Diese Arbeit wurde von NIH AI099854 und AI126742 auf Schlüssel unterstützt.

(1) Glühen des vDNA
<ol><li>Mähdrescher 1 X 10-Puffer (10 X 10 Lager: 100 mM Tris-HCl, pH 8.0, 1 M NaCl 10 mM EDTA), 10 µM Oligo-1 (5' ATTGTCATGGAATTTTGTATATTGAGTGGCGCCCGAACAG 3', 100 µM-Lager) und 10 µM Oligo-2 (5' CTGTTCGGGCGCCACTCAATATACAAAATTCCATGACA 3', 100 µM-Lager) in einem Endvolumen von 1,5 mL . Aliquoten 25 µL in sechzig 0,2 mL Polymerase-Kettenreaktion (PCR) Röhren. Hinweis: Abhängig von der Anwendung können Oligomere mit Fluorophore oder Tags am 5'-Ende von Oligo 2 oder als eine interne amino-T im Boden 13 vom 5'-Ende von Oligo 1 geändert werden. Modifizierte Oligomere sollte durch Hochleistungs-Flüssigkeitschromatographie (HPLC) vor Glühen gereinigt werden. Wir haben festgestellt, dass 5'-Ende Cy3 oder Cy5 Fluorophor Kennzeichnung von Oligo-2 Intasome-Montage-Effizienz 10-fache reduziert. Interne Fluorophor Kennzeichnung verringert nicht die Versammlung Effizienz.</li>
	<li>Tempern mit einem Thermocycler mit folgenden Zeiten und Temperaturen: 1 Zyklus auf 94,0 ˚C 3 min 99 Zyklen bei (94,0 ˚C 1 min, 93,6 ˚C 1 min) beide Temperaturen um 0,8 ° c pro Zyklus verringert (der letzte Zyklus ist 14,8 ˚C 1 min, 14,4 ° c 1 min) , und bei 4,0 ° c lagern.</li>
	<li>Kombinieren Sie die Glühen Reaktionen alle 60 Röhren. Laden Sie 500 µL, zwei 0,5 mL 3 kDa Molekulargewicht cutoff (MWCO) ultracentrifugal Filter Konzentrationseinheiten. Die geglühten vDNA durch Zentrifugieren in einem Microcentrifuge 14.000 x g für 10 min bei Raumtemperatur (RT) zu konzentrieren. Hinweis: Das Retentat Laufwerk sollte ~ 50 µL in jeder Konzentration Einheit.</li>
	<li>Die Durchströmung zu verwerfen. Jede Filteranlage 250 µL der verbleibenden geglühten vDNA hinzufügen. Wiederholen Sie den Spin und verwerfen Sie die Durchströmung zu. Tausch in TE-Puffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA) durch waschen dreimal mit 450 µL TE-Puffer.</li>
	<li>Invertieren der Filtereinheit und Spin bei 1.000 x g für 2 min bei RT Die endgültige Retentat Lautstärke für jede Filteranlage sollte ~ 50 µL kombinieren Sie die Retentates und Übertragung auf ein 1,5 mL Schraubverschluss Rohr.</li>
	<li>Messen Sie die Absorption 260 nm Ultraviolett (UV) von der vDNA. Verwenden Sie diesen Wert, um die Endkonzentration der molaren DNA zu berechnen. Die vom Aussterben bedroht Leistungszahl (ε260) dieses vDNA ist 622.803 cm-1 M-1 und seine Molekulargewicht 23.972 Da. Store bei-20 ° c.</li>
</ol>2. Intasome Montage
<ol><li>Führen Sie nach Möglichkeit die Intasome-Assembly in einem kleinen Raum mit einem Variablen Thermostat. Stellen Sie den Thermostat auf ca. 18-22 ° c. Hinweis: Nach unserer Erfahrung ist Intasome Versammlung bei 4 ° c ineffizient.</li>
	<li>Bereiten Sie 1 L des Dialyse-Puffer (20 mM Bis-Tris Propan, pH 7,5, 200 mM NaCl, 2 mM Dithiothreitol (DTT), 25 µM ZnCl2) in einem 2 L Becherglas mit Stir Bar auf einem Teller rühren. Equilibrate des Puffers in der 18-22 ° c Raum für mindestens 6 h.</li>
	<li>Um die Intasomes zu montieren, verbinden Sie Propan 50 mM Bis-Tris, pH 7.5, 500 mM NaCl und 120 µM PFV IN 50 µM vDNA in einem Gesamtvolumen von 150 µL. Hinweis: Der PFV IN sollte frei von kontaminierenden Nuklease Aktivität7,8. Wenn die Konzentration des PFV IN zu verdünnen, 120 µM IN 150 µL Volumen unterzubringen, ist dann es möglich ist, das Endvolumen zu 200 µL zu erhöhen. Die entscheidenden Faktoren für diesen Schritt sind weiterhin das molare Verhältnis von IN zu vDNA (2.4:1) und ausreichend komplex, während der Chromatographie zu visualisieren.</li>
	<li>Reinigen Sie ein ~ 10 cm langes Stück 10 mm 6-8 kDa MWCO Dialyse Schläuche und Clips mit doppelt destilliertem Wasser (DdH2O) oder die höchste Reinheit Wasser zur Verfügung. Stecken Sie ein Ende des Schlauches. Hinweis: Dialyse Schläuche sollten mit Sorgfalt, um zu verhindern, dass etwaige Kontaminationen aus dem Labor-Raum behandelt werden.</li>
	<li>15 mL Dialyse Schläuche spülen Puffer (50 mM Bis-Tris Propan, pH 7.5, 500 mM NaCl) zu machen. Spülen Sie die Innenseite des Schlauches Dialyse dreimal mit 1-2 mL spülen Puffer. Entfernen Sie so viel des Puffers spülen wie möglich mit einer Pipette und dünnen Gel laden Tipp.</li>
	<li>Verwenden Sie ggf. eine saubere Rasierklinge oder einem Skalpell schneiden die Dialyse Schläuche, so dass ein dünne Gel-laden-Tipp am Ende des Schlauches erreichen kann.</li>
	<li>Übertragen Sie die Intasome-Assembly von Schritt 2.3 auf der Dialyse-Schlauch mit einer Pipette und einem dünnen Gel laden Tipp. Befestigen Sie das offene Ende der Dialyse Schläuche, Minimierung der Menge von Luft in den Schlauch eingeführt. Legen Sie die Schläuche in der Dialyse-Puffer.</li>
	<li>Dialyse über Nacht (16-20 h) unter schonenden rühren, damit das Rohr dreht sich aber nicht in einen Strudel. Sicherstellen Sie, dass die Dialyse-Schlauch unter Wasser und mobile. Beobachten Sie nach etwa einer Stunde einen sichtbaren Niederschlag in den Schlauch. Hinweis: Mit Cy3 oder Cy5 Eindringmittel vDNA bezeichnet, ist der Niederschlag deutlicher. Dies gilt auch für Ende beschriftet und intern beschrifteten fluoreszierende vDNA.</li>
</ol>3. Intasome Solubilization
<ol><li>Bereiten Sie zwei breite Bohrung Pipettenspitzen durch Entfernen von 2-4 mm vom Ende von 200 µL Tipp mit einer neuen Rasierklinge oder Skalpell Klinge auf eine saubere Oberfläche. Hinweis: Die Tipps werden in Schritt 3.3 und 3.5 verwendet werden.</li>
	<li>Entfernen Sie die Dialyse-Schläuche aus der Dialyse-Puffer. Vermeidung einer Verdünnung der Probe mit Dialyse-Puffer Intasome, die am Ende des Schlauches in der Nähe des Clips bleiben können, mithilfe einer Mikropipette mit einem kleinen Pipettenspitze um jede überschüssige Dialyse-Puffer zu entfernen. Entfernen Sie den Clip von einem Ende der Dialyse Schläuche.</li>
	<li>Verwendung eine große Bohrung Pipettenspitze Schritt 3.1, die Probe einschließlich des Niederschlags in der Dialyse-Schlauch, ein 1,5-mL-Tube auf Eis zu übertragen. Beachten Sie das Gesamtvolumen des zurückgewonnenen Materials; Das Gesamtvolumen beträgt in der Regel ca. 140 µL.</li>
	<li>Die Probe mit Niederschlag ist bei 200 mM NaCl; erhöhen Sie das Salz, eine Endkonzentration von 320 mM NaCl, indem das entsprechende Volumen der NaCl-Stammlösung der 5 M. Zum Beispiel für eine Probe von 150 µL hinzufügen 3,9 µL 5 M NaCl und 1,1 µL DdH2O für ein Endvolumen von 155 µL. Transfer Eiseimer mit Probe in einen Kühlraum von 4 ° c.</li>
