Bu eser NIH AI099854 ve AI126742 için anahtar tarafından desteklenmiştir.

1. tavlama, vDNA
<ol><li>Birleştirme 1 X on tampon (10 X 10 hisse senedi: 100 mM Tris-HCl, pH 8.0, 1 M NaCl, 10 mM EDTA), 10 µM Oligo 1 (5' ATTGTCATGGAATTTTGTATATTGAGTGGCGCCCGAACAG 3', 100 µM hisse senedi) ve 10 µM Oligo 2 (5' CTGTTCGGGCGCCACTCAATATACAAAATTCCATGACA 3', 100 µM hisse senedi) son hacmi 1.5 mL ' . Aliquot 25 µL altmış 0,2 mL Polimeraz zincir reaksiyonu (PCR) tüpler içine. Not: fluorophores veya Etiketler sonunda 5'-Oligo 2 veya bir iç amino-T 5'-sonundan itibaren Oligo 1 temel 13 olarak reaksiyonlar uygulamaya bağlı olarak değiştirilebilir. Değiştirilmiş reaksiyonlar tarafından yüksek performanslı sıvı Kromatografi (HPLC) tavlama önce saf. Biz 5' uç Cy3 veya Cy5 fluorophore Oligo 2 / etiketleme intasome montaj verimliliği 10 kat azaltır bulduk. İç fluorophore etiketleme derleme etkinliğini azaltmaz.</li>
	<li>Bir thermocycler kullanarak aşağıdaki saatlerde ve sıcaklıklar ile TAV: 1 döngüsü 94.0 ˚C 3 dk, 99 döngüsü sırasında (94.0 ˚C 1 dk, 93.6 ˚C 1dk) devir başına 0.8 ˚C tarafından her iki sıcaklık azalan (14,8 ˚C 1 dk, 14.4 ˚C son döngüdür 1 dk) ve mağaza 4.0 ˚C.</li>
	<li>Tüm altmış tüpler tavlama reaksiyonlardan birleştirin. İki 0.5 mL 3 kDa molekül ağırlığı kesme (MWCO) ultracentrifugal filtre konsantrasyon cihazları için 500 µL yükleyin. Tavlanmış vDNA tarafından Santrifüjü 14.000 x g (RT) oda sıcaklığında 10 dakika için de bir microcentrifuge içinde konsantre ol. Not: Retentate birim ~ 50 µL her konsantrasyon biriminde olması gerekir.</li>
	<li>Aracılığıyla akış atmak. Kalan tavlanmış vDNA 250 µL her filtre birimine çalışan ekleyin. Spin yineleyin ve aracılığıyla akış atın. TE arabellek (10 mM Tris-HCl, pH 8.0, 1 mM EDTA) Exchange'e 450 µL TE ile üç kez yıkayarak tampon.</li>
	<li>Filtre ünitesi ve 1000 x g RT. 2 min için spin ters çevir Her filtre ünitesi için son retentate ses ~ 50 µL. birleştirin retentates ve 1,5 mL vidalı kapak tüp aktarmak olmalıdır.</li>
	<li>VDNA 260 nm ultraviyole (UV) Absorbans ölçmek. Son molar DNA toplama hesaplamak için bu değeri kullanın. Bu vDNA yok olma katsayısı (ε260) 622,803 cm-1 M-1 ve Moleküler ağırlığı-20 ˚C 23,972 da dükkanda.</li>
</ol>2. Intasome derleme
<ol><li>Mümkünse, intasome derleme küçük bir odada bir değişken termostat ile gerçekleştirin. Termostat yaklaşık 18-22 ˚C için ayarlayın. Not: deneyim, intasome Meclis 4 ˚C de verimli değildir.</li>
	<li>Bir 2 L ölçek bir heyecan plaka üzerinde bir heyecan çizgiyle diyaliz arabelleği (20 mM Bis-tris propan, pH 7.5, 200 mM NaCl, 2 mM dithiothreitol (DTT), 25 µM ZnCl2) 1 L hazırlayın. Arabellek en az 6 h 18-22 ˚C Oda equilibrate.</li>
	<li>İntasomes bir araya getirmek için 50 mM Bis-tris propan, pH 7.5, 500 mM NaCl, 120 µM PFV inç ve 50 µM vDNA 150 µL toplam hacmi içinde birleştirir. Not: PFV inç nükleaz etkinlik7,8kirletici ücretsiz olmalıdır. PFV inç konsantrasyonu ise 200 µL için son hacim artırmak mümkün o zaman da 120 µM inç 150 µL birimindeki karşılamak için sulandırmak. Bu adımın kritik faktörler inç molar oranını vDNA (2.4:1) için korumak için ve Kromatografi sırasında görselleştirmek için yeterli kompleksi için vardır.</li>
	<li>~ 10 cm uzun bir parçası 10 mm 6-8 kDa MWCO diyaliz boru ve klipleri Çift Kişilik distile su (GKD2O) veya en yüksek saflık su ile temizleyin. Tüp bir ucunu küçük. Not: Diyaliz boru laboratuvar uzaydan gelen herhangi bir olası kontaminasyonu önlemek için itina ile ele alınmalıdır.</li>
	<li>Diyaliz boru durulama arabellek (50 mM Bis-tris propan, pH 7.5, 500 mM NaCl) 15 mL olun. Üç kez 1-2 mL durulama arabelleği ile diyaliz boru içine durulayın. Durulama arabelleğin bir pipet ve ince jeli ipucu yükleme mümkün olduğunca çoğunu olmaktan çıkarın.</li>
	<li>Gerekirse, bir temiz jilet veya neşter ince jel yükleme bahşiş hortumunun sonuna ulaşmak böylece diyaliz boru kesmek için kullanın.</li>
	<li>İntasome derleme bir pipet ve ince bir jeli ipucu yükleme diyaliz boru 2.3 adımından aktarın. Açık uçlu boru içinde tanıtılan hava miktarını en aza indirerek diyaliz hortumunun küçük. Boru diyaliz arabellek içine yerleştirin.</li>
	<li>Diyaliz tüp döner ama bir girdap içinde değil böylece nazik karıştırma ile bir gecede (16-20 h). Diyaliz boru batık ve mobil olduğundan emin olun. Yaklaşık bir saat sonra görünür bir çökelti tüp içinde gözlemlemek. Not: Cy3 veya vDNA fluorescently etiketli Cy5 ile çökelti daha açıktır. Bu son etiketli ve dahili olarak etiketli floresan vDNA için geçerlidir.</li>
</ol>3. Intasome Solubilization
<ol><li>İki hazırlamak geniş delik pipet ipuçları 2-4 mm 200 µL bahşiş sonundan itibaren yeni bir jilet ya da neşter bıçak temiz bir yüzey üzerinde kaldırarak. Not: İpuçları adım 3.3 ve 3.5 kullanılacaktır.</li>
	<li>Diyaliz boru diyaliz arabelleğinden kaldırın. Seyreltme klibi yakınındaki hortumunun sonuna kalabilir diyaliz arabelleği ile intasome örneğinin önlemek için bir micropipette bir küçük pipet ucu ile herhangi bir aşırı diyaliz arabellek kaldırmak için kullanın. Küçük resmi diyaliz hortumunun bir ucundan kaldır.</li>
	<li>Kullanım geniş bir adım çökelti diyaliz boru 1,5 mL tüp buz içinde de dahil olmak üzere örnek aktarmak için 3.1 pipet ucu delik. Not kurtarılan malzemenin toplam hacmi; Toplam genellikle ~ 140 µL birimdir.</li>
	<li>200 mM NaCl ile çökelti örneğidir; son konsantrasyonu 320 mm NaCl tuzu bir hisse senedi 5 M NaCl çözüm uygun hacmi ekleyerek artırmak. Örneğin, 150 µL örneği için 3,9 µL 5 M ekleyin NaCl ve 1.1 µL GKD2O 155 µL. Transfer buz kovası ile son bir birim için örnek bir 4 ˚C soğuk odaya.</li>
	<li>Kullanım geniş bir adım resuspend ve pipetting tarafından çökelti solubilize 3.1 pipet ucu delik. Her 20 dakikada en az 1 h. çökelti çoğunu çözüm gitmeli gözlemlemek için yineleyin. Not: çökelti zaman puan arasında artık belirgin bir şekilde azalır belli olduğunda çökelti resuspend için Pipetting durdurulabilir. VDNA değil etiketlenir veya dahili olarak etiketlenir, çökelti görsel inceleme üzerine dayalı ~ 90 oranında azalır. VDNA etiketli Cy5 son söz konusu olduğunda, çökelti sadece ~ 20 oranında azalır; vDNA etiketli fluorophore ucuyla çökelti çoğunu solubilize değil. Etkili çözündürüldükten çökelti değişkendir ve ampirik olarak kararlı olmalıdır.</li>
