Name: assembly and purification of prototype foamy virus intasomes
Uploaded: 2018-03-19T15:00:00.000+00:00
Duration: 10 min 20 s
Description: Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

이 작품은 NIH AI099854 및 AI126742 키에 의해 지원 되었다.

1. 어 닐 링 vDNA의
<ol><li>결합 1 X 10 버퍼 (10 X 10 재고: 100 mM Tris HCl, pH 8.0, 1 M NaCl, 10 mM EDTA), 10 µ M (5' 3' ATTGTCATGGAATTTTGTATATTGAGTGGCGCCCGAACAG, 100 µ M 재고), 올리고 1과 10 µ M 1.5 mL의 최종 볼륨에 올리고 2 (5' 3' CTGTTCGGGCGCCACTCAATATACAAAATTCCATGACA, 100 µ M 재고) . Aliquot 25 µ L 60 0.2 mL 중 합 효소 연쇄 반응 (PCR) 튜브로. 참고: 응용 프로그램에 따라 올리고 fluorophores 또는 5'-끝에 올리고 2의 또는 태그 기본 13 5'-끝 올리고 1에서 내부 아미노 T으로 수정할 수 있습니다. 수정 된 올리고 어 닐 링 전에 고성능 액체 크로마토그래피 (HPLC)에 의해 정화 한다. 우리는 intasome 어셈블리 효율을 10 배 감소 5'-끝 Cy3 또는 Cy5 fluorophore의 라벨 올리고 2 나타났습니다. 내부 fluorophore 라벨 어셈블리 효율을 감소 하지 않습니다.</li>
	<li>다음 시간과 온도 thermocycler를 사용 하 여 anneal: 1에서 99 주기 94.0 ˚C 3 분에 주기 (94.0 ˚C 1 분, 93.6 ˚C 1 분) 주기 당 0.8 ˚C 두 온도 감소 (마지막 주기는 14.8 ˚C 1 분, 14.4 ˚C 1 분) 4.0 ˚C에 저장 하 고.</li>
	<li>모든 60 튜브에서 어 닐 링 반응 결합. 2 0.5 mL 3 kDa 분자량 컷오프 (MWCO) ultracentrifugal 필터 농도 단위 500 µ L을 로드 합니다. 실 온 (RT)에서 10 분 동안 14000 x g에서 microcentrifuge 원심 분리에 의해 단련 된 vDNA을 집중 한다. 참고: retentate 볼륨 각 농도 단위 µ L ~ 50 이어야 한다.</li>
	<li>삭제를 통해 흐름. 각 필터 단위를 나머지 단련된 vDNA의 250 µ L를 추가 합니다. 스핀을 반복 하 고 삭제를 통해 흐름. 450 µ L 테로 세 번 세척 하 여 테 버퍼 (10 mM Tris HCl, pH 8.0, 1 mM EDTA)에 exchange를 버퍼링 합니다.</li>
	<li>필터 장치 및 실시간에 2 분 동안 1000 x g에서 스핀 반전 각 필터 단위에 대 한 최종 retentate 볼륨 ~ 50 µ L. retentates과 1.5 mL 스크류 캡 튜브에 결합 해야 합니다.</li>
	<li>vDNA의 260 nm 자외선 (UV) 흡 광도 측정 합니다. 마지막 어 금 니 DNA 농도 계산 하기 위해이 값을 사용 합니다. 이 vDNA의 소멸 계수 (ε260) 622,803 c m-1 M-1 이며 그 분자량은-20 ˚C에 23,972 검사 저장소.</li>
</ol>2. Intasome 어셈블리
<ol><li>가능 하면 변수 온도와 작은 방에 intasome 어셈블리를 수행 합니다. 약 18-22 ˚C를 온도 조정 합니다. 참고: 우리의 경험 4 ˚C에서 intasome 어셈블리 비효율적입니다.</li>
	<li>저 어 접시에 볶음 바 2 리터 비 커에 투 석 버퍼 (20 mM 두번째-트리 스 프로 판, pH 7.5, 200 m NaCl, 2 m m dithiothreitol (DTT), 25 µ M ZnCl2m)의 1 리터를 준비 합니다. 적어도 6 h에 대 한 18-22 ˚C 방에 버퍼 equilibrate</li>
	<li>intasomes를, 50 mM 두번째-트리 스 프로 판, pH 7.5, 500 mM NaCl, 120 µ M PFV에, 및 150 µ L의 전체 볼륨에 50 µ M vDNA 결합. 참고: PFV에 오염 nuclease 활동7,8의 무료 되어야 합니다. PFV에서 농도 경우 너무 희석 120 µ M에서 150 µ L 볼륨에 맞게 다음 200 µ L 최종 볼륨을 증가 하는 것이 가능 하다. 이 단계는 중요 한 요소는 vDNA (2.4:1) 하에서의 어 금 니 비율을 유지 하 고 충분 한 복잡 한 착 색 인쇄기는 동안 시각화 있습니다.</li>
	<li>10 m m 6-8 kDa MWCO 투 석 튜브와 두 배 증류수 (ddH2O), 또는 높은 순도 물을 사용할 수 있는 클립의 ~ 10 cm 긴 조각을 청소. 튜브의 한쪽 끝을 클립. 참고: 투 석 배관 주의 실험실 공간에서 어떤 가능한 오염 든 지 방지 하기 위해 처리 되어야 합니다.</li>
	<li>투 석 배관 린스 버퍼 (50mm 두번째-트리 스 프로 판, pH 7.5, 500 mM NaCl)의 15 mL를 확인 합니다. 1-2 mL 린스 버퍼와 3 번 투 석 튜브의 내부를 헹 굴. 피 펫과 얇은 젤 팁 로드 가능한 린스 버퍼의 제거.</li>
	<li>필요한 경우 사용 하 여 깨끗 한 면도날 또는 메스 얇은 젤 로드 팁 튜브의 끝에 도달할 수 있도록 투 석 튜브를 잘라.</li>
	<li>피 펫 및 얇은 젤 팁 로드 투 석 튜브에 2.3 단계에서 intasome 어셈블리를 전송. 투 석 배관, 튜브 내에서 도입 하는 공기의 양을 최소화의 오픈 엔드 클립. 투 석 버퍼 튜브를 놓습니다.</li>
	<li>Dialyze 부드러운 교 반 튜브 회전 하지만 소용돌이와 하룻밤 (16-20 h). 투 석 배관 침수 및 모바일 인지 확인 합니다. 약 1 시간 후 튜브 안에 보이는 침전을 관찰 합니다. 참고: Cy3와 Cy5 붙일 표시 vDNA 침전 더 분명 하다. 이것은 끝 표시와 내부적으로 레이블이 형광 vDNA 마찬가지입니다.</li>
</ol>3. Intasome 가용 화
<ol><li>2 준비 넓은 깨끗 한 표면에 새로운 메스 또는 면도칼 블레이드와 2-4 m m 200 µ L 팁의 끝에서 제거 하 여 피 펫 팁을 낳았다. 참고: 도움말 3.3-3.5 단계에서 사용 됩니다.</li>
	<li>투 석 버퍼에서 투 석 튜브를 제거 합니다. 클립 근처 튜빙의 끝에 남아 있을 수 있습니다 투 버퍼 intasome 샘플의 희석을 방지 하기 위해 작은 피 펫 팁는 micropipette을 사용 하 여 모든 초과 투 버퍼를 제거 하. 투 석 튜브의 한쪽 끝에서 클립을 제거 합니다.</li>
	<li>사용 넓은 얼음에 1.5 mL 튜브에 투 석 배관 내부 침전 물의 포함 하 여 샘플을 전송 하려면 3.1 단계에서 피 펫 팁을 낳았다. 참고 복구 된 자료;의 총 볼륨 총 볼륨은 일반적으로 ~ 140 µ L.</li>
	<li>침전 된 샘플은 200 m m NaCl; 320 mM NaCl의 최종 농도에 소금 재고 5 M NaCl 솔루션의 적절 한 볼륨을 추가 하 여 증가. 예를 들어 150 µ L의 샘플을 추가 3.9 µ L 5 M NaCl과 1.1 µ L ddH2O 155 µ L. 전송 얼음 양동이와 마지막 볼륨에 대 한 샘플 4 ˚C 찬 방으로.</li>