	<li>Verwendung eine große Bohrung Pipettenspitze Schritt 3.1 Aufschwemmen und solubilisieren die Ausfällung von pipettieren. Wiederholen Sie alle 20 min für mindestens 1 Stunde beobachten, die meisten des Niederschlags in Lösung gehen sollte. Hinweis: Um den Niederschlag Aufschwemmen Pipettieren kann beendet werden, wenn es ersichtlich ist, dass der Niederschlag zwischen Zeitpunkten nicht mehr spürbar reduziert wird. Wenn vDNA nicht beschriftet ist oder intern bezeichnet, ist der Niederschlag um ~ 90 % bezogen auf die Sichtprüfung reduziert. Bei Cy5 Ende beschriftet vDNA wird der Niederschlag nur ~ 20 % reduziert; die meisten des Niederschlags mit Fluorophor Ende beschriftet vDNA werden nicht anderweitig. Die Menge des Niederschlags, die effektiv solubilisiert ist ist variabel und sollte empirisch ermittelt werden.</li>
</ol>4. Intasome-Reinigung
<ol><li>Bereiten Sie 250 mL Größe Ausgrenzung Chromatography (SEC) Puffer (20 mM Bis-Tris Propan, pH 7.5, 320 mM NaCl, 10 % Glycerin) ausgeführt. Sterilfilter des Puffers mit einem 0,2 µm Filtern Einheit und bei 4 ° c lagern. Hinweis: Alle Reinigungsschritte sind in einem 4 ° c kalten Raum durchgeführt.</li>
	<li>Equilibrate eine vernetzte Agarose SEC-Spalte (Durchmesser = 10 mm; Länge = 300 mm; Volumen Bett = 24 mL; probieren Volumen = 25-500 µL; Maximaldruck = 1,5 MPa; Ausgrenzung Limit = 4 x 107 Da; trennt Molekulargewichte zwischen 5 bis 5.000 kDa, sehen die Tabelle von Mat Erials) mit SEC laufenden Puffer mit einer Durchflussrate von 0,4 mL/min. Hinweis: Diese Reinigung kann auf unterschiedlicher Größe Ausgrenzung Spalten angepasst werden, wenn sie effektiv 300 kDa trennen 44 kDa, z. B. Superose 12 10/300 GL oder Superose 6 erhöhen können. Superose 12 10/300 GL hat niedrigeren Auflösung, was zu mehr Überschneidungen der Gipfel. Im Gegensatz dazu Superose 6 erhöhen verfügt über höhere Auflösung und besseren Trennung.</li>
	<li>Zentrifuge Intasome Probe in ein Microfuge bei 14.000 x g für 10 min bei 4 ° c, alle übrigen Niederschlag pellet. Entfernen Sie vorsichtig den überstand. Laden des Überstands zu einem 200 µL Injektionsschleife (Schläuche, die ~ 200 μL enthalten kann). Die Probe auf der SEC-Spalte anwenden. Hinweis: Kleinere Ladevolumen ermöglichen höhere Auflösung von SEC</li>
	<li>Eluieren mit 25 mL SEC laufen zu puffern und sammeln 95 Bruchteile von 270 µL. beachten Sie, dass die SEC-Chromatogramm drei A280/a260 -Gipfel (Abbildung 1 zeigt). Hinweis: Die erste sollte ein Aggregat (~9.0 - 11,5 mL Elution), gefolgt von der PFV Tetramer Intasome Peak (~12.0 - 14,75 mL Elution) und PFV IN Monomer mit kostenlosen vDNA Peak (~15.0 - 18,0 mL) sein.</li>
</ol>5. Integration Strang Transfer Assay, Bruchteil Auswahl und Lagerung
<ol><li>Kombinieren Sie 2 µL der Höhepunkt jedes Intasome und 50 ng 3 kb supercoiled Plasmid DNA (Lager Konzentration ist 50 ng/µL) in Reaktion-Puffer (10 mM Bis-Tris Propan, pH 7.5, 110 mM NaCl, 5 mM MgSO4, 4 µM ZnCl2, 10 mM DTT) in eine endgültige Reaktionsvolumen von 15 µL. Bei 37 ° c für 5 min inkubieren.</li>
	<li>Gehören Sie eine Negativkontrolle mit keine zusätzlichen PFV Intasome. Stoppen Sie die Reaktion mit 0,75 µL Proteinase K (20 mg/mL Stammlösung) und 0,75 µL SDS (10 % Stammlösung). Inkubieren Sie bei 55 ° c für 1 h Store Proben Bedarf bei-20 ° c für spätere Analysen. Hinweis: Dieser Test ist eine qualitative Bewertung der Integration Aktivität. Die Intasome molare Konzentration der einzelnen Fraktionen ist nicht vor dieser Assay ermittelt. Brüche in der Integration Strang Transfer Test enthalten können gespeichert werden auf dem Eis (einschließlich Lagerung über Nacht) bis zur Integration Tätigkeit bestätigt und ausgewählte Brüche sind regelmÄÑig. Hier verwenden wir pMP2, eine pUC19 Derivative9. Wir haben auch erfolgreich die 5,4 kb-Plasmid PcDNA 3.1 verwendet. Alle Plasmid, das gelöst werden kann entspannt Kreis, linear, und supercoiled Formen als Ziel für die Integration verwendet werden.</li>
	<li>Bereiten Sie ein 120 mL 1 % Gewicht pro Volumen (w/V) Agarose-Gel auf 1 X TAE-Puffer (40 mM Tris-Acetat, 1 mM EDTA) mit 0,1 μg/mL Interkalation Bromid (EtBr, 10 mg/mL Stammlösung)10. Schmelzen Sie die Agarose-Lösung zu und gießen Sie sie in ein 15 x 10 cm Gel Casting Tablett. Legen Sie einen 15-Brunnen-Kamm mit 5 mm breit, 0,75 mm dick Brunnen. Hinweis: Schmalere Brunnen liefern besseren Band-Auflösung im Vergleich zu 1,5 mm Dicke Brunnen.</li>
	<li>Lassen Sie das Gel bei Raumtemperatur zu festigen. Tauchen Sie das Gel in 1 X TAE mit 0,1 μg/mL EtBr.</li>
	<li>Jede Integration Reaktion 3 µL 50 % Glycerin aus Schritt 5.2 hinzufügen. Laden Sie das gesamte Reaktionsvolumen auf das Gel. 1 µL 10 kb DNA Größe Marker (150 ng/µL Lager Konzentration) auf Bahnen auf beiden Seiten der Proben zu laden; Das heißt, sollte der DNA Größe Marker die Probe Gassen flankieren.</li>
	<li>Laden Sie in eine äußere Fahrspur 6 µL Orange G Farbstoff (0,25 % Orange G, 30 % Glycerin). Führen Sie das Gel bei konstanter Spannung, 10 V/cm (100 V) bei Raumtemperatur 1 Stunde oder bis Orange G Farbstoff vorne das Ende des Gels erreicht.</li>
	<li>Sofort Bild das Agarosegel mit einem fluoreszierenden Scanner EtBr (532 nm Anregung, 610 nm Emission Filter) überschreitet. Wenn Fluorophore beschriftet vDNAs verwendet wurden, auch mit entsprechenden Fluorophor Einstellungen Bild. Hinweis: zum Beispiel mit der Bezeichnung Cy5 erkennen DNA, Bild mit 633 nm Anregung und 670 nm Emission Filter. Abgestimmte Integrationsprodukte (CI, lineare DNA) laufen maßhaltig bei ~ 3 kb, nicht umgesetztes supercoiled Plasmid (SC) läuft schneller (~ 2 kb) und halb-Website Integrationsprodukte (HSI, entspannten Kreis DNA) läuft langsamer (~3.5 kb). Nicht umgesetztes vDNA führen maßhaltig bei ~ 40 bp.</li>
	<li>Die Bänder in jeder Bahn mit imaging Software7zu quantifizieren. Der Anteil der DNA in jeder Spur, die CI, HSI oder SC ist zu berechnen; vDNA ist in dieser Berechnung nicht enthalten. Hinweis: Integration Effizienz oder der Bruch des SC zu einem linearen Produkt umgewandelt wurde dividiert das Pixel-Volumen von abgestimmten Integrationsprodukte (CI) durch das gesamte Pixel Volumen von drei Bands (HSI + CI + SC). Wenn Intasomes Fluorophore beschriftet sind, können die HSI und CI-Produkte auch durch Fluoreszenz quantitated.</li>
	<li>Wählen Sie Brüche, die die meisten abgestimmte Integration-Aktivität haben. Hinweis: Nach unserer Erfahrung fällt der Spitzenaktivität abgestimmte Integration mit dem Protein-Gipfel als tetrameres PFV Intasomes identifiziert. Messen Sie die A280 jedes dieser Fraktionen und berechnen Sie die endgültigen Intasome Konzentration. Die ε-280 für ein Tetramer von Wildtyp PFV IN mit zwei vDNAs hier beschriebenen ist 908.339 cm-1M-1 und das Molekulargewicht ist 225.5 kDa. Die Konzentrationen sollten das gleiche Muster als die SEC Chromatogramm Peak und im Strang Transfer Test folgen.</li>
	<li>Jede Fraktion in 5 µL-Aliquots verteilen und snap Einfrieren in flüssigem Stickstoff. Lagern Sie Aliquote bei-80 ° c. Brüche, ausgewählt für die Lagerung sind in der Regel zwischen 200 und 600 nM.</li>
</ol>