</ol>4. Intasome arıtma
<ol><li>250 mL boyutu dışlama Kromatografi (sn) arabellek (20 mM Bis-tris propan, pH 7.5, 320 mM NaCl, % 10 gliserol) çalıştıran hazırlayın. Steril filtre 0.2 µm ile tampon filtre ünitesi ve 4 ˚C saklayın. Not: Tüm arıtma adımlar 4 ˚C soğuk odada gerçekleştirilir.</li>
	<li>Bir çapraz bağlı özel sn sütun equilibrate (çapı = 10 mm; uzunluğu 300 mm =; yatak birim 24 mL =; örnek hacmi = 25-500 µL; maksimum basınç = 1,5 MPa; dışlama sınırı = 4 x 107 Da; moleküler ağırlık ayıran Mat tablo 5 ve 5000 kDa arasında görmek erials) sn 0.4 mL/dk akış hızında çalışan arabelleği ile. Not: etkin bir şekilde Superose 12 10/300 GL veya Superose 6 artırmak gibi 44 kDa 300 kDa ayırmak mümkün olup olmadığını bu arıtma farklı boyut dışlama sütunlar için adapte. Superose 12 10/300 GL daha düşük çözünürlük, zirveleri daha fazla çakışma için lider vardır. Tersine, Superose 6 artış daha yüksek çözünürlüğe sahip ve daha iyi renk ayrımı sunmaktadır.</li>
	<li>14.000 x g 4 ˚C kalan herhangi bir çökelti cips, 10 min için de bir microfuge intasome örnekte santrifüj kapasitesi. Dikkatli bir şekilde süpernatant çıkarın. Süpernatant 200 µL enjeksiyon döngü (~ 200 μL tutabilir boru) yükleyin. Örnek sn sütun için geçerlidir. Not: Daha küçük yük birimler sn tarafından daha fazla çözünürlük sağlar.</li>
	<li>25 sn çalıştıran tampon ve 270 µL. 95 kesirler toplamak mL ile elute sn Kromatografik üç A280/A260 tepeler (şekil 1) görüntüler gözlemlemek. Not: İlk toplama (~9.0 - 11,5 mL elüsyon), ardından PFV tetramer intasome tepe (~12.0 - 14.75 mL elüsyon) ve PFV inç monomer ücretsiz vDNA tepe (~15.0 - 18,0 mL) ile olmalıdır.</li>
</ol>5. entegrasyon Strand Transfer tahlil, kesir seçimi ve depolama
<ol><li>Her intasome tepe kesir ve 50 2 µL birleştirmek ng 3 kb supercoiled plazmid DNA (hisse senedi toplama olduğunu 50 ng/µL) 15 µL son tepki hacmine tepki arabelleği (10 mM Bis-tris propan, pH 7.5, 110 mM NaCl, 5 mM MgSO4, 4 µM ZnCl2, 10 mM DTT). 5 min için 37 ˚C, kuluçkaya.</li>
	<li>Eklenen hiçbir PFV intasome ile bir negatif kontrol içerir. Reaksiyon (20 mg/mL stok çözelti) 0,75 µL İndinavir K ile ve 0,75 µL SDS durdurmak (% 10 hisse senedi çözüm). -20 ˚C daha sonraki analizler için gerektiği gibi 1 h. mağaza örnekleri için 55 ˚C, kuluçkaya. Not: Bu tahlil Tümleştirme faaliyet nitel bir değerlendirme olduğunu. Her kesir intasome molar konsantrasyon bu tahlil önce belirlenir değildir. Entegrasyon strand transfer tahlil dahil kesirler saklanabilir kadar entegrasyon (gece depolama da dahil olmak üzere) buzda etkinliğini doğruladı ve seçili kesirler bölünmemeli. Burada pMP2, bir pUC19 türev9kullanırız. Biz de başarıyla 5.4 kb plazmid pcDNA 3.1 kullandık. İçin çözülmüş olabilir herhangi bir plazmid daire, doğrusal, rahat ve supercoiled formları tümleştirme için bir hedef olarak kullanılabilir.</li>
	<li>120 mL % 1 kilo başına 1 X TAE (40 mM Tris-asetat, 1 mM EDTA) önbellekle 0,1 μg/mL arasında etidyum bromür (EtBr, 10 mg/mL stok solüsyon)10birim (w/v) özel jel hazırlayın. Özel çözüm eritmek ve 15 cm x 10 cm jel döküm tepsiye dökün. 15-iyi tarak 5 mm genişliğinde, 0,75 mm kalın kuyu ile ekleyin. Not: 1.5 mm kalınlığında wells için karşılaştırıldığında daha iyi grup çözünürlük daha dar kuyu verim.</li>
	<li>Ortam sıcaklığında katılaşmaya jel izin. 1 X TAE ile 0,1 μg/mL EtBr jel bırakın.</li>
	<li>3 µL % 50 gliserol her Tümleştirme tepki adım 5.2 ekleyin. Jel tüm reaksiyon birime yükleyin. 10 kb DNA boyutu işaretleyici (150 ng/µL hisse senedi toplama) örnekleri her iki tarafında kulvar için 1 µL yük; başka bir deyişle, DNA boyutu marker örnek şerit yan.</li>
	<li>Dış bir şeritte 6 µL Orange G boya (%0.25 portakal G, % 30 gliserol) yükleyin. Jel sabit voltaj, 10 V/cm (100 V), ortam sıcaklığında veya 1 h için Orange G boya açık jel sonuna ulaşana kadar çalıştırın.</li>
	<li>Hemen özel jel EtBr (532 nm uyarma, 610 nm emisyon filtre) tespit etmek için ayarla floresan bir tarayıcı ile resim. VDNAs etiketli fluorophore kullandıysanız, aynı zamanda uygun fluorophore ayarları ile görüntü. Not: Örneğin, Cy5 tespit etmek için DNA, 633 nm uyarma ve 670 nm emisyon filtreleri kullanarak görüntü etiketli. Uyumlu entegrasyon ürünleri (CI, doğrusal DNA) ~ 3 kb boyutu sadık çalıştırmalısınız, unreacted supercoiled plazmid (SC) daha hızlı (~ 2 kb) çalıştırmalısınız ve yarı-site entegrasyon ürünleri (HSI, rahat daire DNA) yavaş (~3.5 kb) çalıştırmalısınız. Unreacted vDNA ~ 40, gerçek boyutu çalıştırmak gerekir kan basıncı.</li>
	<li>Her yol, görüntüleme yazılım7bantlarında ölçmek. DNA kesir CI, HSI veya SC her şeritte hesaplamak; vDNA bu hesaba dahil değil. Not: Entegrasyon verimliliği veya doğrusal bir ürün, dönüştürülmüş SC kısmını uyumlu entegrasyon ürünleri (CI) piksel hacmi üç grup (HSI + CI + SC) toplam piksel Hacmen bölerek hesaplanmıştır. İntasomes etiketli fluorophore iseniz, HSI ve CI ürünleri de floresan tarafından quantitated.</li>
	<li>En uyumlu entegrasyon etkinliğine sahip kesirler seçin. Not: deneyim, tetrameric PFV intasomes tanımlanan protein en yüksek ile en yüksek uyumlu entegrasyon etkinlik denk geliyor. Her birinin bu kesirler A280 ölçmek ve son intasome konsantrasyonu hesaplayın. PFV inç vahşi türünde iki vDNAs burada anlatılan bir tetramer ε280 908,339 cm-1M-1 ve molekül ağırlığı 225.5 kDa. Konsantrasyonları aynı model olarak sn Kromatografik tepe ve strand transfer tahlil takip etmelidir.</li>
	<li>5 µL aliquots her kesir dağıtmak ve erken sıvı azot içinde dondurmak. Aliquots,-80 ˚C saklayın. Depolama birimi için seçilen kesirler genellikle 200-600 nM arasında bulunmaktadır.</li>
</ol>