	<li>사용 넓은 단계 resuspend를 pipetting으로 침전을 solubilize 3.1에서에서 피 펫 팁을 낳았다. 적어도 1 h. 침전의 대부분 솔루션에가 서 관찰에 대 한 모든 20 분을 반복 합니다. 참고: resuspend 침전에 Pipetting 수 중지 때 명백한 침전 시간 점 사이 더 이상 눈에 띄게 감소. VDNA는 레이블이 또는 내부적으로 분류 때 침전 육안 검사에 따라 ~ 90%로 감소 된다. Cy5 끝 vDNA를 표시, 경우 침전 감소만 ~ 20%; vDNA 라는 fluorophore 엔드와 침전의 대부분 solubilize 하지 것 이다. 효과적으로 solubilized 침전의 양 변수 이며, 실험적으로 결정 되어야 합니다.</li>
</ol>4. Intasome 정화
<ol><li>버퍼 (20 mM 두번째-트리 스 프로 판, pH 7.5, 320 mM NaCl, 10% 글리세롤)를 실행 하는 크기 배제 크로마토그래피 (SEC)의 250 mL를 준비 합니다. 살 균 필터 버퍼 0.2 µ m와 단위 필터와 4 ˚C에 저장 합니다. 참고: 모든 정화 단계 4 ˚C 차가운 방에 수행 됩니다.</li>
	<li>복사해올된 agarose 초 열 equilibrate (직경 = 10 밀리미터; 길이 = 300 mm; 볼륨 침대 24 mL =; 샘플 량 = 25-500 µ L, 최대 압력 = 1.5 MPa; 제외 제한 = 4 x 107 다; 분자 무게 분리 5, 5000 kDa 사이의 참조 테이블 매트 erials) 0.4 mL/min의 유량에서 초 실행 버퍼. 참고:이 정화 그들이 효과적으로 Superose 12 10/300 GL 또는 Superose 6 증가 등 44 kDa에서 300 kDa 분리 수 있다면 다른 크기 제외 열에 적응 시킬 수 있습니다. Superose 12 10/300 GL는 낮은 해상도, 봉우리의 더 많은 중복을 선도. 반대로, Superose 6 증가 높은 해상도 하 고 더 나은 분리를 제공 합니다.</li>
	<li>펠 렛의 모든 나머지 침전을 4 ˚C에서 10 분 동안 14000 x g에서 microfuge에서 intasome 샘플 원심 조심 스럽게 제거는 상쾌한. 200 µ L 주입 루프 (~ 200 μ를 저장할 수 있는 튜브) 상쾌한을 로드 합니다. SEC 열에 샘플을 적용 됩니다. 참고: 작은 로드 볼륨 수 초에 의해 더 큰 해상도</li>
	<li>25 mL 초 실행 버퍼 및 수집 270 µ L. 95 분수와 함께 elute 관찰 SEC 크로마 세 A280/A260 봉우리 (그림 1)를 표시 합니다. 참고: 첫 번째 집계 (~9.0-11.5 mL 차입), PFV tetramer intasome 피크 (~12.0-14.75 mL 차입) 및 무료 vDNA 피크 (~15.0-18.0 mL)와 모노 머 PFV에 이어야 한다.</li>
</ol>5. 통합 가닥 전송 분석 결과, 분수 선택 및 저장
<ol><li>각 intasome 피크 분수 및 50의 2 µ L 결합 ng 3 kb supercoiled 플라스 미드 DNA (재고 농도 50 ng / µ L) 15 µ L의 최종 반응 볼륨에서 반응 버퍼 (10 mM tris 두번째 프로 판, pH 7.5, 110 m NaCl, 5mm MgSO4, 4 µ M ZnCl2, 10 m DTT m m)에. 5 분 동안 37 ˚C에서 품 어.</li>
	<li>아니 추가 PFV intasome와 부정적인 컨트롤을 포함 합니다. (20 mg/mL 재고 솔루션) 0.75 µ L 성분 K와 반응 및 0.75 µ L SDS 중지 (10% 주식 솔루션). 1 헤 게 샘플 나중 분석-20 ˚C에서 필요에 따라 55 ˚C에서 품 어. 참고:이 분석 결과 통합 활동의 질적 평가. 각 분수의 intasome 어 금 니 농도이 분석 결과 이전 결정 되지 않습니다. 분수 통합 가닥 전송 분석 결과에 포함 되어 저장 될 수 있다 통합까지 (를 포함 하 여 하룻밤 저장) 얼음에 활동은 확인 되 고 선택한 분수는 aliquoted. 여기 우리는 pMP2, pUC19 파생9를 사용합니다. 우리는 또한 성공적으로 5.4 kb 플라스 미드 pcDNA 3.1을 사용 했습니다. 으로 확인 될 수 있는 모든 플라스 미드 원형, 선형, 편안 하 고 supercoiled 형태의 통합을 위한 대상으로 사용할 수 있습니다.</li>
	<li>1의 X 태 버퍼 (40 m m 트리 아세테이트, 1 mM EDTA) 0.1 μ g/mL ethidium 평범한 사람 (EtBr, 10 mg/mL 재고 솔루션)10에서 볼륨 (w/v) agarose 젤 당 120 mL 1% 무게를 준비 합니다. Agarose 솔루션을 용 해 하 고 15 cm x 10 cm 젤 캐스팅 쟁반에 부 어. 5 밀리미터 넓은, 0.75 m m 두께 웰 스도 15 잘 빗을 삽입 합니다. 참고: 좁은 우물 1.5 m m 두꺼운 우물에 비해 더 나은 밴드 해상도 얻을.</li>
	<li>허용 주위 온도에서 응고 하 젤. 0.1 μ g/mL EtBr로 1 X 태에서 젤 담가.</li>
	<li>5.2 단계에서 각 통합 반응 3 µ L 50% 글리세롤을 추가 합니다. 전체 반응 볼륨 젤을 로드 합니다. 마커의 10 kb DNA 크기 (150 ng / µ L 재고 농도); 샘플의 양쪽에 차선 1 µ L 로드 즉, DNA 크기 마커 샘플 레인 측면 해야 합니다.</li>
	<li>외부 레인에서 6 µ L 오렌지 G 염료 (0.25% 오렌지 G, 30% 글리세롤)을 로드 합니다. 정 전압, 1 시간, 또는 오렌지 G 염료 전면 젤의 끝에 도달할 때까지 주위 온도에 10 V/cm (100 V)에서 젤을 실행 합니다.</li>
	<li>바로 형광 스캐너 (532 nm 여기, 610 nm 방출 필터) EtBr을 감지로 설정 agarose 젤 이미지. Fluorophore vDNAs 라는 사용 된 경우 또한 해당 fluorophore 설정으로 이미지. 참고: 예를 들어 감지 Cy5 DNA, 633 nm 여기 및 670 nm 방출 필터를 사용 하 여 이미지 표시. 공동된 통합 제품 (CI, 선형 DNA) ~ 3 kb 크기 true로 실행 한다, unreacted supercoiled 플라스 미드 (SC) 빠른 (~ 2 kb), 실행 해야 하 고 반 사이트 통합 제품 (HSI, 편안한 원형 DNA) 느린 (~3.5 kb)를 실행 해야 합니다. Unreacted vDNA ~ 40 크기 true로 실행 해야 혈압.</li>
	<li>이미징 소프트웨어7각 레인에서 밴드를 계량. CI, HSI, 또는 SC; 각 레인에 DNA의 분수를 계산 vDNA이이 계산에 포함 되지 않습니다. 참고: 통합 효율성, 또는 선형 제품으로 변환 하는 SC의 분수 3 밴드 (HSI + CI + SC)의 총 픽셀 볼륨에 의해 공동된 통합 제품 (CI)의 픽셀 볼륨을 나누어 계산 했다. Intasomes 라는 fluorophore 있다면, HSI와 CI 제품 형광으로 quantitated 또한 수 있습니다.</li>
	<li>가장 공동 통합 활동 분수를 선택 합니다. 참고: 우리의 경험에서 공동으로 행 한 피크 통합 활동 tetrameric PFV intasomes로 식별 단백질 피크와 일치 합니다. 이 분수의 각각의 A280 을 측정 하 고 최종 intasome 농도 계산. Ε280 의 야생 PFV에 여기에 설명 된 두 개의 vDNAs tetramer에 대 한 908,339 c m-1M-1 이며 분자 무게는 225.5 kDa. 농도 SEC 크로마 피크로 가닥 전송 분석 결과에 같은 패턴을 따라야 한다.</li>
	<li>5 µ L aliquots 각 분수를 배포 하 고 스냅 액체 질소에서 동결. Aliquots-80 ˚C에 저장 합니다. 저장을 위해 선택 하는 분수는 일반적으로 200-600 nM 사이.</li>
</ol>

