 끝 또는 목표에 intasome 검색을 시각화 하기 위해 총 내부 반사 형광의 가입 사이 시간을 측정 하려면 자기 핀셋에 의해 단일 분자 현미경 분석에 대 한 허용 주위 온도에 기능적 DNA6. 또한, PFV intasomes 구조적으로 먼저 retroviral 통합3분야에 크게 영향을 미치는 특징 이었다.

<table>
	<tbody>
		<tr>
			<td>DNA Oligomers</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>Custom DNA Oligos</td>
		</tr>
		<tr>
			<td>Tris Ultra Pure</td>
			<td>Gojira Fine Chemicals</td>
			<td>UTS1003</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>P212121</td>
			<td>RP-S23020</td>
			<td></td>
		</tr>
		<tr>
			<td>UltraPure EDTA</td>
			<td>Invitrogen/Gibco</td>
			<td>15575</td>
			<td></td>
		</tr>
		<tr>
			<td>Amicon Ultra 0.5 mL centrifugal filters</td>
			<td>Sigma-Aldrich</td>
			<td>Z677094-24EA</td>
			<td>3 kDa MWCO</td>
		</tr>
		<tr>
			<td>DTT&#160;</td>
			<td>P212121</td>
			<td>SV-DTT</td>
			<td></td>
		</tr>
		<tr>
			<td>BIS-TRIS propane,&#62;=99.0% (titration)</td>
			<td>Sigma-Aldrich</td>
			<td>B6755-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>ZnCl2</td>
			<td>Sigma-Aldrich</td>
			<td>208086</td>
			<td></td>
		</tr>
		<tr>
			<td>MgSO4</td>
			<td>Amresco</td>
			<td>0662</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>G37-20</td>
			<td></td>
		</tr>
		<tr>
			<td>Gel-loading tips, 1 - 200 &#956;L</td>
			<td>Corning</td>
			<td>CLS4853-400EA</td>
			<td></td>
		</tr>
		<tr>
			<td>Razor blade; Single-edged; 100/Pk.; Pack of 100</td>
			<td>Fisher Scientific</td>
			<td>12-640</td>
			<td></td>
		</tr>
		<tr>
			<td>Sterile Disposable Filter Units with PES Membrane &#62; 250mL</td>
			<td>Thermo Fisher Scientific</td>
			<td>568-0020</td>
			<td></td>
		</tr>
		<tr>
			<td>Dialysis tubing clips</td>
			<td>Spectrum Labs</td>
			<td>132734</td>
			<td></td>
		</tr>
		<tr>
			<td>6-8 kDa 10 mm Dialysis Tubing</td>
			<td>Spectrum Medical</td>
			<td>132645</td>
			<td></td>
		</tr>
		<tr>
			<td>Superose 6 10/300 GL</td>
			<td>GE Healthcare Life Sciences</td>
			<td>17517201</td>
			<td></td>
		</tr>
		<tr>
			<td>Hi-Res Standard Agarose</td>
			<td>AGTC Bioproducts</td>
			<td>AG500D1</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethidium bromide</td>
			<td>Thermo Fisher Scientific</td>
			<td>BP1302</td>
			<td></td>
		</tr>
		<tr>
			<td>Orange G</td>
			<td>Fisher Scientific</td>
			<td>0-267</td>
			<td></td>
		</tr>
		<tr>
			<td>Hyladder 10kb, 500 lanes</td>
			<td>Denville Scientific</td>
			<td>CB4225-4</td>
			<td></td>
		</tr>
	</tbody>
</table>

assembly and purification of prototype foamy virus intasomes

A 기능 및 레트로 바이러스 라이프 사이클의 필요한 단계를 정의 하는 것은 주인 게놈으로 바이러스 성 게놈의 통합. 모든 레트로 바이러스는 호스트 DNA 가닥 전송으로 알려진 바이러스의 공유 결합 catalyzes integrase (IN) 효소를 인코딩합니다. 통합은 모델링 된 시험관에 재조합 retroviral in 되며 DNA 올리고 바이러스 성 게놈의 끝을 흉내 낸 수 있습니다. 더 밀접 하 게 통합 반응에서 발생 하 비보에, 통합을 정리 하기 위해 단지 감소 된 소금 농도 버퍼에서 투 석 하 여 재조합 및 합성 올리고에서 조립 된다. intasome 라는 통합 복잡 한, 크기 배제 크로마토그래피에 의해 순화 될 수 있습니다. 프로토 타입 거품 바이러스 (PFV)의 경우는 intasome에 tetramer 및 2 개의 DNA 올리고 이며 단위체에 무료 올리고 DNA 머에서 쉽게 분리 된다. PFV intasomes의 통합 효율성 다양 한 역학을 보다 잘 이해 하려면 실험 조건 및 retroviral 통합의 역학 분석 될 수 있습니다.