<ol>
	<li>Coffin, J. M., Hughes, S. H., Varmus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Retroviruses. , (1997).</li><li>Valkov, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+and+structural+characterization+of+the+integrase+from+the+prototype+foamy+virus.">Functional and structural characterization of the integrase from the prototype foamy virus.</a> Nucleic Acids Res. 37 (1), 243-255 (2009).</li><li>Hare, S., Gupta, S. S., Valkov, E., Engelman, A., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasome+assembly+and+inhibition+of+DNA+strand+transfer.">Retroviral intasome assembly and inhibition of DNA strand transfer.</a> Nature. 464 (7286), 232-236 (2010).</li><li>Li, M., Lin, S., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Outer+domains+of+integrase+within+retroviral+intasomes+are+dispensible+for+catalysis+of+DNA+integration.">Outer domains of integrase within retroviral intasomes are dispensible for catalysis of DNA integration.</a> Protein Sci. 25 (2), 472-478 (2016).</li><li>Gupta, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solution+conformations+of+prototype+foamy+virus+integrase+and+its+stable+synaptic+complex+with+U5+viral+DNA.">Solution conformations of prototype foamy virus integrase and its stable synaptic complex with U5 viral DNA.</a> Structure. 20 (11), 1918-1928 (2012).</li><li>Jones, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasomes+search+for+a+target+DNA+by+1D+diffusion+which+rarely+results+in+integration.">Retroviral intasomes search for a target DNA by 1D diffusion which rarely results in integration.</a> Nat Commun. 7, 11409 (2016).</li><li>Lopez, M. A., Mackler, R. M., Altman, M. P., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+and+removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Detection and removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Vis Exp. , (2017).</li><li>Lopez, M. A., Mackler, R. M., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Virol Methods. 235, 134-138 (2016).</li><li>Poirier, M. G., Bussiek, M., Langowski, J., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+access+to+DNA+target+sites+in+folded+chromatin+fibers.">Spontaneous access to DNA target sites in folded chromatin fibers.</a> J Mol Biol. 379 (4), 772-786 (2008).</li><li>Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments.">Agarose gel electrophoresis for the separation of DNA fragments.</a> J Vis Exp. (62), (2012).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+reveals+a+novel+octameric+integrase+structure+for+betaretroviral+intasome+function.">Cryo-EM reveals a novel octameric integrase structure for betaretroviral intasome function.</a> Nature. 530 (7590), 358-361 (2016).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+supramolecular+assembly+mediates+lentiviral+DNA+integration.">A supramolecular assembly mediates lentiviral DNA integration.</a> Science. 355 (6320), 93-95 (2017).</li><li>Passos, D. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+structures+and+atomic+model+of+the+HIV-1+strand+transfer+complex+intasome.">Cryo-EM structures and atomic model of the HIV-1 strand transfer complex intasome.</a> Science. 355 (6320), 89-92 (2017).</li><li>Yin, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Rous+sarcoma+virus+intasome.">Crystal structure of the Rous sarcoma virus intasome.</a> Nature. 530 (7590), 362-366 (2016).</li><li>Maertens, G. N., Hare, S., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mechanism+of+retroviral+integration+from+X-ray+structures+of+its+key+intermediates.">The mechanism of retroviral integration from X-ray structures of its key intermediates.</a> Nature. 468 (7321), 326-329 (2010).</li><li>Maskell, D. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+for+retroviral+integration+into+nucleosomes.">Structural basis for retroviral integration into nucleosomes.</a> Nature. 523 (7560), 366-369 (2015).</li></ol>