<ol>
	<li>Coffin, J. M., Hughes, S. H., Varmus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Retroviruses. , (1997).</li><li>Valkov, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+and+structural+characterization+of+the+integrase+from+the+prototype+foamy+virus.">Functional and structural characterization of the integrase from the prototype foamy virus.</a> Nucleic Acids Res. 37 (1), 243-255 (2009).</li><li>Hare, S., Gupta, S. S., Valkov, E., Engelman, A., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasome+assembly+and+inhibition+of+DNA+strand+transfer.">Retroviral intasome assembly and inhibition of DNA strand transfer.</a> Nature. 464 (7286), 232-236 (2010).</li><li>Li, M., Lin, S., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Outer+domains+of+integrase+within+retroviral+intasomes+are+dispensible+for+catalysis+of+DNA+integration.">Outer domains of integrase within retroviral intasomes are dispensible for catalysis of DNA integration.</a> Protein Sci. 25 (2), 472-478 (2016).</li><li>Gupta, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solution+conformations+of+prototype+foamy+virus+integrase+and+its+stable+synaptic+complex+with+U5+viral+DNA.">Solution conformations of prototype foamy virus integrase and its stable synaptic complex with U5 viral DNA.</a> Structure. 20 (11), 1918-1928 (2012).</li><li>Jones, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasomes+search+for+a+target+DNA+by+1D+diffusion+which+rarely+results+in+integration.">Retroviral intasomes search for a target DNA by 1D diffusion which rarely results in integration.</a> Nat Commun. 7, 11409 (2016).</li><li>Lopez, M. A., Mackler, R. M., Altman, M. P., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+and+removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Detection and removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Vis Exp. , (2017).</li><li>Lopez, M. A., Mackler, R. M., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Virol Methods. 235, 134-138 (2016).</li><li>Poirier, M. G., Bussiek, M., Langowski, J., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+access+to+DNA+target+sites+in+folded+chromatin+fibers.">Spontaneous access to DNA target sites in folded chromatin fibers.</a> J Mol Biol. 379 (4), 772-786 (2008).</li><li>Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments.">Agarose gel electrophoresis for the separation of DNA fragments.</a> J Vis Exp. (62), (2012).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+reveals+a+novel+octameric+integrase+structure+for+betaretroviral+intasome+function.">Cryo-EM reveals a novel octameric integrase structure for betaretroviral intasome function.</a> Nature. 530 (7590), 358-361 (2016).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+supramolecular+assembly+mediates+lentiviral+DNA+integration.">A supramolecular assembly mediates lentiviral DNA integration.</a> Science. 355 (6320), 93-95 (2017).</li><li>Passos, D. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+structures+and+atomic+model+of+the+HIV-1+strand+transfer+complex+intasome.">Cryo-EM structures and atomic model of the HIV-1 strand transfer complex intasome.</a> Science. 355 (6320), 89-92 (2017).</li><li>Yin, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Rous+sarcoma+virus+intasome.">Crystal structure of the Rous sarcoma virus intasome.</a> Nature. 530 (7590), 362-366 (2016).</li><li>Maertens, G. N., Hare, S., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mechanism+of+retroviral+integration+from+X-ray+structures+of+its+key+intermediates.">The mechanism of retroviral integration from X-ray structures of its key intermediates.</a> Nature. 468 (7321), 326-329 (2010).</li><li>Maskell, D. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+for+retroviral+integration+into+nucleosomes.">Structural basis for retroviral integration into nucleosomes.</a> Nature. 523 (7560), 366-369 (2015).</li></ol>