PFV intasomes 재조합 및 vDNA에서 조립 된다. 조립 후 intasomes 초 (그림 1)에 의해 정화 된다. 각 분수의 통합 활동을 supercoiled DNA 대상과 agarose 젤 전기 이동 법 (그림 2)와 분석 이다. 이 젤은 감지 EtBr (fluorophore, fluorophore 표시 vDNA 사용 하는 경우)로 설정 하는 형광 스캐너와 몇 군데. 이미지 분석 소프트웨어를 사용 하 여, 밴드 픽셀 볼?...

Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

Assembly and Purification of Prototype Foamy Virus Intasomes

재조합 retroviral integrase와 바이러스 성 DNA 끝을 흉내 낸 DNA 올리고는 intasome로 알려진 복잡 한 효소 활성을 형성할 수 있다. Intasomes 생화학, 구조, 및 키네틱 연구에 대 한 사용할 수 있습니다. 이 프로토콜에는 조립 및 프로토 타입 거품 바이러스 intasomes를 정화 하는 방법을 자세히 설명 합니다.

조립 및 프로토 타입 거품 바이러스 Intasomes의 정화

A defining feature and necessary step of the retrovirus life cycle is the integration of the viral genome into the host genome. All retroviruses encode an ...

assembly-and-purification-of-prototype-foamy-virus-intasomes

Research

JoVE Journal

Immunology and Infection

5.4K 조회수.  The Ohio State University College of Medicine. 재조합 retroviral integrase와 바이러스 성 DNA 끝을 흉내 낸 DNA 올리고는 intasome로 알려진 복잡 한 효소 활성을 형성할 수 있다. Intasomes 생화학, 구조, 및 키네틱 연구에 대 한 사용할 수 있습니다. 이 프로토콜에는 조립 및 프로토 타입 거품 바이러스 intasomes를 정화 하는 방법을 자세히 설명 합니다.

비디오: Assembly and Purification of Prototype Foamy Virus Intasomes

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal phase during establishment of infection in a given host. Consequently, study of encapsidation deciphers the information regarding the know-how of the mechanism regulating virus assembly to form infectious virions. Such information is vital in formulating novel methods of curbing virus spread and disease control. Virus encapsidation can be studied in vivo and in vitro. Genome encapsidation in vivo is a highly regulated selective process involving macromolecular interactions and subcellular compartmentalization. Therefore, study leading to dissect events encompassing virus encapsidation in vivo would provide basic knowledge to understand how viruses proliferate and assemble. Recently in vitro encapsidation has been exploited for the research in the area of biomedical imaging and therapeutic applications. Non-enveloped plant viruses stand far ahead in the venture of in vitro encapsidation of the negatively charged foreign material. Brome mosaic virus (BMV), a non-enveloped multicomponent RNA virus pathogenic to plants, has been used as a model system for studying genome packaging in vivo and in vitro. For encapsidation assays in Nicotiana benthamiana plants, Agrobacterium -mediated transient expression, refer to as agroinfiltration, is an efficient and robust technique for the synchronized delivery and expression of multiple components to the same cell. In this approach, a suspension of Agrobacterium tumefaciens cells carrying binary plasmid vectors carrying cDNAs of desiredviral mRNAs is infiltrated into the intercellular space withina leaf using nothing more sophisticated than a 1 ml disposable syringe (without needle). This process results in the transfer of DNA insert into plant cells; the T-DNA insert remains transiently in the nucleus and is then transcribed by the host polymerase II, leading to the transient expression. The resulting mRNA transcript (capped and polyadenylated) is then exported to the cytoplasm for translation. After approximately 24 to 48 hours of incubation,sections of infiltrated leaves can be sampled for microscopyor biochemical analyses. Agroinfiltration permits large numbers (hundreds to thousands) of cells to be transfected simultaneously. For in vitro encapsidation, purified virions of BMV are dissociated into capsid protein by dialyzing against dissociation buffer containing calcium chloride followed by removal of RNA and un-dissociated virions by centrifugation. Genome depleted capsid protein subunits are then reassembled with desired viral genome components or non-viral components such as indocyanine dye.