Yazarlar ifşa gerek yok.

Retroviral Ins entegrasyonu gerçekleştirmek için ve viral ömrünün devam viral genomik DNA ile karmaşık bir multimeric oluştururlar. Monomer intasome başına sayısı tetramers, octamers ya da muhtemelen daha yüksek sipariş multimers11,12,13,14olabilir. PFV intasomes3. bir tetramer rekombinant viral genomik DNA taklit çift iplikçikli DNA reaksiyonla...

Ana bilgisayar genom viral genom entegrasyonu döngüsündeki tüm Retrovirüsler1zorunlu bir adımdır. Viral enzim integrase (IN) viral DNA genom DNA ağırlamaktan her iki ucuna kovalent katılmadan tromboksan. Hücresel bir enfeksiyon sırasında Tümleştirme aracılık eder öncesi entegrasyonu karmaşık bir parçasıdır. Rekombinant inç viral DNA uçları taklit çift iplikçikli DNA reaksiyonlar ile complexed da bir hedef DNA vitro2entegrasyon gerçekleştirebilirsiniz. Bir ortak Tümleştirme tahlil vitro supercoiled plazmid DNA hedef kullanır. Her iki viral DNA reaksiyonlar (vDNA) için plazmid bütünleştirilmesi doğrusal bir üründe sonuçları ve uyumlu entegrasyon (şekil 2A) olarak adlandırılır. Entegrasyon tahlil vitro da tek bir vDNA kovalent rahat bir daire içinde sonuçlanan hedef plazmid katıldı ile ürün verim. Bu yarı-site Tümleştirme ürün tahlil içinde in vitrobir eşya gibi görünüyor.
Rekombinant inç ve vDNA entegrasyonu vitrogerçekleştirebilir, ama monomeric inç ilgili görselleştirme karanlık onlar Tümleştirme kompleksleri yapısını veya çalışması dinamikleri ile ideal Kimyasalları değil. Arıtılmış Tümleştirme kompleksleri veya "intasomes," dinamik tek molekül analiz veya yapısal çalışmalar için gereklidir. PFV inç ve vDNAs diyaliz tarafından bir daha düşük tuz konsantrasyonu3,4' e bir nispeten yüksek tuz konsantrasyonu arabelleğinden monte. Diyaliz, bir çökelti sırasında formları. Bu çökelti diyaliz kaldırılır ve tuz konsantrasyonu artar. Yüksek tuz konsantrasyonu acele içeren PFV intasomes solubilizes. İntasomes o zaman boyutu dışlama Kromatografi (sn) tarafından saf. Rekombinant prototip köpüklü virüs (PFV) inç 225 µM5konsantrasyonlarda çözümde bir monomer olarak bulunmaya gösterilmiştir. SN ayırma etkili bir tetramer PFV inç ve iki vDNAs içeren PFV intasomes (225.5 kDa), monomeric PFV (44,4 kDa) ve ücretsiz vDNA (24.0 kDa) ayırır. PFV intasomes dondurulmuş olabilirler ve en az altı ay-80 ˚C, Muhafazası için Tümleştirme etkinliğini korumak.
Rekombinant PFV intasomes de amino asit oyuncu değişikliği veya kesilme mutasyonlar veya fluorophores veya biotin4,6ile etiketli vDNAs içerecek şekilde değiştirilmiş. Saf PFV intasomes kolayca supercoiled plazmid hedef DNA vitroentegrasyonu gerçekleştirmek. Toplu biyokimyasal Tümleştirme deneyleri ile intasomes etkilerini mutasyonların inhibitörleri veya diğer maddeleri, kimyevî test. Biotinylated intasomes nükleik asit veya proteinler ile ilgi soruşturma için kullanılabilir. PFV intasomes iki vDNA ucu veya intasome arama hedef görselleştirmek için toplam iç yansıma Floresans katılmadan arasında geçen zamanı ölçmek için manyetik cımbız tarafından tek molekül mikroskobu analiz için izin ortam sıcaklığında işlevsel olduğundan DNA6. Ayrıca, PFV intasomes ilk yapısal olarak olacak önemli ölçüde etkileyen retroviral entegrasyon3alan ile karakterize edildi.