Die Autoren haben nichts preisgeben.

Retroviren INs bilden einen Komplex mit viralen genomischen DNA führen Integration und weiter den viralen Lebenszyklus Multimeric. Die Anzahl der im Monomeren pro Intasome möglicherweise Tetramers, Octamers oder eventuell höhere Ordnung Multimere11,12,13,14. PFV Intasomes sind, dass ein Tetramer des rekombinanten mit doppelsträngigen DNA-Oligomere, die viralen genomischen DNA zu imitieren e...

Integration des viralen Genoms in das Wirtsgenom ist ein obligatorischer Schritt im Lebenszyklus von allen Retroviren1. Das virale Enzym Integrase (IN) katalysiert die kovalente Verbindung der beiden Enden der viralen DNA-Genom an den Host DNA. Während einer zellulären Infektion gehört eine Vorintegration Komplex, die die Integration vermittelt. Rekombinante IN komplexiert mit doppelten gestrandeten DNA-Oligomere imitiert die virale DNA-enden können auch die Integration in ein Ziel DNA in Vitro2durchführen. Eine gemeinsame Integration Assay in Vitro nutzt ein supercoiled Plasmid als Ziel DNA. Integration der beiden virale DNA-Oligomere (vDNA) auf dem Plasmid führt zu einem linearen Produkt und ist abgestimmte Integration (Abbildung 2A) bezeichnet. Die Integration Tests in Vitro können auch Produkte mit nur ein vDNA kovalent an das Ziel-Plasmid, was zu einem entspannten Kreis trat führen. Dieser halb-Website Integration Produkt scheint ein Artefakt der Assay in Vitro.
IN rekombinanten und vDNA Integration in Vitroverrichten, aber sie sind nicht ideal Reagenzien für das Studium der Dynamik oder die Struktur der komplexe Integration, wenn Monomere IN relevanten Visualisierung verdecken würde. Gereinigte Integration komplexe oder "Intasomes" sind für dynamische Einzelmolekül-Analyse oder strukturelle Studien erforderlich. PFV IN und vDNAs können durch Dialyse aus einem relativ hohen Salzkonzentration Puffer zu einem niedrigeren Salzkonzentration3,4montiert werden. Während der Dialyse, einen Niederschlag Formen. Dieser Niederschlag aus Dialyse entfernt und die Salzkonzentration steigt. Die höheren Salzkonzentration solubilisiert überstürzten enthaltenden PFV-Intasomes. Die Intasomes werden dann durch Größe Ausgrenzung Chromatography (SEC) gereinigt. Rekombinante Prototyp schaumig Virus (PFV) IN nachweislich als ein Monomer in Lösung in Konzentrationen bis zu 225 µM5existieren. SEC Fraktionierung trennt effektiv PFV Intasomes (225.5 kDa), die ein Tetramer des PFV IN und zwei vDNAs umfasst, von Monomeren PFV IN (44,4 kDa) und freie vDNA (24,0 kDa). Der PFV Intasomes können eingefroren werden und Integration Aktivität für mindestens sechs Monate Lagerung bei-80 ° c aufbewahren.
Rekombinante PFV Intasomes kann auch geändert werden, um IN Aminosäure Substitutionen oder abschneiden Mutationen oder vDNAs beschriftet mit Fluorophore oder Biotin4,6erweitert. Die gereinigten PFV Intasomes durchführen ohne weiteres Integration in ein Ziel supercoiled Plasmid DNA in Vitro. Bulk-biochemische Integration-Assays mit Intasomes können die Auswirkungen der IN Mutationen im Hemmer oder sonstigen chemischen Zusätzen testen. Biotinylierte Intasomes kann verwendet werden, Affinität mit Nukleinsäuren oder Proteine zu untersuchen. PFV Intasomes funktionieren bei Umgebungstemperatur zulassend Einzelmolekül-Mikroskopie-Analyse von magnetischen Pinzette Messung die Zeit zwischen den Beitritt der beiden vDNA enden oder Totalreflexion Fluoreszenz, die Intasome Suche auf Ziel zu visualisieren DNA-6. Darüber hinaus wurden PFV Intasomes die erste strukturell sein deutlich beeinflussen das Feld von Retroviren Integration3gekennzeichnet.