<ol>
	<li>Coffin, J. M., Hughes, S. H., Varmus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Retroviruses. , (1997).</li><li>Valkov, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+and+structural+characterization+of+the+integrase+from+the+prototype+foamy+virus.">Functional and structural characterization of the integrase from the prototype foamy virus.</a> Nucleic Acids Res. 37 (1), 243-255 (2009).</li><li>Hare, S., Gupta, S. S., Valkov, E., Engelman, A., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasome+assembly+and+inhibition+of+DNA+strand+transfer.">Retroviral intasome assembly and inhibition of DNA strand transfer.</a> Nature. 464 (7286), 232-236 (2010).</li><li>Li, M., Lin, S., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Outer+domains+of+integrase+within+retroviral+intasomes+are+dispensible+for+catalysis+of+DNA+integration.">Outer domains of integrase within retroviral intasomes are dispensible for catalysis of DNA integration.</a> Protein Sci. 25 (2), 472-478 (2016).</li><li>Gupta, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solution+conformations+of+prototype+foamy+virus+integrase+and+its+stable+synaptic+complex+with+U5+viral+DNA.">Solution conformations of prototype foamy virus integrase and its stable synaptic complex with U5 viral DNA.</a> Structure. 20 (11), 1918-1928 (2012).</li><li>Jones, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasomes+search+for+a+target+DNA+by+1D+diffusion+which+rarely+results+in+integration.">Retroviral intasomes search for a target DNA by 1D diffusion which rarely results in integration.</a> Nat Commun. 7, 11409 (2016).</li><li>Lopez, M. A., Mackler, R. M., Altman, M. P., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+and+removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Detection and removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Vis Exp. , (2017).</li><li>Lopez, M. A., Mackler, R. M., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Virol Methods. 235, 134-138 (2016).</li><li>Poirier, M. G., Bussiek, M., Langowski, J., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+access+to+DNA+target+sites+in+folded+chromatin+fibers.">Spontaneous access to DNA target sites in folded chromatin fibers.</a> J Mol Biol. 379 (4), 772-786 (2008).</li><li>Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments.">Agarose gel electrophoresis for the separation of DNA fragments.</a> J Vis Exp. (62), (2012).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+reveals+a+novel+octameric+integrase+structure+for+betaretroviral+intasome+function.">Cryo-EM reveals a novel octameric integrase structure for betaretroviral intasome function.</a> Nature. 530 (7590), 358-361 (2016).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+supramolecular+assembly+mediates+lentiviral+DNA+integration.">A supramolecular assembly mediates lentiviral DNA integration.</a> Science. 355 (6320), 93-95 (2017).</li><li>Passos, D. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+structures+and+atomic+model+of+the+HIV-1+strand+transfer+complex+intasome.">Cryo-EM structures and atomic model of the HIV-1 strand transfer complex intasome.</a> Science. 355 (6320), 89-92 (2017).</li><li>Yin, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Rous+sarcoma+virus+intasome.">Crystal structure of the Rous sarcoma virus intasome.</a> Nature. 530 (7590), 362-366 (2016).</li><li>Maertens, G. N., Hare, S., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mechanism+of+retroviral+integration+from+X-ray+structures+of+its+key+intermediates.">The mechanism of retroviral integration from X-ray structures of its key intermediates.</a> Nature. 468 (7321), 326-329 (2010).</li><li>Maskell, D. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+for+retroviral+integration+into+nucleosomes.">Structural basis for retroviral integration into nucleosomes.</a> Nature. 523 (7560), 366-369 (2015).</li></ol>