<table>
	<tbody>
		<tr>
			<td>DNA Oligomers</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>Custom DNA Oligos</td>
		</tr>
		<tr>
			<td>Tris Ultra Pure</td>
			<td>Gojira Fine Chemicals</td>
			<td>UTS1003</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>P212121</td>
			<td>RP-S23020</td>
			<td></td>
		</tr>
		<tr>
			<td>UltraPure EDTA</td>
			<td>Invitrogen/Gibco</td>
			<td>15575</td>
			<td></td>
		</tr>
		<tr>
			<td>Amicon Ultra 0.5 mL centrifugal filters</td>
			<td>Sigma-Aldrich</td>
			<td>Z677094-24EA</td>
			<td>3 kDa MWCO</td>
		</tr>
		<tr>
			<td>DTT&#160;</td>
			<td>P212121</td>
			<td>SV-DTT</td>
			<td></td>
		</tr>
		<tr>
			<td>BIS-TRIS propane,&#62;=99.0% (titration)</td>
			<td>Sigma-Aldrich</td>
			<td>B6755-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>ZnCl2</td>
			<td>Sigma-Aldrich</td>
			<td>208086</td>
			<td></td>
		</tr>
		<tr>
			<td>MgSO4</td>
			<td>Amresco</td>
			<td>0662</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>G37-20</td>
			<td></td>
		</tr>
		<tr>
			<td>Gel-loading tips, 1 - 200 &#956;L</td>
			<td>Corning</td>
			<td>CLS4853-400EA</td>
			<td></td>
		</tr>
		<tr>
			<td>Razor blade; Single-edged; 100/Pk.; Pack of 100</td>
			<td>Fisher Scientific</td>
			<td>12-640</td>
			<td></td>
		</tr>
		<tr>
			<td>Sterile Disposable Filter Units with PES Membrane &#62; 250mL</td>
			<td>Thermo Fisher Scientific</td>
			<td>568-0020</td>
			<td></td>
		</tr>
		<tr>
			<td>Dialysis tubing clips</td>
			<td>Spectrum Labs</td>
			<td>132734</td>
			<td></td>
		</tr>
		<tr>
			<td>6-8 kDa 10 mm Dialysis Tubing</td>
			<td>Spectrum Medical</td>
			<td>132645</td>
			<td></td>
		</tr>
		<tr>
			<td>Superose 6 10/300 GL</td>
			<td>GE Healthcare Life Sciences</td>
			<td>17517201</td>
			<td></td>
		</tr>
		<tr>
			<td>Hi-Res Standard Agarose</td>
			<td>AGTC Bioproducts</td>
			<td>AG500D1</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethidium bromide</td>
			<td>Thermo Fisher Scientific</td>
			<td>BP1302</td>
			<td></td>
		</tr>
		<tr>
			<td>Orange G</td>
			<td>Fisher Scientific</td>
			<td>0-267</td>
			<td></td>
		</tr>
		<tr>
			<td>Hyladder 10kb, 500 lanes</td>
			<td>Denville Scientific</td>
			<td>CB4225-4</td>
			<td></td>
		</tr>
	</tbody>
</table>

assembly and purification of prototype foamy virus intasomes

A özelliği ve gerekli adım retrovirüsü yaşam döngüsünün tanimlar viral genom entegrasyon ana bilgisayar genom. Tüm Retrovirüsler kovalent ana bilgisayara strand transfer olarak bilinen DNA viral birleştirilmesi tromboksan integrase (IN) enzim kodlamak. Entegrasyon modellenmiş vitro rekombinant retroviral inç ile olmak ve viral genom uçları taklit eden DNA reaksiyonlar olabilir. Daha yakından vivo içindeentegrasyon oluşur Tümleştirme tepki özetlemek için kompleksleri rekombinant inç ve sentetik reaksiyonlar diyaliz azaltılmış tuz konsantrasyonu arabellekte tarafından monte edilir. Entegrasyonu karmaşık, bir intasome olarak adlandırılan boyut dışlama Kromatografi tarafından saf. Prototip köpüklü virüs (PFV), söz konusu olduğunda intasome inç bir tetramer ve iki DNA reaksiyonlar ve kolayca monomeric inç ve ücretsiz oligomer DNA ayrılır. PFV intasomes entegrasyon verimliliği daha iyi dinamiklerini anlamak için deneysel koşullar çeşitli ve mekanik retroviral entegrasyon altında denetlesinler.

PFV intasomes rekombinant inç vDNA toplanır. Derleme sonra intasomes (şekil 1) SEC tarafından saf. Entegrasyon etkinliği her kesir bir supercoiled DNA hedef ve özel Jel Elektroforez ile (Şekil 2) denetlesinler. Bu jel EtBr (ve fluorophore, fluorophore etiketli vDNA kullanılırsa) algılamak için ayarla floresan tarayıcıyla görüntüsü. Görüntü analiz yazılımı kullanarak, grup piksel birimleri entegrasyon veriml...

Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

Assembly and Purification of Prototype Foamy Virus Intasomes

Rekombinant retroviral integrase ve DNA reaksiyonlar viral DNA uçları taklit eden bir intasome bilinen bir enzimatik etkin kompleks oluşabilir. Intasomes biyokimyasal, yapısal ve Kinetik çalışmalar için kullanılır. Bu protokolü nasıl bir araya getiren ve prototip köpüklü virüs intasomes arındırmak ayrıntılı.

Derleme ve prototip köpüklü virüs Intasomes arıtma

A defining feature and necessary step of the retrovirus life cycle is the integration of the viral genome into the host genome. All retroviruses encode an ...

assembly-and-purification-of-prototype-foamy-virus-intasomes

Research

JoVE Journal

Immunology and Infection

5.4K Görüntüleme.  The Ohio State University College of Medicine. Rekombinant retroviral integrase ve DNA reaksiyonlar viral DNA uçları taklit eden bir intasome bilinen bir enzimatik etkin kompleks oluşabilir. Intasomes biyokimyasal, yapısal ve Kinetik çalışmalar için kullanılır. Bu protokolü nasıl bir araya getiren ve prototip köpüklü virüs intasomes arındırmak ayrıntılı.