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

A simple, efficient and robust way to synchronize the delivery of multiple viral components to plant cells via Agrobacterium-mediated transient expression is described. This approach is amenable for studying replication, encapsidation followed by in vitro reassembly of non-viral components into genome depleted optical viral ghosts suitable for biomedical applications.

간편하고 강력한 생체내에서과 체외에서</em바이러스 조립 유학을위한> 접근법

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal ...

연구

면역학 및 감염병학

Affinity Purification of Influenza Virus Ribonucleoprotein Complexes from the Chromatin of Infected Cells

Like all negative-strand RNA viruses, the genome of influenza viruses is packaged in the form of viral ribonucleoprotein complexes (vRNP), in which the single-stranded genome is encapsidated by the nucleoprotein (NP), and associated with the trimeric polymerase complex consisting of the PA, PB1, and PB2 subunits. However, in contrast to most RNA viruses, influenza viruses perform viral RNA synthesis in the nuclei of infected cells. Interestingly, viral mRNA synthesis uses cellular pre-mRNAs as primers, and it has been proposed that this process takes place on chromatin1. Interactions between the viral polymerase and the host RNA polymerase II, as well as between NP and host nucleosomes have also been characterized1,2.
Recently, the generation of recombinant influenza viruses encoding a One-Strep-Tag genetically fused to the C-terminus of the PB2 subunit of the viral polymerase (rWSN-PB2-Strep3) has been described. These recombinant viruses allow the purification of PB2-containing complexes, including vRNPs, from infected cells. To obtain purified vRNPs, cell cultures are infected, and vRNPs are affinity purified from lysates derived from these cells. However, the lysis procedures used to date have been based on one-step detergent lysis, which, despite the presence of a general nuclease, often extract chromatin-bound material only inefficiently. 
Our preliminary work suggested that a large portion of nuclear vRNPs were not extracted during traditional cell lysis, and therefore could not be affinity purified. To increase this extraction efficiency, and to separate chromatin-bound from non-chromatin-bound nuclear vRNPs, we adapted a step-wise subcellular extraction protocol to influenza virus-infected cells. Briefly, this procedure first separates the nuclei from the cell and then extracts soluble nuclear proteins (here termed the "nucleoplasmic" fraction). The remaining insoluble nuclear material is then digested with Benzonase, an unspecific DNA/RNA nuclease, followed by two salt extraction steps: first using 150 mM NaCl (termed "ch150"), then 500 mM NaCl ("ch500") (Fig. 1). These salt extraction steps were chosen based on our observation that 500 mM NaCl was sufficient to solubilize over 85% of nuclear vRNPs yet still allow binding of tagged vRNPs to the affinity matrix.
After subcellular fractionation of infected cells, it is possible to affinity purify PB2-tagged vRNPs from each individual fraction and analyze their protein and RNA components using Western Blot and primer extension, respectively. Recently, we utilized this method to discover that vRNP export complexes form during late points after infection on the chromatin fraction extracted with 500 mM NaCl (ch500)3.

Influenza viruses replicate their RNA genome in association with host-cell chromatin. Here, we present a method to purify intact viral ribonucleoprotein complexes from the chromatin of infected cells. Purified viral complexes can be analyzed by both Western blot and primer extension of protein and RNA content, respectively.

감염된 세포의 염색질에서 인플루엔자 바이러스 Ribonucleoprotein 컴플렉스의 동질 정제

Like all negative-strand RNA viruses, the genome of influenza viruses is packaged in the form of viral ribonucleoprotein complexes (vRNP), in which the ...