저자는 공개 없다.

Retroviral 기능 통합을 수행 하 고 바이러스 성 수명 주기를 계속 하는 바이러스 성 게놈 DNA와 복잡 한 multimeric를 형성 한다. Intasome 당 단위체에의 수는 tetramers, octamers, 또는 가능 하 게 더 높은 순서 multimers11,12,,1314수 있습니다. PFV intasomes는 모방 하는 바이러스 성 게놈 DNA 이중 가닥 DNA 올리고도 재조합 ...

호스트 게놈으로 바이러스 성 게놈의 통합 모든 레트로 바이러스1의 라이프 사이클에는 필수 단계입니다. 바이러스 성 효소 integrase (IN) catalyzes 호스트 DNA에 바이러스 성 DNA 게놈의 각 끝의 공유 결합. 세포 감염 동안에 통합을 중재 하는 사전 통합 복잡 한의 일부가입니다. 재조합에 더블 좌초 DNA 올리고 흉내 낸 바이러스 성 DNA 끝에 complexed는 대상 DNA 생체 외에서2에 통합을 수행할 수 있습니다. 일반적인 통합 분석 결과 생체 외에서 supercoiled 플라스 미드 DNA 대상으로 사용합니다. 플라스 미드를 모두 바이러스 성 DNA 올리고 (vDNA)의 통합 선형 제품 귀착되 고 공동된 통합 (그림 2A) 이라고 불린다. 통합 분석 결과 생체 외에서 covalently 편안한 원에서 결과 대상 플라스 미드에 참가 한 vDNA와 제품을 얻을 또한 수 있습니다. 이 반 사이트 통합 제품 분석 결과 체 외의 인 것 처럼 보인다.
재조합에 및 vDNA 통합에서 생체 외에서수행할 수 있습니다 하지만 그들은 역학의 연구 또는 통합 복합물의 구조에 대 한 이상적인 약 단위체에 관련 시각화 모호한 것 때. 순화 통합 복합물, 또는 "intasomes," 동적 단일 분자 분석 또는 구조 연구에 필요한 있습니다. PFV에 및 vDNAs 수 있습니다 조립 될 투 석 하 여 상대적으로 높은 소금 농도 버퍼에서 낮은 염 농도3,4. 투 석, 한 침전 동안 양식. 이 침전 물은 투 석에서 제거 되 고 소금 농도 증가. 더 높은 소금 농도 촉진 포함 PFV intasomes solubilizes. intasomes 다음 크기 배제 크로마토그래피 (SEC)에 의해 정화 된다. 재조합 프로토 타입 거품 바이러스 (PFV)에 225 µ M5농도에서 솔루션에 단위체로 존재 하기 위하여 보였다. 초 분류 (44.4 kDa) 단위체 PFV와 무료 vDNA (24.0 kDa)에서 효과적으로 tetramer PFV에 및 2 개의 vDNAs를 포함 하는 PFV intasomes (225.5 kDa)를 구분 합니다. PFV intasomes 냉동 수 있습니다 그리고-80 ˚C에 저장의 적어도 6 개월에 대 한 통합 활동을 유지 합니다.
재조합 PFV intasomes 아미노산 대체 또는 잘림 돌연변이 또는 fluorophores 또는 biotin4,6으로 표시 하는 vDNAs에 포함 하도록 수정할 수 있습니다. 순화 PFV intasomes는 쉽게 DNA에서 생체 외에서supercoiled 플라스 미드 대상으로 통합을 수행합니다. Intasomes과 대량 생 화 확 적인 통합 분석 돌연변이, 억제제, 또는 다른 화학 첨가제에의 효과 테스트할 수 있습니다. Biotinylated intasomes는 핵 산 또는 단백질 선호도 조사를 사용할 수 있습니다. PFV intasomes는 두 vDNA 끝 또는 목표에 intasome 검색을 시각화 하기 위해 총 내부 반사 형광의 가입 사이 시간을 측정 하려면 자기 핀셋에 의해 단일 분자 현미경 분석에 대 한 허용 주위 온도에 기능적 DNA6. 또한, PFV intasomes 구조적으로 먼저 retroviral 통합3분야에 크게 영향을 미치는 특징 이었다.