Video: Assembly and Purification of Prototype Foamy Virus Intasomes

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal phase during establishment of infection in a given host. Consequently, study of encapsidation deciphers the information regarding the know-how of the mechanism regulating virus assembly to form infectious virions. Such information is vital in formulating novel methods of curbing virus spread and disease control. Virus encapsidation can be studied in vivo and in vitro. Genome encapsidation in vivo is a highly regulated selective process involving macromolecular interactions and subcellular compartmentalization. Therefore, study leading to dissect events encompassing virus encapsidation in vivo would provide basic knowledge to understand how viruses proliferate and assemble. Recently in vitro encapsidation has been exploited for the research in the area of biomedical imaging and therapeutic applications. Non-enveloped plant viruses stand far ahead in the venture of in vitro encapsidation of the negatively charged foreign material. Brome mosaic virus (BMV), a non-enveloped multicomponent RNA virus pathogenic to plants, has been used as a model system for studying genome packaging in vivo and in vitro. For encapsidation assays in Nicotiana benthamiana plants, Agrobacterium -mediated transient expression, refer to as agroinfiltration, is an efficient and robust technique for the synchronized delivery and expression of multiple components to the same cell. In this approach, a suspension of Agrobacterium tumefaciens cells carrying binary plasmid vectors carrying cDNAs of desiredviral mRNAs is infiltrated into the intercellular space withina leaf using nothing more sophisticated than a 1 ml disposable syringe (without needle). This process results in the transfer of DNA insert into plant cells; the T-DNA insert remains transiently in the nucleus and is then transcribed by the host polymerase II, leading to the transient expression. The resulting mRNA transcript (capped and polyadenylated) is then exported to the cytoplasm for translation. After approximately 24 to 48 hours of incubation,sections of infiltrated leaves can be sampled for microscopyor biochemical analyses. Agroinfiltration permits large numbers (hundreds to thousands) of cells to be transfected simultaneously. For in vitro encapsidation, purified virions of BMV are dissociated into capsid protein by dialyzing against dissociation buffer containing calcium chloride followed by removal of RNA and un-dissociated virions by centrifugation. Genome depleted capsid protein subunits are then reassembled with desired viral genome components or non-viral components such as indocyanine dye.

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

A simple, efficient and robust way to synchronize the delivery of multiple viral components to plant cells via Agrobacterium-mediated transient expression is described. This approach is amenable for studying replication, encapsidation followed by in vitro reassembly of non-viral components into genome depleted optical viral ghosts suitable for biomedical applications.

Basit ve Sağlam In vivo Ve In vitro</emVirüs Meclisi Öğrenmenin> Yaklaşım

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal ...

İmmünoloji ve Enfeksiyon

Affinity Purification of Influenza Virus Ribonucleoprotein Complexes from the Chromatin of Infected Cells

Like all negative-strand RNA viruses, the genome of influenza viruses is packaged in the form of viral ribonucleoprotein complexes (vRNP), in which the single-stranded genome is encapsidated by the nucleoprotein (NP), and associated with the trimeric polymerase complex consisting of the PA, PB1, and PB2 subunits. However, in contrast to most RNA viruses, influenza viruses perform viral RNA synthesis in the nuclei of infected cells. Interestingly, viral mRNA synthesis uses cellular pre-mRNAs as primers, and it has been proposed that this process takes place on chromatin1. Interactions between the viral polymerase and the host RNA polymerase II, as well as between NP and host nucleosomes have also been characterized1,2.
Recently, the generation of recombinant influenza viruses encoding a One-Strep-Tag genetically fused to the C-terminus of the PB2 subunit of the viral polymerase (rWSN-PB2-Strep3) has been described. These recombinant viruses allow the purification of PB2-containing complexes, including vRNPs, from infected cells. To obtain purified vRNPs, cell cultures are infected, and vRNPs are affinity purified from lysates derived from these cells. However, the lysis procedures used to date have been based on one-step detergent lysis, which, despite the presence of a general nuclease, often extract chromatin-bound material only inefficiently. 
Our preliminary work suggested that a large portion of nuclear vRNPs were not extracted during traditional cell lysis, and therefore could not be affinity purified. To increase this extraction efficiency, and to separate chromatin-bound from non-chromatin-bound nuclear vRNPs, we adapted a step-wise subcellular extraction protocol to influenza virus-infected cells. Briefly, this procedure first separates the nuclei from the cell and then extracts soluble nuclear proteins (here termed the "nucleoplasmic" fraction). The remaining insoluble nuclear material is then digested with Benzonase, an unspecific DNA/RNA nuclease, followed by two salt extraction steps: first using 150 mM NaCl (termed "ch150"), then 500 mM NaCl ("ch500") (Fig. 1). These salt extraction steps were chosen based on our observation that 500 mM NaCl was sufficient to solubilize over 85% of nuclear vRNPs yet still allow binding of tagged vRNPs to the affinity matrix.
After subcellular fractionation of infected cells, it is possible to affinity purify PB2-tagged vRNPs from each individual fraction and analyze their protein and RNA components using Western Blot and primer extension, respectively. Recently, we utilized this method to discover that vRNP export complexes form during late points after infection on the chromatin fraction extracted with 500 mM NaCl (ch500)3.

Influenza viruses replicate their RNA genome in association with host-cell chromatin. Here, we present a method to purify intact viral ribonucleoprotein complexes from the chromatin of infected cells. Purified viral complexes can be analyzed by both Western blot and primer extension of protein and RNA content, respectively.

Enfekte Hücre Kromatin gelen Gribi ribonükleoprotein Komplekslerinin Affinity Arıtma

Like all negative-strand RNA viruses, the genome of influenza viruses is packaged in the form of viral ribonucleoprotein complexes (vRNP), in which the ...