<table>
	<tbody>
		<tr>
			<td>DNA Oligomers</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>Custom DNA Oligos</td>
		</tr>
		<tr>
			<td>Tris Ultra Pure</td>
			<td>Gojira Fine Chemicals</td>
			<td>UTS1003</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>P212121</td>
			<td>RP-S23020</td>
			<td></td>
		</tr>
		<tr>
			<td>UltraPure EDTA</td>
			<td>Invitrogen/Gibco</td>
			<td>15575</td>
			<td></td>
		</tr>
		<tr>
			<td>Amicon Ultra 0.5 mL centrifugal filters</td>
			<td>Sigma-Aldrich</td>
			<td>Z677094-24EA</td>
			<td>3 kDa MWCO</td>
		</tr>
		<tr>
			<td>DTT&#160;</td>
			<td>P212121</td>
			<td>SV-DTT</td>
			<td></td>
		</tr>
		<tr>
			<td>BIS-TRIS propane,&#62;=99.0% (titration)</td>
			<td>Sigma-Aldrich</td>
			<td>B6755-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>ZnCl2</td>
			<td>Sigma-Aldrich</td>
			<td>208086</td>
			<td></td>
		</tr>
		<tr>
			<td>MgSO4</td>
			<td>Amresco</td>
			<td>0662</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>G37-20</td>
			<td></td>
		</tr>
		<tr>
			<td>Gel-loading tips, 1 - 200 &#956;L</td>
			<td>Corning</td>
			<td>CLS4853-400EA</td>
			<td></td>
		</tr>
		<tr>
			<td>Razor blade; Single-edged; 100/Pk.; Pack of 100</td>
			<td>Fisher Scientific</td>
			<td>12-640</td>
			<td></td>
		</tr>
		<tr>
			<td>Sterile Disposable Filter Units with PES Membrane &#62; 250mL</td>
			<td>Thermo Fisher Scientific</td>
			<td>568-0020</td>
			<td></td>
		</tr>
		<tr>
			<td>Dialysis tubing clips</td>
			<td>Spectrum Labs</td>
			<td>132734</td>
			<td></td>
		</tr>
		<tr>
			<td>6-8 kDa 10 mm Dialysis Tubing</td>
			<td>Spectrum Medical</td>
			<td>132645</td>
			<td></td>
		</tr>
		<tr>
			<td>Superose 6 10/300 GL</td>
			<td>GE Healthcare Life Sciences</td>
			<td>17517201</td>
			<td></td>
		</tr>
		<tr>
			<td>Hi-Res Standard Agarose</td>
			<td>AGTC Bioproducts</td>
			<td>AG500D1</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethidium bromide</td>
			<td>Thermo Fisher Scientific</td>
			<td>BP1302</td>
			<td></td>
		</tr>
		<tr>
			<td>Orange G</td>
			<td>Fisher Scientific</td>
			<td>0-267</td>
			<td></td>
		</tr>
		<tr>
			<td>Hyladder 10kb, 500 lanes</td>
			<td>Denville Scientific</td>
			<td>CB4225-4</td>
			<td></td>
		</tr>
	</tbody>
</table>

assembly and purification of prototype foamy virus intasomes

A Definition von Funktion und notwendiger Schritt des Lebenszyklus Retrovirus ist die Integration des viralen Genoms in das Wirtsgenom. Alle Retroviren kodiert eine Integrase (IN)-Enzym, das katalysiert die kovalente Verbindung von viralen Host DNA, bekannt als Strang übertragen. Integration kann modelliert in Vitro mit rekombinante Retroviren und DNA-Oligomere imitiert die Enden des Virusgenoms. Um genauer rekapitulieren die Integration-Reaktion, die auftritt, in Vivo, Integration sind komplexe von rekombinanten IN und synthetischen Oligomere durch Dialyse in einem reduzierten Salzgehalt Puffer montiert. Die Integration komplexer, genannt eine Intasome kann durch Größe Ausgrenzung Chromatographie gereinigt werden. Bei Prototyp schaumig Virus (PFV) der Intasome ist ein Tetramer von innen und zwei DNA-Oligomere und ist leicht von Monomeren IN und kostenlose Oligomer DNA getrennt. Die Effizienz der Integration des PFV Intasomes kann unter einer Vielzahl von experimentellen Bedingungen für die Dynamik besser zu verstehen und Mechanik der retroviralen Integration untersucht.

PFV Intasomes werden von rekombinanten IN und vDNA montiert. Nach der Montage sind Intasomes durch SEC (Abbildung 1) gereinigt. Integration-Aktivität der einzelnen Fraktionen ist mit einem supercoiled DNA Ziel- und Agarose Gelelektrophorese (Abbildung 2) untersucht. Dieses Gel wird mit einem fluoreszierenden Scanner eingestellt, erkennt EtBr (und Fluorophor, wenn Fluorophore beschriftet vDNA verwendet wird) abgebildet. Bildanaly...

Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

Assembly and Purification of Prototype Foamy Virus Intasomes

Rekombinante Retroviren Integrase und DNA-Oligomere imitiert virale DNA enden können einen enzymatisch aktiven Komplex bekannt als ein Intasome bilden. Intasomes können für biochemische, strukturellen und kinetischen Studien verwendet werden. Dieses Protokoll beschreibt, wie zu montieren und zu reinigen Prototyp schaumig Virus Intasomes.

Montage und Reinigung der Prototyp schaumig Virus Intasomes

A defining feature and necessary step of the retrovirus life cycle is the integration of the viral genome into the host genome. All retroviruses encode an ...

assembly-and-purification-of-prototype-foamy-virus-intasomes

Research

JoVE Journal

Immunology and Infection

5.4K Aufrufe.  The Ohio State University College of Medicine. Rekombinante Retroviren Integrase und DNA-Oligomere imitiert virale DNA enden können einen enzymatisch aktiven Komplex bekannt als ein Intasome bilden. Intasomes können für biochemische, strukturellen und kinetischen Studien verwendet werden. Dieses Protokoll beschreibt, wie zu montieren und zu reinigen Prototyp schaumig Virus Intasomes.