<table><tbody><tr><td>DNA Oligomers</td><td>IDT</td><td>N/A</td><td>Custom DNA Oligos</td></tr><tr><td>Tris Ultra Pure</td><td>Gojira Fine Chemicals</td><td>UTS1003</td><td></td></tr><tr><td>NaCl</td><td>P212121</td><td>RP-S23020</td><td></td></tr><tr><td>UltraPure EDTA</td><td>Invitrogen/Gibco</td><td>15575</td><td></td></tr><tr><td>Amicon Ultra 0.5 mL centrifugal filters</td><td>Sigma-Aldrich</td><td>Z677094-24EA</td><td>3 kDa MWCO</td></tr><tr><td>DTT</td><td>P212121</td><td>SV-DTT</td><td></td></tr><tr><td>BIS-TRIS propane,&gt;=99.0% (titration)</td><td>Sigma-Aldrich</td><td>B6755-500G</td><td></td></tr><tr><td>ZnCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Sigma-Aldrich</td><td>208086</td><td></td></tr><tr><td>MgSO&lt;sub&gt;4&lt;/sub&gt;</td><td>Amresco</td><td>0662</td><td></td></tr><tr><td>Glycerol</td><td>Thermo Fisher Scientific</td><td>G37-20</td><td></td></tr><tr><td>Gel-loading tips, 1 - 200 &amp;mu;L</td><td>Corning</td><td>CLS4853-400EA</td><td></td></tr><tr><td>Razor blade; Single-edged; 100/Pk.; Pack of 100</td><td>Fisher Scientific</td><td>12-640</td><td></td></tr><tr><td>Sterile Disposable Filter Units with PES Membrane &gt; 250mL</td><td>Thermo Fisher Scientific</td><td>568-0020</td><td></td></tr><tr><td>Dialysis tubing clips</td><td>Spectrum Labs</td><td>132734</td><td></td></tr><tr><td>6-8 kDa 10 mm Dialysis Tubing</td><td>Spectrum Medical</td><td>132645</td><td></td></tr><tr><td>Superose 6 10/300 GL</td><td>GE Healthcare Life Sciences</td><td>17517201</td><td></td></tr><tr><td>Hi-Res Standard Agarose</td><td>AGTC Bioproducts</td><td>AG500D1</td><td></td></tr><tr><td>Ethidium bromide</td><td>Thermo Fisher Scientific</td><td>BP1302</td><td></td></tr><tr><td>Orange G</td><td>Fisher Scientific</td><td>0-267</td><td></td></tr><tr><td>Hyladder 10kb, 500 lanes</td><td>Denville Scientific</td><td>CB4225-4</td><td></td></tr></tbody></table>

assembly and purification of prototype foamy virus intasomes

A 기능 및 레트로 바이러스 라이프 사이클의 필요한 단계를 정의 하는 것은 주인 게놈으로 바이러스 성 게놈의 통합. 모든 레트로 바이러스는 호스트 DNA 가닥 전송으로 알려진 바이러스의 공유 결합 catalyzes integrase (IN) 효소를 인코딩합니다. 통합은 모델링 된 시험관에 재조합 retroviral in 되며 DNA 올리고 바이러스 성 게놈의 끝을 흉내 낸 수 있습니다. 더 밀접 하 게 통합 반응에서 발생 하 비보에, 통합을 정리 하기 위해 단지 감소 된 소금 농도 버퍼에서 투 석 하 여 재조합 및 합성 올리고에서 조립 된다. intasome 라는 통합 복잡 한, 크기 배제 크로마토그래피에 의해 순화 될 수 있습니다. 프로토 타입 거품 바이러스 (PFV)의 경우는 intasome에 tetramer 및 2 개의 DNA 올리고 이며 단위체에 무료 올리고 DNA 머에서 쉽게 분리 된다. PFV intasomes의 통합 효율성 다양 한 역학을 보다 잘 이해 하려면 실험 조건 및 retroviral 통합의 역학 분석 될 수 있습니다.

PFV intasomes 재조합 및 vDNA에서 조립 된다. 조립 후 intasomes 초 (그림 1)에 의해 정화 된다. 각 분수의 통합 활동을 supercoiled DNA 대상과 agarose 젤 전기 이동 법 (그림 2)와 분석 이다. 이 젤은 감지 EtBr (fluorophore, fluorophore 표시 vDNA 사용 하는 경우)로 설정 하는 형광 스캐너와 몇 군데. 이미지 분석 소프트웨어를 사용 하 여, 밴드 픽셀 볼?...

Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

Assembly and Purification of Prototype Foamy Virus Intasomes

재조합 retroviral integrase와 바이러스 성 DNA 끝을 흉내 낸 DNA 올리고는 intasome로 알려진 복잡 한 효소 활성을 형성할 수 있다. Intasomes 생화학, 구조, 및 키네틱 연구에 대 한 사용할 수 있습니다. 이 프로토콜에는 조립 및 프로토 타입 거품 바이러스 intasomes를 정화 하는 방법을 자세히 설명 합니다.