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

The opportunistic pathogen Legionella pneumophila is an amoeba-resistant bacterium, which also replicates in alveolar macrophages thus causing the severe pneumonia "Legionnaires' disease"1. In protozoan and mammalian phagocytes, L. pneumophila employs a conserved mechanism to form a specific, replication-permissive compartment, the "Legionella-containing vacuole" (LCV). LCV formation requires the bacterial Icm/Dot type IV secretion system (T4SS), which translocates as many as 275 "effector" proteins into host cells. The effectors manipulate host proteins as well as lipids and communicate with secretory, endosomal and mitochondrial organelles2-4.
The formation of LCVs represents a complex, robust and redundant process, which is difficult to grasp in a reductionist manner. An integrative approach is required to comprehensively understand LCV formation, including a global analysis of pathogen-host factor interactions and their temporal and spatial dynamics. As a first step towards this goal, intact LCVs are purified and analyzed by proteomics and lipidomics.
The composition and formation of pathogen-containing vacuoles has been investigated by proteomic analysis using liquid chromatography or 2-D gel electrophoresis coupled to mass-spectrometry. Vacuoles isolated from either the social soil amoeba Dictyostelium discoideum or mammalian phagocytes harboured Leishmania5, Listeria6, Mycobacterium7, Rhodococcus8, Salmonella9 or Legionella spp.10. However, the purification protocols employed in these studies are time-consuming and tedious, as they require e.g. electron microscopy to analyse LCV morphology, integrity and purity. Additionally, these protocols do not exploit specific features of the pathogen vacuole for enrichment.
The method presented here overcomes these limitations by employing D. discoideum producing a fluorescent LCV marker and by targeting the bacterial effector protein SidC, which selectively anchors to the LCV membrane by binding to phosphatidylinositol 4-phosphate (PtdIns(4)P)3,11 . LCVs are enriched in a first step by immuno-magnetic separation using an affinity-purified primary antibody against SidC and a secondary antibody coupled to magnetic beads, followed in a second step by a classical Histodenz density gradient centrifugation12,13 (Fig. 1).
A proteome study of isolated LCVs from D. discoideum revealed more than 560 host cell proteins, including proteins associated with phagocytic vesicles, mitochondria, ER and Golgi, as well as several GTPases, which have not been implicated in LCV formation before13. LCVs enriched and purified with the protocol outlined here can be further analyzed by microscopy (immunofluorescence, electron microscopy), biochemical methods (Western blot) and proteomic or lipidomic approaches.

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

This article describes a method for the isolation and purification of intact Legionella-containing vacuoles (LCVs) from amoeba and macrophages. The two-step protocol comprises LCV enrichment by immuno-magnetic separation using an antibody against a bacterial LCV marker and further purification by density gradient centrifugation.

병원체 Vacuoles의 정제에서<em&gt; Legionella</em&gt; - 감염된 Phagocytes

The opportunistic pathogen Legionella pneumophila is an amoeba-resistant bacterium, which also replicates in alveolar macrophages thus causing the severe ...

Rescue of Recombinant Newcastle Disease Virus from cDNA

Newcastle disease virus (NDV), the prototype member of the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented, negative-sense, single-stranded, enveloped RNA virus (Figure 1) with potential applications as a vector for vaccination and treatment of human diseases. In-depth exploration of these applications has only become possible after the establishment of reverse genetics techniques to rescue recombinant viruses from plasmids encoding their complete genomes as cDNA2-5. Viral cDNA can be conveniently modified in vitro by using standard cloning procedures to alter the genotype of the virus and/or to include new transcriptional units. Rescue of such genetically modified viruses provides a valuable tool to understand factors affecting multiple stages of infection, as well as allows for the development and improvement of vectors for the expression and delivery of antigens for vaccination and therapy. Here we describe a protocol for the rescue of recombinant NDVs.

Newcastle disease virus (NDV) has been extensively studied in the last few years in order to develop new vectors for vaccination and therapy, among others. These studies have been possible due to techniques to rescue recombinant virus from cDNA, such as those we describe here.

의 cDNA에서 재조합 뉴캐슬 질병 바이러스의 구조

Newcastle disease virus (NDV), the prototype member of  the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented,  negative-sense, ...

Isolation, Identification, and Purification of Murine Thymic Epithelial Cells

The thymus is a vital organ for T lymphocyte development. Of thymic stromal cells, thymic epithelial cells (TECs) are particularly crucial at multiple stages of T cell development: T cell commitment, positive selection and negative selection. However, the function of TECs in the thymus remains incompletely understood. In the article, we provide a method to isolate TEC subsets from fresh mouse thymus using a combination of mechanical disruption and enzymatic digestion. The method allows thymic stromal cells and thymocytes to be efficiently released from cell-cell and cell-extracellular matrix connections and to form a single-cell suspension. Using the isolated cells, multiparameter flow cytometry can be applied to identification and characterization of TECs and dendritic cells. Because TECs are a rare cell population in the thymus, we also describe an effective way to enrich and purify TECs by depleting thymocytes, the most abundant cell type in the thymus. Following the enrichment, cell sorting time can be decreased so that loss of cell viability can be minimized during purification of TECs. Purified cells are suitable for various downstream analyses like Real Time-PCR, Western blot and gene expression profiling. The protocol will promote research of TEC function and as well as the development of in vitro T cell reconstitution.