Serie: Assembly and Purification of Prototype Foamy Virus Intasomes

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal phase during establishment of infection in a given host. Consequently, study of encapsidation deciphers the information regarding the know-how of the mechanism regulating virus assembly to form infectious virions. Such information is vital in formulating novel methods of curbing virus spread and disease control. Virus encapsidation can be studied in vivo and in vitro. Genome encapsidation in vivo is a highly regulated selective process involving macromolecular interactions and subcellular compartmentalization. Therefore, study leading to dissect events encompassing virus encapsidation in vivo would provide basic knowledge to understand how viruses proliferate and assemble. Recently in vitro encapsidation has been exploited for the research in the area of biomedical imaging and therapeutic applications. Non-enveloped plant viruses stand far ahead in the venture of in vitro encapsidation of the negatively charged foreign material. Brome mosaic virus (BMV), a non-enveloped multicomponent RNA virus pathogenic to plants, has been used as a model system for studying genome packaging in vivo and in vitro. For encapsidation assays in Nicotiana benthamiana plants, Agrobacterium -mediated transient expression, refer to as agroinfiltration, is an efficient and robust technique for the synchronized delivery and expression of multiple components to the same cell. In this approach, a suspension of Agrobacterium tumefaciens cells carrying binary plasmid vectors carrying cDNAs of desiredviral mRNAs is infiltrated into the intercellular space withina leaf using nothing more sophisticated than a 1 ml disposable syringe (without needle). This process results in the transfer of DNA insert into plant cells; the T-DNA insert remains transiently in the nucleus and is then transcribed by the host polymerase II, leading to the transient expression. The resulting mRNA transcript (capped and polyadenylated) is then exported to the cytoplasm for translation. After approximately 24 to 48 hours of incubation,sections of infiltrated leaves can be sampled for microscopyor biochemical analyses. Agroinfiltration permits large numbers (hundreds to thousands) of cells to be transfected simultaneously. For in vitro encapsidation, purified virions of BMV are dissociated into capsid protein by dialyzing against dissociation buffer containing calcium chloride followed by removal of RNA and un-dissociated virions by centrifugation. Genome depleted capsid protein subunits are then reassembled with desired viral genome components or non-viral components such as indocyanine dye.

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

A simple, efficient and robust way to synchronize the delivery of multiple viral components to plant cells via Agrobacterium-mediated transient expression is described. This approach is amenable for studying replication, encapsidation followed by in vitro reassembly of non-viral components into genome depleted optical viral ghosts suitable for biomedical applications.

Einfach und robust In-vivo- Und In-vitro- Ansatz für das Studium Virusassemblierung

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal ...

Forschung

Immunologie und Infektion

Affinity Purification of Influenza Virus Ribonucleoprotein Complexes from the Chromatin of Infected Cells

Like all negative-strand RNA viruses, the genome of influenza viruses is packaged in the form of viral ribonucleoprotein complexes (vRNP), in which the single-stranded genome is encapsidated by the nucleoprotein (NP), and associated with the trimeric polymerase complex consisting of the PA, PB1, and PB2 subunits. However, in contrast to most RNA viruses, influenza viruses perform viral RNA synthesis in the nuclei of infected cells. Interestingly, viral mRNA synthesis uses cellular pre-mRNAs as primers, and it has been proposed that this process takes place on chromatin1. Interactions between the viral polymerase and the host RNA polymerase II, as well as between NP and host nucleosomes have also been characterized1,2.
Recently, the generation of recombinant influenza viruses encoding a One-Strep-Tag genetically fused to the C-terminus of the PB2 subunit of the viral polymerase (rWSN-PB2-Strep3) has been described. These recombinant viruses allow the purification of PB2-containing complexes, including vRNPs, from infected cells. To obtain purified vRNPs, cell cultures are infected, and vRNPs are affinity purified from lysates derived from these cells. However, the lysis procedures used to date have been based on one-step detergent lysis, which, despite the presence of a general nuclease, often extract chromatin-bound material only inefficiently. 
Our preliminary work suggested that a large portion of nuclear vRNPs were not extracted during traditional cell lysis, and therefore could not be affinity purified. To increase this extraction efficiency, and to separate chromatin-bound from non-chromatin-bound nuclear vRNPs, we adapted a step-wise subcellular extraction protocol to influenza virus-infected cells. Briefly, this procedure first separates the nuclei from the cell and then extracts soluble nuclear proteins (here termed the "nucleoplasmic" fraction). The remaining insoluble nuclear material is then digested with Benzonase, an unspecific DNA/RNA nuclease, followed by two salt extraction steps: first using 150 mM NaCl (termed "ch150"), then 500 mM NaCl ("ch500") (Fig. 1). These salt extraction steps were chosen based on our observation that 500 mM NaCl was sufficient to solubilize over 85% of nuclear vRNPs yet still allow binding of tagged vRNPs to the affinity matrix.
After subcellular fractionation of infected cells, it is possible to affinity purify PB2-tagged vRNPs from each individual fraction and analyze their protein and RNA components using Western Blot and primer extension, respectively. Recently, we utilized this method to discover that vRNP export complexes form during late points after infection on the chromatin fraction extracted with 500 mM NaCl (ch500)3.

Influenza viruses replicate their RNA genome in association with host-cell chromatin. Here, we present a method to purify intact viral ribonucleoprotein complexes from the chromatin of infected cells. Purified viral complexes can be analyzed by both Western blot and primer extension of protein and RNA content, respectively.

Affinitätsreinigung des Influenza-Virus Ribonukleoproteinkomplexe aus dem Chromatin der infizierten Zellen

Like all negative-strand RNA viruses, the genome of influenza viruses is packaged in the form of viral ribonucleoprotein complexes (vRNP), in which the ...