조립 및 프로토 타입 거품 바이러스 Intasomes의 정화

A defining feature and necessary step of the retrovirus life cycle is the integration of the viral genome into the host genome. All retroviruses encode an ...

assembly-and-purification-of-prototype-foamy-virus-intasomes

Research

JoVE Journal

Immunology and Infection

5.4K 조회수.  The Ohio State University College of Medicine. 재조합 retroviral integrase와 바이러스 성 DNA 끝을 흉내 낸 DNA 올리고는 intasome로 알려진 복잡 한 효소 활성을 형성할 수 있다. Intasomes 생화학, 구조, 및 키네틱 연구에 대 한 사용할 수 있습니다. 이 프로토콜에는 조립 및 프로토 타입 거품 바이러스 intasomes를 정화 하는 방법을 자세히 설명 합니다.

비디오: Assembly and Purification of Prototype Foamy Virus Intasomes

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal phase during establishment of infection in a given host. Consequently, study of encapsidation deciphers the information regarding the know-how of the mechanism regulating virus assembly to form infectious virions. Such information is vital in formulating novel methods of curbing virus spread and disease control. Virus encapsidation can be studied in vivo and in vitro. Genome encapsidation in vivo is a highly regulated selective process involving macromolecular interactions and subcellular compartmentalization. Therefore, study leading to dissect events encompassing virus encapsidation in vivo would provide basic knowledge to understand how viruses proliferate and assemble. Recently in vitro encapsidation has been exploited for the research in the area of biomedical imaging and therapeutic applications. Non-enveloped plant viruses stand far ahead in the venture of in vitro encapsidation of the negatively charged foreign material. Brome mosaic virus (BMV), a non-enveloped multicomponent RNA virus pathogenic to plants, has been used as a model system for studying genome packaging in vivo and in vitro. For encapsidation assays in Nicotiana benthamiana plants, Agrobacterium -mediated transient expression, refer to as agroinfiltration, is an efficient and robust technique for the synchronized delivery and expression of multiple components to the same cell. In this approach, a suspension of Agrobacterium tumefaciens cells carrying binary plasmid vectors carrying cDNAs of desiredviral mRNAs is infiltrated into the intercellular space withina leaf using nothing more sophisticated than a 1 ml disposable syringe (without needle). This process results in the transfer of DNA insert into plant cells; the T-DNA insert remains transiently in the nucleus and is then transcribed by the host polymerase II, leading to the transient expression. The resulting mRNA transcript (capped and polyadenylated) is then exported to the cytoplasm for translation. After approximately 24 to 48 hours of incubation,sections of infiltrated leaves can be sampled for microscopyor biochemical analyses. Agroinfiltration permits large numbers (hundreds to thousands) of cells to be transfected simultaneously. For in vitro encapsidation, purified virions of BMV are dissociated into capsid protein by dialyzing against dissociation buffer containing calcium chloride followed by removal of RNA and un-dissociated virions by centrifugation. Genome depleted capsid protein subunits are then reassembled with desired viral genome components or non-viral components such as indocyanine dye.

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

A simple, efficient and robust way to synchronize the delivery of multiple viral components to plant cells via Agrobacterium-mediated transient expression is described. This approach is amenable for studying replication, encapsidation followed by in vitro reassembly of non-viral components into genome depleted optical viral ghosts suitable for biomedical applications.

간편하고 강력한 생체내에서과 체외에서</em바이러스 조립 유학을위한> 접근법

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal ...

연구

면역학 및 감염병학

Multi-target Parallel Processing Approach for Gene-to-structure Determination of the Influenza Polymerase PB2 Subunit

Pandemic outbreaks of highly virulent influenza strains can cause widespread morbidity and mortality in human populations worldwide. In the United States alone, an average of 41,400 deaths and 1.86 million hospitalizations are caused by influenza virus infection each year 1. Point mutations in the polymerase basic protein 2 subunit (PB2) have been linked to the adaptation of the viral infection in humans 2. Findings from such studies have revealed the biological significance of PB2 as a virulence factor, thus highlighting its potential as an antiviral drug target.
The structural genomics program put forth by the National Institute of Allergy and Infectious Disease (NIAID) provides funding to Emerald Bio and three other Pacific Northwest institutions that together make up the Seattle Structural Genomics Center for Infectious Disease (SSGCID). The SSGCID is dedicated to providing the scientific community with three-dimensional protein structures of NIAID category A-C pathogens. Making such structural information available to the scientific community serves to accelerate structure-based drug design.
Structure-based drug design plays an important role in drug development. Pursuing multiple targets in parallel greatly increases the chance of success for new lead discovery by targeting a pathway or an entire protein family. Emerald Bio has developed a high-throughput, multi-target parallel processing pipeline (MTPP) for gene-to-structure determination to support the consortium. Here we describe the protocols used to determine the structure of the PB2 subunit from four different influenza A strains.

Structure-based drug design plays an important role in drug development. Pursuing multiple targets in parallel greatly increases the chance of success for lead discovery. The following article highlights how the Seattle Structural Genomics Center for Infectious Disease utilizes a multi-target approach for gene-to-structure determination of the PB2 influenza A subunit.

인플루엔자 중합 효소의 유전자에 대한 구조 결정 PB2 소단위를위한 멀티 타겟 병렬 처리 방식

Pandemic outbreaks of highly virulent influenza strains can cause widespread morbidity and mortality in human populations worldwide. In the United States ...

Detergent-assisted Reconstitution of Recombinant Drosophila Atlastin into Liposomes for Lipid-mixing Assays

Membrane fusion is a crucial process in the eukaryotic cell. Specialized proteins are necessary to catalyze fusion. Atlastins are endoplasmic reticulum (ER) resident proteins implicated in homotypic fusion of the ER. We detail here a method for purifying a glutathione S-transferase (GST) and poly-histidine tagged Drosophila atlastin by two rounds of affinity chromatography. Studying fusion reactions in vitro requires purified fusion proteins to be inserted into a lipid bilayer. Liposomes are ideal model membranes, as lipid composition and size may be adjusted. To this end, we describe a reconstitution method by detergent removal for Drosophila atlastin into preformed liposomes. While several reconstitution methods are available, reconstitution by detergent removal has several advantages that make it suitable for atlastins and other similar proteins. The advantage of this method includes a high reconstitution yield and correct orientation of the reconstituted protein. This method can be extended to other membrane proteins and for other applications that require proteoliposomes. Additionally, we describe a FRET based lipid mixing assay of proteoliposomes used as a measurement of membrane fusion.