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

The opportunistic pathogen Legionella pneumophila is an amoeba-resistant bacterium, which also replicates in alveolar macrophages thus causing the severe pneumonia "Legionnaires' disease"1. In protozoan and mammalian phagocytes, L. pneumophila employs a conserved mechanism to form a specific, replication-permissive compartment, the "Legionella-containing vacuole" (LCV). LCV formation requires the bacterial Icm/Dot type IV secretion system (T4SS), which translocates as many as 275 "effector" proteins into host cells. The effectors manipulate host proteins as well as lipids and communicate with secretory, endosomal and mitochondrial organelles2-4.
The formation of LCVs represents a complex, robust and redundant process, which is difficult to grasp in a reductionist manner. An integrative approach is required to comprehensively understand LCV formation, including a global analysis of pathogen-host factor interactions and their temporal and spatial dynamics. As a first step towards this goal, intact LCVs are purified and analyzed by proteomics and lipidomics.
The composition and formation of pathogen-containing vacuoles has been investigated by proteomic analysis using liquid chromatography or 2-D gel electrophoresis coupled to mass-spectrometry. Vacuoles isolated from either the social soil amoeba Dictyostelium discoideum or mammalian phagocytes harboured Leishmania5, Listeria6, Mycobacterium7, Rhodococcus8, Salmonella9 or Legionella spp.10. However, the purification protocols employed in these studies are time-consuming and tedious, as they require e.g. electron microscopy to analyse LCV morphology, integrity and purity. Additionally, these protocols do not exploit specific features of the pathogen vacuole for enrichment.
The method presented here overcomes these limitations by employing D. discoideum producing a fluorescent LCV marker and by targeting the bacterial effector protein SidC, which selectively anchors to the LCV membrane by binding to phosphatidylinositol 4-phosphate (PtdIns(4)P)3,11 . LCVs are enriched in a first step by immuno-magnetic separation using an affinity-purified primary antibody against SidC and a secondary antibody coupled to magnetic beads, followed in a second step by a classical Histodenz density gradient centrifugation12,13 (Fig. 1).
A proteome study of isolated LCVs from D. discoideum revealed more than 560 host cell proteins, including proteins associated with phagocytic vesicles, mitochondria, ER and Golgi, as well as several GTPases, which have not been implicated in LCV formation before13. LCVs enriched and purified with the protocol outlined here can be further analyzed by microscopy (immunofluorescence, electron microscopy), biochemical methods (Western blot) and proteomic or lipidomic approaches.

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

This article describes a method for the isolation and purification of intact Legionella-containing vacuoles (LCVs) from amoeba and macrophages. The two-step protocol comprises LCV enrichment by immuno-magnetic separation using an antibody against a bacterial LCV marker and further purification by density gradient centrifugation.

Patojen Vakuoller saflaştırılması gelen<em&gt; Legionella</em&gt;-Enfekte Fagositler

The opportunistic pathogen Legionella pneumophila is an amoeba-resistant bacterium, which also replicates in alveolar macrophages thus causing the severe ...

Rescue of Recombinant Newcastle Disease Virus from cDNA

Newcastle disease virus (NDV), the prototype member of the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented, negative-sense, single-stranded, enveloped RNA virus (Figure 1) with potential applications as a vector for vaccination and treatment of human diseases. In-depth exploration of these applications has only become possible after the establishment of reverse genetics techniques to rescue recombinant viruses from plasmids encoding their complete genomes as cDNA2-5. Viral cDNA can be conveniently modified in vitro by using standard cloning procedures to alter the genotype of the virus and/or to include new transcriptional units. Rescue of such genetically modified viruses provides a valuable tool to understand factors affecting multiple stages of infection, as well as allows for the development and improvement of vectors for the expression and delivery of antigens for vaccination and therapy. Here we describe a protocol for the rescue of recombinant NDVs.

Newcastle disease virus (NDV) has been extensively studied in the last few years in order to develop new vectors for vaccination and therapy, among others. These studies have been possible due to techniques to rescue recombinant virus from cDNA, such as those we describe here.

CDNA&#39;dan rekombinant Newcastle Hastalığı Virüsü Rescue

Newcastle disease virus (NDV), the prototype member of  the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented,  negative-sense, ...

Isolation, Identification, and Purification of Murine Thymic Epithelial Cells

The thymus is a vital organ for T lymphocyte development. Of thymic stromal cells, thymic epithelial cells (TECs) are particularly crucial at multiple stages of T cell development: T cell commitment, positive selection and negative selection. However, the function of TECs in the thymus remains incompletely understood. In the article, we provide a method to isolate TEC subsets from fresh mouse thymus using a combination of mechanical disruption and enzymatic digestion. The method allows thymic stromal cells and thymocytes to be efficiently released from cell-cell and cell-extracellular matrix connections and to form a single-cell suspension. Using the isolated cells, multiparameter flow cytometry can be applied to identification and characterization of TECs and dendritic cells. Because TECs are a rare cell population in the thymus, we also describe an effective way to enrich and purify TECs by depleting thymocytes, the most abundant cell type in the thymus. Following the enrichment, cell sorting time can be decreased so that loss of cell viability can be minimized during purification of TECs. Purified cells are suitable for various downstream analyses like Real Time-PCR, Western blot and gene expression profiling. The protocol will promote research of TEC function and as well as the development of in vitro T cell reconstitution.

Here we describe an efficient method for isolation, identification, and purification of mouse thymic epithelial cells (TECs). The protocol can be utilized for studies of thymus function for normal T cell development, thymus dysfunction, and T cell reconstitution.

İzolasyon, tanımlama ve Murin Thymic Epitel Hücreleri saflaştırılması

The thymus is a vital organ for T lymphocyte development. Of thymic stromal cells, thymic epithelial cells (TECs) are particularly crucial at multiple ...

Neutrophil Isolation and Analysis to Determine their Role in Lymphoma Cell Sensitivity to Therapeutic Agents

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of inflammation. They are key players in the innate immune system and play major roles in cancer biology. Neutrophils have been proposed as key mediators of malignant transformation, tumor progression, angiogenesis and in the modulation of the antitumor immunity; through their release of soluble factors or their interaction with tumor cells. To characterize the specific functions of neutrophils, a fast and reliable method is coveted for in vitro isolation of neutrophils from human blood. Here, a density gradient separation method is demonstrated to isolate neutrophils as well as mononuclear cells from the blood. The procedure consists of layering the density gradient solution such as Ficoll carefully above the diluted blood obtained from patients diagnosed with chronic lymphocytic leukemia (CLL), followed by centrifugation, isolation of mononuclear layer, separation of neutrophils from RBCsby dextran then lysis of residual erythrocytes. This method has been shown to isolate neutrophils &#8805; 90 % pure. To mimic the tumor microenvironment, 3-dimensional (3D) experiments were performed using basement membrane matrix such as Matrigel. Given the short half-life of neutrophils in vitro, 3D experiments with fresh human neutrophils cannot be performed. For this reason promyelocytic HL60 cells are differentiated along the granulocytic pathway using the differentiation inducers dimethyl sulfoxide (DMSO) and retinoic acid (RA). The aim of our experiments is to study the role of neutrophils on the sensitivity of lymphoma cells to anti-lymphoma agents. However these methods can be generalized to study the interactions of neutrophils or neutrophil-like cells with a large range of cell types in different situations.