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

The opportunistic pathogen Legionella pneumophila is an amoeba-resistant bacterium, which also replicates in alveolar macrophages thus causing the severe pneumonia "Legionnaires' disease"1. In protozoan and mammalian phagocytes, L. pneumophila employs a conserved mechanism to form a specific, replication-permissive compartment, the "Legionella-containing vacuole" (LCV). LCV formation requires the bacterial Icm/Dot type IV secretion system (T4SS), which translocates as many as 275 "effector" proteins into host cells. The effectors manipulate host proteins as well as lipids and communicate with secretory, endosomal and mitochondrial organelles2-4.
The formation of LCVs represents a complex, robust and redundant process, which is difficult to grasp in a reductionist manner. An integrative approach is required to comprehensively understand LCV formation, including a global analysis of pathogen-host factor interactions and their temporal and spatial dynamics. As a first step towards this goal, intact LCVs are purified and analyzed by proteomics and lipidomics.
The composition and formation of pathogen-containing vacuoles has been investigated by proteomic analysis using liquid chromatography or 2-D gel electrophoresis coupled to mass-spectrometry. Vacuoles isolated from either the social soil amoeba Dictyostelium discoideum or mammalian phagocytes harboured Leishmania5, Listeria6, Mycobacterium7, Rhodococcus8, Salmonella9 or Legionella spp.10. However, the purification protocols employed in these studies are time-consuming and tedious, as they require e.g. electron microscopy to analyse LCV morphology, integrity and purity. Additionally, these protocols do not exploit specific features of the pathogen vacuole for enrichment.
The method presented here overcomes these limitations by employing D. discoideum producing a fluorescent LCV marker and by targeting the bacterial effector protein SidC, which selectively anchors to the LCV membrane by binding to phosphatidylinositol 4-phosphate (PtdIns(4)P)3,11 . LCVs are enriched in a first step by immuno-magnetic separation using an affinity-purified primary antibody against SidC and a secondary antibody coupled to magnetic beads, followed in a second step by a classical Histodenz density gradient centrifugation12,13 (Fig. 1).
A proteome study of isolated LCVs from D. discoideum revealed more than 560 host cell proteins, including proteins associated with phagocytic vesicles, mitochondria, ER and Golgi, as well as several GTPases, which have not been implicated in LCV formation before13. LCVs enriched and purified with the protocol outlined here can be further analyzed by microscopy (immunofluorescence, electron microscopy), biochemical methods (Western blot) and proteomic or lipidomic approaches.

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

This article describes a method for the isolation and purification of intact Legionella-containing vacuoles (LCVs) from amoeba and macrophages. The two-step protocol comprises LCV enrichment by immuno-magnetic separation using an antibody against a bacterial LCV marker and further purification by density gradient centrifugation.

Die Reinigung von Pathogen Vakuolen aus<em&gt; Legionellen</em&gt;-Infizierten Phagozyten

The opportunistic pathogen Legionella pneumophila is an amoeba-resistant bacterium, which also replicates in alveolar macrophages thus causing the severe ...

Rescue of Recombinant Newcastle Disease Virus from cDNA

Newcastle disease virus (NDV), the prototype member of the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented, negative-sense, single-stranded, enveloped RNA virus (Figure 1) with potential applications as a vector for vaccination and treatment of human diseases. In-depth exploration of these applications has only become possible after the establishment of reverse genetics techniques to rescue recombinant viruses from plasmids encoding their complete genomes as cDNA2-5. Viral cDNA can be conveniently modified in vitro by using standard cloning procedures to alter the genotype of the virus and/or to include new transcriptional units. Rescue of such genetically modified viruses provides a valuable tool to understand factors affecting multiple stages of infection, as well as allows for the development and improvement of vectors for the expression and delivery of antigens for vaccination and therapy. Here we describe a protocol for the rescue of recombinant NDVs.

Newcastle disease virus (NDV) has been extensively studied in the last few years in order to develop new vectors for vaccination and therapy, among others. These studies have been possible due to techniques to rescue recombinant virus from cDNA, such as those we describe here.

Rettung von rekombinanten Newcastle Disease Virus aus cDNA

Newcastle disease virus (NDV), the prototype member of  the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented,  negative-sense, ...

Isolation, Identification, and Purification of Murine Thymic Epithelial Cells

The thymus is a vital organ for T lymphocyte development. Of thymic stromal cells, thymic epithelial cells (TECs) are particularly crucial at multiple stages of T cell development: T cell commitment, positive selection and negative selection. However, the function of TECs in the thymus remains incompletely understood. In the article, we provide a method to isolate TEC subsets from fresh mouse thymus using a combination of mechanical disruption and enzymatic digestion. The method allows thymic stromal cells and thymocytes to be efficiently released from cell-cell and cell-extracellular matrix connections and to form a single-cell suspension. Using the isolated cells, multiparameter flow cytometry can be applied to identification and characterization of TECs and dendritic cells. Because TECs are a rare cell population in the thymus, we also describe an effective way to enrich and purify TECs by depleting thymocytes, the most abundant cell type in the thymus. Following the enrichment, cell sorting time can be decreased so that loss of cell viability can be minimized during purification of TECs. Purified cells are suitable for various downstream analyses like Real Time-PCR, Western blot and gene expression profiling. The protocol will promote research of TEC function and as well as the development of in vitro T cell reconstitution.

Here we describe an efficient method for isolation, identification, and purification of mouse thymic epithelial cells (TECs). The protocol can be utilized for studies of thymus function for normal T cell development, thymus dysfunction, and T cell reconstitution.

Isolierung, Identifizierung und Reinigung von Murine Thymusepithelzellen

The thymus is a vital organ for T lymphocyte development. Of thymic stromal cells, thymic epithelial cells (TECs) are particularly crucial at multiple ...

Neutrophil Isolation and Analysis to Determine their Role in Lymphoma Cell Sensitivity to Therapeutic Agents

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of inflammation. They are key players in the innate immune system and play major roles in cancer biology. Neutrophils have been proposed as key mediators of malignant transformation, tumor progression, angiogenesis and in the modulation of the antitumor immunity; through their release of soluble factors or their interaction with tumor cells. To characterize the specific functions of neutrophils, a fast and reliable method is coveted for in vitro isolation of neutrophils from human blood. Here, a density gradient separation method is demonstrated to isolate neutrophils as well as mononuclear cells from the blood. The procedure consists of layering the density gradient solution such as Ficoll carefully above the diluted blood obtained from patients diagnosed with chronic lymphocytic leukemia (CLL), followed by centrifugation, isolation of mononuclear layer, separation of neutrophils from RBCsby dextran then lysis of residual erythrocytes. This method has been shown to isolate neutrophils &#8805; 90 % pure. To mimic the tumor microenvironment, 3-dimensional (3D) experiments were performed using basement membrane matrix such as Matrigel. Given the short half-life of neutrophils in vitro, 3D experiments with fresh human neutrophils cannot be performed. For this reason promyelocytic HL60 cells are differentiated along the granulocytic pathway using the differentiation inducers dimethyl sulfoxide (DMSO) and retinoic acid (RA). The aim of our experiments is to study the role of neutrophils on the sensitivity of lymphoma cells to anti-lymphoma agents. However these methods can be generalized to study the interactions of neutrophils or neutrophil-like cells with a large range of cell types in different situations.