Detergent-assisted Reconstitution of Recombinant Drosophila Atlastin into Liposomes for Lipid-mixing Assays

Biological membrane fusion is catalyzed by specialized fusion proteins. Measuring the fusogenic properties of proteins can be achieved by lipid mixing assays. We present a method for purifying recombinant Drosophila atlastin, a protein that mediates homotypic fusion of the ER, reconstituting it to preformed liposomes, and testing for fusion capacity.

지질 혼합 애신을 위한 리포솜으로 재조합 초파리 아틀라스틴의 세제 지원 재구성

Membrane fusion is a crucial process in the eukaryotic cell. Specialized proteins are necessary to catalyze fusion. Atlastins are endoplasmic reticulum ...

생화학

Generation and Assembly of Virus-Specific Nucleocapsids of the Respiratory Syncytial Virus

The use of an authentic RNA template is critical to advance the fundamental knowledge of viral RNA synthesis that can guide both mechanistic discovery and assay development in virology. The RNA template of nonsegmented negative-sense (NNS) RNA viruses, such as the respiratory syncytial virus (RSV), is not an RNA molecule alone but rather a nucleoprotein (N) encapsidated ribonucleoprotein complex. Despite the importance of the authentic RNA template, the generation and assembly of such a ribonucleoprotein complex remain sophisticated and require in-depth elucidation. The main challenge is that the overexpressed RSV N binds non-specifically to cellular RNAs to form random nucleocapsid-like particles (NCLPs). Here, we established a protocol to obtain RNA-free N (N0) first by co-expressing N with a chaperone phosphoprotein (P), then assembling N0 with RNA oligos with the RSV-specific RNA sequence to obtain virus-specific nucleocapsids (NCs). This protocol shows how to overcome the difficulty in the preparation of this traditionally challenging viral ribonucleoprotein complex.

For in-depth mechanistic analysis of the respiratory syncytial virus (RSV) RNA synthesis, we report a protocol of utilizing the chaperone phosphoprotein (P) for coexpression of the RNA-free nucleoprotein (N0) for subsequent in vitro assembly of the virus-specific nucleocapsids (NCs).

호흡기 싱크량 바이러스의 바이러스 특이적 뉴클레오캡시드의 생성 및 조립

The use of an authentic RNA template is critical to advance the fundamental knowledge of viral RNA synthesis that can guide both mechanistic discovery and ...

In Vitro Disassembly of Influenza A Virus Capsids by Gradient Centrifugation

Acid-triggered molecular processes closely control cell entry of many viruses that enter through the endocytic system. In the case of influenza A virus (IAV), virus fusion with the endosomal membrane as well as the subsequent disassembly of the viral capsid, called uncoating, is governed by the ionic conditions inside endocytic vesicles. The early steps in the virus life cycle are hard to study because endosomes cannot be directly accessed experimentally, creating the need for an in vitro approach. Here, we describe a method based on velocity gradient centrifugation of purified virions through a two-layer glycerol gradient, which enables analysis of the IAV core and its stability. The gradient contains a non-ionic detergent (NP-40) in its lower layer to remove the viral membrane by solubilization as the virus sediments toward the bottom. At neutral pH, viral cores are pelleted as stable structures. The major core components, matrix protein (M1) and the viral ribonucleoproteins (vRNPs), can be clearly identified in the pellet fraction by SDS-PAGE. Decreasing the pH to 6.0 or lower in the bottom layer selectively removes M1 from the pellet followed by release of vRNPs at more acidic conditions. Viral protein bands on Coomassie-stained gels can be subjected to densitometric quantification to monitor intermediate states of IAV disassembly. Besides pH, other factors that influence viral core stability can be assessed, such as salt concentration and putative viral uncoating factors, simply by modifying the detergent-containing glycerol layer accordingly. Taken together, the presented technique allows highly reproducible and quantitative analysis of viral uncoating in vitro. It can be applied to other enveloped viruses that undergo complex uncoating processes.

In Vitro Disassembly of Influenza A Virus Capsids by Gradient Centrifugation

Disassembly of influenza A virus cores during virus entry into host cells is a multistep process. We describe an in vitro method to analyze the early stages of viral uncoating. In this approach, velocity gradient centrifugation is used to biochemically dissect the steps that initiate uncoating under defined conditions.

그라데이션 원심 분리에 의해 인플루엔자 A 바이러스 캡시드의 생체 외 분해에

Acid-triggered molecular processes closely control cell entry of many viruses that enter through the endocytic system. In the case of influenza A virus ...

Advancing High-Resolution Imaging of Virus Assemblies in Liquid and Ice

Interest in liquid-electron microscopy (liquid-EM) has skyrocketed in recent years as scientists can now observe real-time processes at the nanoscale. It is extremely desirable to pair high-resolution cryo-EM information with dynamic observations as many events occur at rapid timescales - in the millisecond range or faster. Improved knowledge of flexible structures can also assist in the design of novel reagents to combat emerging pathogens, such as SARS-CoV-2. More importantly, viewing biological materials in a fluid environment provides a unique glimpse of their performance in the human body. Presented here are newly developed methods to investigate the nanoscale properties of virus assemblies in liquid and vitreous ice. To accomplish this goal, well-defined samples were used as model systems. Side-by-side comparisons of sample preparation methods and representative structural information are presented. Sub-nanometer features are shown for structures resolved in the range of ~3.5-&#197;-10 &#197;. Other recent results that support this complementary framework include dynamic insights of vaccine candidates and antibody-based therapies imaged in liquid. Overall, these correlative applications advance our ability to visualize molecular dynamics, providing a unique context for their use in human health and disease.

Here protocols are described to prepare virus assemblies suitable for liquid-EM and cryo-EM analysis at the nanoscale using transmission electron microscopy.