Neutrophils are the most abundant type of white blood cells. The isolation of neutrophils from human blood by density gradient separation method and the differentiation of human promyelocytic (HL60) cells along the granulocytic pathway are described here; to test their role on sensitivity of lymphoma cells to anti-lymphoma agents.

Nötrofil İzolasyon ve Analiz Terapötik Ajanların için Lenfoma Hücre Duyarlılık kendi Rolü belirleme

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of ...

Evaluation of the Efficacy And Toxicity of RNAs Targeting HIV-1 Production for Use in Gene or Drug Therapy

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential to be used as drug therapies for HIV-1 infection. Post-integration inhibitors include ribozymes, short hairpin (sh) RNAs, small interfering (si) RNAs, U1 interference (U1i) RNAs and RNA aptamers. Many of these have been identified using transient co-transfection assays with an HIV-1 expression plasmid and some have advanced to clinical trials. In addition to measures of efficacy, small RNAs have been evaluated for their potential to affect the expression of human RNAs, alter cell growth and/or differentiation, and elicit innate immune responses. In the protocols described here, a set of transient transfection assays designed to evaluate the efficacy and toxicity of RNA molecules targeting post-integration steps in the HIV-1 replication cycle are described. We have used these assays to identify new ribozymes and optimize the format of shRNAs and siRNAs targeting HIV-1 RNA. The methods provide a quick set of assays that are useful for screening new anti-HIV-1 RNAs and could be adapted to screen other post-integration inhibitors of HIV-1 replication.

Methods to evaluate the efficacy and toxicity of RNA molecules targeting post-integration steps of the HIV-1 replication cycle are described. These methods are useful for screening new molecules and optimizing the format of existing ones.

Bir gen ya da ilaç terapisinde kullanım için, HIV-1 üretim yapan RNA&#39;lar etkinlik ve toksisite Değerlendirilmesi

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential ...

Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral evolution. Here we describe the construction of an infectious clone for Zika virus (ZIKV), which is currently causing an explosive outbreak in the Americas. To prevent toxicity to bacteria that is commonly observed with flavivirus-derived plasmids, we generated a two-plasmid system which separates the genome at the NS1 gene and is more stable than full-length constructs that could not be successfully recovered without mutations. After digestion and ligation to join the two fragments, full-length viral RNA can be generated by in vitro transcription with T7 RNA polymerase. Following electroporation of transcribed RNA into cells, virus was recovered that exhibited similar in vitro growth kinetics and in vivo virulence and infection phenotypes in mice and mosquitoes, respectively.

This protocol describes the recovery of infectious Zika virus from a two-plasmid infectious cDNA clone.

Yeni Bir Dünyadan Rekombinant Virüsün Kurtarılması ve Karakterizasyonu Zika Virüsü Bulaşıcı Klon

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral ...

Detection and Removal of Nuclease Contamination During Purification of Recombinant Prototype Foamy Virus Integrase

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared to IN from other retroviruses, PFV IN is more soluble and more amenable to experimental manipulation. Additionally, it is sensitive to clinically relevant human immunodeficiency virus (HIV-1) IN inhibitors, suggesting that the catalytic mechanism of PFV IN is similar to that of HIV-1 IN. IN catalyzes the covalent joining of viral complementary DNA (cDNA) to target DNA in a process called strand transfer. This strand transfer reaction introduces nicks to the target DNA. Analysis of integration reaction products can be confounded by the presence of nucleases that similarly nick DNA. A bacterial nuclease has been shown to co-purify with recombinant PFV IN expressed in Escherichia coli (E. coli). Here we describe a method to isolate PFV IN from the contaminating nuclease by heparin affinity chromatography. Fractions are easily screened for nuclease contamination with a supercoiled plasmid and agarose gel electrophoresis. PFV IN and the contaminating nuclease display alternative affinities for heparin sepharose allowing a nuclease-free preparation of recombinant PFV IN suitable for bulk biochemical or single molecule analysis of integration.

Recombinant prototype foamy virus integrase protein is often contaminated with a bacterial nuclease during purification. This method identifies nuclease contamination and removes it from the final preparation of the enzyme.

Algılama ve kaldırma nükleaz kirlenme rekombinant prototip köpüklü virüs Integrase saflaştırılması sırasında

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared ...

Rapid, Safe, and Simple Manual Bedside Nucleic Acid Extraction for the Detection of Virus in Whole Blood Samples

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for the rapid bedside inactivation of the Ebola virus during blood sampling for safe nucleic acid (NA) tests by adding a commercial lysis/binding buffer directly into the vacuum blood collection tubes. Using this bedside inactivation approach, we have developed a safe, rapid, and simplified bedside NA extraction method for the subsequent detection of a virus in lysis/binding buffer-inactivated whole blood. The NA extraction is directly performed in the blood collection tubes and requires no equipment or electricity. 
After the blood is collected into the lysis/binding buffer, the contents are mixed by flipping the tube by hand, and the mixture is incubated for 20 min at room temperature. Magnetic glass particles (MGPs) are added to the tube, and the contents are mixed by flipping the collection tube by hand. The MGPs are then collected on the side of the blood collection tube using a magnetic holder or a magnet and a rubber band. The MGPs are washed three times, and after the addition of elution buffer directly into the collection tube, the NAs are ready for NA tests, such as qPCR or isothermal loop amplification (LAMP), without the removal of the MGPs from the reaction. The NA extraction method is not dependent on any laboratory facilities and can easily be used anywhere (e.g., in field hospitals and hospital isolation wards). When this NA extraction method is combined with LAMP and a portable instrument, a diagnosis can be obtained within 40 min of the blood collection.

Here, we present a protocol for the rapid virus nucleic acid extraction from the virus-inactivated whole blood. The extraction is performed directly in the blood collection tubes and requires no equipment or electricity. The method is not dependent on laboratory facilities and can be used anywhere (e.g., in field hospitals).

Tam kan örneklerinde virüs tespiti için hızlı, güvenli ve basit el ile başucu nükleik asit çıkarma

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for ...