Neutrophils are the most abundant type of white blood cells. The isolation of neutrophils from human blood by density gradient separation method and the differentiation of human promyelocytic (HL60) cells along the granulocytic pathway are described here; to test their role on sensitivity of lymphoma cells to anti-lymphoma agents.

Neutrophilen-Isolierung und Analyse zur Bestimmung ihrer Rolle in der Lymphom-Zellempfindlichkeit therapeutische Mittel

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of ...

Evaluation of the Efficacy And Toxicity of RNAs Targeting HIV-1 Production for Use in Gene or Drug Therapy

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential to be used as drug therapies for HIV-1 infection. Post-integration inhibitors include ribozymes, short hairpin (sh) RNAs, small interfering (si) RNAs, U1 interference (U1i) RNAs and RNA aptamers. Many of these have been identified using transient co-transfection assays with an HIV-1 expression plasmid and some have advanced to clinical trials. In addition to measures of efficacy, small RNAs have been evaluated for their potential to affect the expression of human RNAs, alter cell growth and/or differentiation, and elicit innate immune responses. In the protocols described here, a set of transient transfection assays designed to evaluate the efficacy and toxicity of RNA molecules targeting post-integration steps in the HIV-1 replication cycle are described. We have used these assays to identify new ribozymes and optimize the format of shRNAs and siRNAs targeting HIV-1 RNA. The methods provide a quick set of assays that are useful for screening new anti-HIV-1 RNAs and could be adapted to screen other post-integration inhibitors of HIV-1 replication.

Methods to evaluate the efficacy and toxicity of RNA molecules targeting post-integration steps of the HIV-1 replication cycle are described. These methods are useful for screening new molecules and optimizing the format of existing ones.

Bewertung der Wirksamkeit und Toxizität von RNAs Targeting HIV-1-Produktion für den Einsatz in Gene oder Arzneimitteltherapie

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential ...

Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral evolution. Here we describe the construction of an infectious clone for Zika virus (ZIKV), which is currently causing an explosive outbreak in the Americas. To prevent toxicity to bacteria that is commonly observed with flavivirus-derived plasmids, we generated a two-plasmid system which separates the genome at the NS1 gene and is more stable than full-length constructs that could not be successfully recovered without mutations. After digestion and ligation to join the two fragments, full-length viral RNA can be generated by in vitro transcription with T7 RNA polymerase. Following electroporation of transcribed RNA into cells, virus was recovered that exhibited similar in vitro growth kinetics and in vivo virulence and infection phenotypes in mice and mosquitoes, respectively.

This protocol describes the recovery of infectious Zika virus from a two-plasmid infectious cDNA clone.

Rettung und Charakterisierung des rekombinanten Virus aus einer neuen Welt Zika Virus Infectious Clone

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral ...

Detection and Removal of Nuclease Contamination During Purification of Recombinant Prototype Foamy Virus Integrase

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared to IN from other retroviruses, PFV IN is more soluble and more amenable to experimental manipulation. Additionally, it is sensitive to clinically relevant human immunodeficiency virus (HIV-1) IN inhibitors, suggesting that the catalytic mechanism of PFV IN is similar to that of HIV-1 IN. IN catalyzes the covalent joining of viral complementary DNA (cDNA) to target DNA in a process called strand transfer. This strand transfer reaction introduces nicks to the target DNA. Analysis of integration reaction products can be confounded by the presence of nucleases that similarly nick DNA. A bacterial nuclease has been shown to co-purify with recombinant PFV IN expressed in Escherichia coli (E. coli). Here we describe a method to isolate PFV IN from the contaminating nuclease by heparin affinity chromatography. Fractions are easily screened for nuclease contamination with a supercoiled plasmid and agarose gel electrophoresis. PFV IN and the contaminating nuclease display alternative affinities for heparin sepharose allowing a nuclease-free preparation of recombinant PFV IN suitable for bulk biochemical or single molecule analysis of integration.

Recombinant prototype foamy virus integrase protein is often contaminated with a bacterial nuclease during purification. This method identifies nuclease contamination and removes it from the final preparation of the enzyme.

Erkennung und Entfernung von Nuklease Kontamination während der Reinigung von rekombinanten Prototyp schaumig Virus Integrase

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared ...

Rapid, Safe, and Simple Manual Bedside Nucleic Acid Extraction for the Detection of Virus in Whole Blood Samples

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for the rapid bedside inactivation of the Ebola virus during blood sampling for safe nucleic acid (NA) tests by adding a commercial lysis/binding buffer directly into the vacuum blood collection tubes. Using this bedside inactivation approach, we have developed a safe, rapid, and simplified bedside NA extraction method for the subsequent detection of a virus in lysis/binding buffer-inactivated whole blood. The NA extraction is directly performed in the blood collection tubes and requires no equipment or electricity. 
After the blood is collected into the lysis/binding buffer, the contents are mixed by flipping the tube by hand, and the mixture is incubated for 20 min at room temperature. Magnetic glass particles (MGPs) are added to the tube, and the contents are mixed by flipping the collection tube by hand. The MGPs are then collected on the side of the blood collection tube using a magnetic holder or a magnet and a rubber band. The MGPs are washed three times, and after the addition of elution buffer directly into the collection tube, the NAs are ready for NA tests, such as qPCR or isothermal loop amplification (LAMP), without the removal of the MGPs from the reaction. The NA extraction method is not dependent on any laboratory facilities and can easily be used anywhere (e.g., in field hospitals and hospital isolation wards). When this NA extraction method is combined with LAMP and a portable instrument, a diagnosis can be obtained within 40 min of the blood collection.

Here, we present a protocol for the rapid virus nucleic acid extraction from the virus-inactivated whole blood. The extraction is performed directly in the blood collection tubes and requires no equipment or electricity. The method is not dependent on laboratory facilities and can be used anywhere (e.g., in field hospitals).

Schnelle, sichere und einfache manuelle am Krankenbett Nukleinsäure-Extraktion für den Nachweis des Virus in Vollblut-Proben

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for ...