액체와 얼음에서 바이러스 어셈블리의 고해상도 이미징 향상

Interest in liquid-electron microscopy (liquid-EM) has skyrocketed in recent years as scientists can now observe real-time processes at the nanoscale. It ...

Detection and Removal of Nuclease Contamination During Purification of Recombinant Prototype Foamy Virus Integrase

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared to IN from other retroviruses, PFV IN is more soluble and more amenable to experimental manipulation. Additionally, it is sensitive to clinically relevant human immunodeficiency virus (HIV-1) IN inhibitors, suggesting that the catalytic mechanism of PFV IN is similar to that of HIV-1 IN. IN catalyzes the covalent joining of viral complementary DNA (cDNA) to target DNA in a process called strand transfer. This strand transfer reaction introduces nicks to the target DNA. Analysis of integration reaction products can be confounded by the presence of nucleases that similarly nick DNA. A bacterial nuclease has been shown to co-purify with recombinant PFV IN expressed in Escherichia coli (E. coli). Here we describe a method to isolate PFV IN from the contaminating nuclease by heparin affinity chromatography. Fractions are easily screened for nuclease contamination with a supercoiled plasmid and agarose gel electrophoresis. PFV IN and the contaminating nuclease display alternative affinities for heparin sepharose allowing a nuclease-free preparation of recombinant PFV IN suitable for bulk biochemical or single molecule analysis of integration.

Recombinant prototype foamy virus integrase protein is often contaminated with a bacterial nuclease during purification. This method identifies nuclease contamination and removes it from the final preparation of the enzyme.

검색 및 재조합 프로토 타입 거품 바이러스 Integrase의 정화 동안 Nuclease 오염의 제거

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared ...

In Vitro Reconstitution of the Actin Cytoskeleton Inside Giant Unilamellar Vesicles

The actin cytoskeleton, the principal mechanical machinery in the cell, mediates numerous essential physical cellular activities, including cell deformation, division, migration, and adhesion. However, studying the dynamics and structure of the actin network in vivo is complicated by the biochemical and genetic regulation within live cells. To build a minimal model devoid of intracellular biochemical regulation, actin is encapsulated inside giant unilamellar vesicles (GUVs, also called liposomes). The biomimetic liposomes are cell-sized and facilitate a quantitative insight into the mechanical and dynamical properties of the cytoskeleton network, opening a viable route for bottom-up synthetic biology. To generate liposomes for encapsulation, the inverted emulsion method (also referred to as the emulsion transfer method) is utilized, which is one of the most successful techniques for encapsulating complex solutions into liposomes to prepare various cell-mimicking systems. With this method, a mixture of proteins of interest is added to the inner buffer, which is later emulsified in a phospholipid-containing mineral oil solution to form monolayer lipid droplets. The desired liposomes are generated from monolayer lipid droplets crossing a lipid/oil-water interface. This method enables the encapsulation of concentrated actin polymers into the liposomes with desired lipid components, paving the way for in vitro reconstitution of a biomimicking cytoskeleton network.

In Vitro Reconstitution of the Actin Cytoskeleton Inside Giant Unilamellar Vesicles

In this manuscript, we demonstrate the experimental techniques to encapsulate the F-actin cytoskeleton into giant unilamellar lipid vesicles (also called liposomes), and the method to form a cortex-biomimicking F-actin layer at the inner leaflet of the liposome membrane.

체외 거대한 Unilamellar 소포 내부의 Actin Cytoskeleton 재구성

The actin cytoskeleton, the principal mechanical machinery in the cell, mediates numerous essential physical cellular activities, including cell ...

생체공학

Sample Preparation for Single Virion Atomic Force Microscopy and Super-resolution Fluorescence Imaging

Immobilization of virions to glass surfaces is a critical step in single virion imaging. Here we present a technique&#160;adopted from single molecule imaging assays which allows adhesion of single virions to glass surfaces with specificity. This preparation is based on grafting the surface of the glass with a mixture of PLL-g-PEG and PLL-g-PEG-Biotin, adding a layer of avidin, and finally creating virion anchors through attachment of biotinylated virus specific antibodies. We have applied this technique across a range of experiments including atomic force microscopy (AFM) and super-resolution fluorescence imaging. This sample preparation method results in a control adhesion of the virions to the surface.

The attachment of virions to a surface is a requirement for single virion imaging by Super-resolution fluorescence imaging or atomic force microscopy (AFM). Here we demonstrate a sample preparation method for controlled adhesion of virions to glass surfaces suitable for use in AFM and super-resolution fluorescence imaging.

단일 비리온 원자력 현미경 검사및 초분해성 형광 이미징을 위한 샘플 준비

Immobilization of virions to glass surfaces is a critical step in single virion imaging. Here we present a technique&#160;adopted from single molecule ...

생물학

Expression and Purification of Virus-like Particles for Vaccination

Virus-like particles (VLPs) and subviral particles (SVPs) are an alternative approach to viral vaccine design that offers the advantages of increased biosafety and stability over use of live pathogens. Non-infectious and self-assembling, VLPs are used to present structural proteins as immunogens, bypassing the need for live pathogens or recombinant viral vectors for antigen delivery. In this article, we demonstrate the different stages of VLP design and development for future applications in preclinical animal testing. The procedure includes the following stages: selection of antigen, expression of antigen in cell line of choice, purification of VLPs/SVPs, and quantification for antigen dosing. We demonstrate use of both mammalian and insect cell lines for expression of our antigens and demonstrate how methodologies differ in yield. The methodology presented may apply to a variety of pathogens and can be achieved by substituting the antigens with immunogenic structural proteins of the user&#39;s microorganism of interest. VLPs and SVPs assist with antigen characterization and selection of the best vaccine candidates.

Here, we present a protocol for synthesizing virus-like particles using either baculovirus or mammalian expression systems, and ultracentrifugation purification. This highly customizable approach is used to identify viral antigens as vaccine targets in a safe and flexible manner.

표현과 예방 접종에 대한 바이러스 입자의 정제

Virus-like particles (VLPs) and subviral particles (SVPs) are an alternative approach to viral vaccine design that offers the advantages of increased ...