Here we describe an efficient method for isolation, identification, and purification of mouse thymic epithelial cells (TECs). The protocol can be utilized for studies of thymus function for normal T cell development, thymus dysfunction, and T cell reconstitution.

격리, 식별 및 쥐과 흉선 상피 세포의 정화

The thymus is a vital organ for T lymphocyte development. Of thymic stromal cells, thymic epithelial cells (TECs) are particularly crucial at multiple ...

Neutrophil Isolation and Analysis to Determine their Role in Lymphoma Cell Sensitivity to Therapeutic Agents

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of inflammation. They are key players in the innate immune system and play major roles in cancer biology. Neutrophils have been proposed as key mediators of malignant transformation, tumor progression, angiogenesis and in the modulation of the antitumor immunity; through their release of soluble factors or their interaction with tumor cells. To characterize the specific functions of neutrophils, a fast and reliable method is coveted for in vitro isolation of neutrophils from human blood. Here, a density gradient separation method is demonstrated to isolate neutrophils as well as mononuclear cells from the blood. The procedure consists of layering the density gradient solution such as Ficoll carefully above the diluted blood obtained from patients diagnosed with chronic lymphocytic leukemia (CLL), followed by centrifugation, isolation of mononuclear layer, separation of neutrophils from RBCsby dextran then lysis of residual erythrocytes. This method has been shown to isolate neutrophils &#8805; 90 % pure. To mimic the tumor microenvironment, 3-dimensional (3D) experiments were performed using basement membrane matrix such as Matrigel. Given the short half-life of neutrophils in vitro, 3D experiments with fresh human neutrophils cannot be performed. For this reason promyelocytic HL60 cells are differentiated along the granulocytic pathway using the differentiation inducers dimethyl sulfoxide (DMSO) and retinoic acid (RA). The aim of our experiments is to study the role of neutrophils on the sensitivity of lymphoma cells to anti-lymphoma agents. However these methods can be generalized to study the interactions of neutrophils or neutrophil-like cells with a large range of cell types in different situations.

Neutrophils are the most abundant type of white blood cells. The isolation of neutrophils from human blood by density gradient separation method and the differentiation of human promyelocytic (HL60) cells along the granulocytic pathway are described here; to test their role on sensitivity of lymphoma cells to anti-lymphoma agents.

호중구의 분리 및 분석 치료제에 림프종 세포 감도에서 자신의 역할을 확인하는 방법

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of ...

Evaluation of the Efficacy And Toxicity of RNAs Targeting HIV-1 Production for Use in Gene or Drug Therapy

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential to be used as drug therapies for HIV-1 infection. Post-integration inhibitors include ribozymes, short hairpin (sh) RNAs, small interfering (si) RNAs, U1 interference (U1i) RNAs and RNA aptamers. Many of these have been identified using transient co-transfection assays with an HIV-1 expression plasmid and some have advanced to clinical trials. In addition to measures of efficacy, small RNAs have been evaluated for their potential to affect the expression of human RNAs, alter cell growth and/or differentiation, and elicit innate immune responses. In the protocols described here, a set of transient transfection assays designed to evaluate the efficacy and toxicity of RNA molecules targeting post-integration steps in the HIV-1 replication cycle are described. We have used these assays to identify new ribozymes and optimize the format of shRNAs and siRNAs targeting HIV-1 RNA. The methods provide a quick set of assays that are useful for screening new anti-HIV-1 RNAs and could be adapted to screen other post-integration inhibitors of HIV-1 replication.

Methods to evaluate the efficacy and toxicity of RNA molecules targeting post-integration steps of the HIV-1 replication cycle are described. These methods are useful for screening new molecules and optimizing the format of existing ones.

유전자 또는 약물 치료에 사용하기 위해 HIV-1 생산을 표적 RNA를의 효능 및 독성 평가

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential ...

Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral evolution. Here we describe the construction of an infectious clone for Zika virus (ZIKV), which is currently causing an explosive outbreak in the Americas. To prevent toxicity to bacteria that is commonly observed with flavivirus-derived plasmids, we generated a two-plasmid system which separates the genome at the NS1 gene and is more stable than full-length constructs that could not be successfully recovered without mutations. After digestion and ligation to join the two fragments, full-length viral RNA can be generated by in vitro transcription with T7 RNA polymerase. Following electroporation of transcribed RNA into cells, virus was recovered that exhibited similar in vitro growth kinetics and in vivo virulence and infection phenotypes in mice and mosquitoes, respectively.

This protocol describes the recovery of infectious Zika virus from a two-plasmid infectious cDNA clone.

새로운 세계 Zika 바이러스 전염성 클론으로부터 재조합 바이러스의 구조 및 특성 규명

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral ...

Detection and Removal of Nuclease Contamination During Purification of Recombinant Prototype Foamy Virus Integrase

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared to IN from other retroviruses, PFV IN is more soluble and more amenable to experimental manipulation. Additionally, it is sensitive to clinically relevant human immunodeficiency virus (HIV-1) IN inhibitors, suggesting that the catalytic mechanism of PFV IN is similar to that of HIV-1 IN. IN catalyzes the covalent joining of viral complementary DNA (cDNA) to target DNA in a process called strand transfer. This strand transfer reaction introduces nicks to the target DNA. Analysis of integration reaction products can be confounded by the presence of nucleases that similarly nick DNA. A bacterial nuclease has been shown to co-purify with recombinant PFV IN expressed in Escherichia coli (E. coli). Here we describe a method to isolate PFV IN from the contaminating nuclease by heparin affinity chromatography. Fractions are easily screened for nuclease contamination with a supercoiled plasmid and agarose gel electrophoresis. PFV IN and the contaminating nuclease display alternative affinities for heparin sepharose allowing a nuclease-free preparation of recombinant PFV IN suitable for bulk biochemical or single molecule analysis of integration.

Recombinant prototype foamy virus integrase protein is often contaminated with a bacterial nuclease during purification. This method identifies nuclease contamination and removes it from the final preparation of the enzyme.

검색 및 재조합 프로토 타입 거품 바이러스 Integrase의 정화 동안 Nuclease 오염의 제거

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared ...

Rapid, Safe, and Simple Manual Bedside Nucleic Acid Extraction for the Detection of Virus in Whole Blood Samples

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for the rapid bedside inactivation of the Ebola virus during blood sampling for safe nucleic acid (NA) tests by adding a commercial lysis/binding buffer directly into the vacuum blood collection tubes. Using this bedside inactivation approach, we have developed a safe, rapid, and simplified bedside NA extraction method for the subsequent detection of a virus in lysis/binding buffer-inactivated whole blood. The NA extraction is directly performed in the blood collection tubes and requires no equipment or electricity. 
After the blood is collected into the lysis/binding buffer, the contents are mixed by flipping the tube by hand, and the mixture is incubated for 20 min at room temperature. Magnetic glass particles (MGPs) are added to the tube, and the contents are mixed by flipping the collection tube by hand. The MGPs are then collected on the side of the blood collection tube using a magnetic holder or a magnet and a rubber band. The MGPs are washed three times, and after the addition of elution buffer directly into the collection tube, the NAs are ready for NA tests, such as qPCR or isothermal loop amplification (LAMP), without the removal of the MGPs from the reaction. The NA extraction method is not dependent on any laboratory facilities and can easily be used anywhere (e.g., in field hospitals and hospital isolation wards). When this NA extraction method is combined with LAMP and a portable instrument, a diagnosis can be obtained within 40 min of the blood collection.

Here, we present a protocol for the rapid virus nucleic acid extraction from the virus-inactivated whole blood. The extraction is performed directly in the blood collection tubes and requires no equipment or electricity. The method is not dependent on laboratory facilities and can be used anywhere (e.g., in field hospitals).

전체 혈액 샘플에서 바이러스의 검출, 안전, 신속 하 고 간단한 수동 침대 핵 산 추출

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for ...

조립 및 프로토 타입 거품 바이러스 Intasomes의 정화

요약

더 많은 비디오 탐색

이 비디오의 챕터

간편하고 강력한 생체내에서과 체외에서 접근법