Name: assembly and purification of prototype foamy virus intasomes
Uploaded: 2018-03-19T15:00:00.000+00:00
Duration: 10 min 20 s
Description: Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

Bu eser NIH AI099854 ve AI126742 için anahtar tarafından desteklenmiştir.

1. tavlama, vDNA
<ol><li>Birleştirme 1 X on tampon (10 X 10 hisse senedi: 100 mM Tris-HCl, pH 8.0, 1 M NaCl, 10 mM EDTA), 10 µM Oligo 1 (5' ATTGTCATGGAATTTTGTATATTGAGTGGCGCCCGAACAG 3', 100 µM hisse senedi) ve 10 µM Oligo 2 (5' CTGTTCGGGCGCCACTCAATATACAAAATTCCATGACA 3', 100 µM hisse senedi) son hacmi 1.5 mL ' . Aliquot 25 µL altmış 0,2 mL Polimeraz zincir reaksiyonu (PCR) tüpler içine. Not: fluorophores veya Etiketler sonunda 5'-Oligo 2 veya bir iç amino-T 5'-sonundan itibaren Oligo 1 temel 13 olarak reaksiyonlar uygulamaya bağlı olarak değiştirilebilir. Değiştirilmiş reaksiyonlar tarafından yüksek performanslı sıvı Kromatografi (HPLC) tavlama önce saf. Biz 5' uç Cy3 veya Cy5 fluorophore Oligo 2 / etiketleme intasome montaj verimliliği 10 kat azaltır bulduk. İç fluorophore etiketleme derleme etkinliğini azaltmaz.</li>
	<li>Bir thermocycler kullanarak aşağıdaki saatlerde ve sıcaklıklar ile TAV: 1 döngüsü 94.0 ˚C 3 dk, 99 döngüsü sırasında (94.0 ˚C 1 dk, 93.6 ˚C 1dk) devir başına 0.8 ˚C tarafından her iki sıcaklık azalan (14,8 ˚C 1 dk, 14.4 ˚C son döngüdür 1 dk) ve mağaza 4.0 ˚C.</li>
	<li>Tüm altmış tüpler tavlama reaksiyonlardan birleştirin. İki 0.5 mL 3 kDa molekül ağırlığı kesme (MWCO) ultracentrifugal filtre konsantrasyon cihazları için 500 µL yükleyin. Tavlanmış vDNA tarafından Santrifüjü 14.000 x g (RT) oda sıcaklığında 10 dakika için de bir microcentrifuge içinde konsantre ol. Not: Retentate birim ~ 50 µL her konsantrasyon biriminde olması gerekir.</li>
	<li>Aracılığıyla akış atmak. Kalan tavlanmış vDNA 250 µL her filtre birimine çalışan ekleyin. Spin yineleyin ve aracılığıyla akış atın. TE arabellek (10 mM Tris-HCl, pH 8.0, 1 mM EDTA) Exchange'e 450 µL TE ile üç kez yıkayarak tampon.</li>
	<li>Filtre ünitesi ve 1000 x g RT. 2 min için spin ters çevir Her filtre ünitesi için son retentate ses ~ 50 µL. birleştirin retentates ve 1,5 mL vidalı kapak tüp aktarmak olmalıdır.</li>
	<li>VDNA 260 nm ultraviyole (UV) Absorbans ölçmek. Son molar DNA toplama hesaplamak için bu değeri kullanın. Bu vDNA yok olma katsayısı (ε260) 622,803 cm-1 M-1 ve Moleküler ağırlığı-20 ˚C 23,972 da dükkanda.</li>
</ol>2. Intasome derleme
<ol><li>Mümkünse, intasome derleme küçük bir odada bir değişken termostat ile gerçekleştirin. Termostat yaklaşık 18-22 ˚C için ayarlayın. Not: deneyim, intasome Meclis 4 ˚C de verimli değildir.</li>
	<li>Bir 2 L ölçek bir heyecan plaka üzerinde bir heyecan çizgiyle diyaliz arabelleği (20 mM Bis-tris propan, pH 7.5, 200 mM NaCl, 2 mM dithiothreitol (DTT), 25 µM ZnCl2) 1 L hazırlayın. Arabellek en az 6 h 18-22 ˚C Oda equilibrate.</li>
	<li>İntasomes bir araya getirmek için 50 mM Bis-tris propan, pH 7.5, 500 mM NaCl, 120 µM PFV inç ve 50 µM vDNA 150 µL toplam hacmi içinde birleştirir. Not: PFV inç nükleaz etkinlik7,8kirletici ücretsiz olmalıdır. PFV inç konsantrasyonu ise 200 µL için son hacim artırmak mümkün o zaman da 120 µM inç 150 µL birimindeki karşılamak için sulandırmak. Bu adımın kritik faktörler inç molar oranını vDNA (2.4:1) için korumak için ve Kromatografi sırasında görselleştirmek için yeterli kompleksi için vardır.</li>
	<li>~ 10 cm uzun bir parçası 10 mm 6-8 kDa MWCO diyaliz boru ve klipleri Çift Kişilik distile su (GKD2O) veya en yüksek saflık su ile temizleyin. Tüp bir ucunu küçük. Not: Diyaliz boru laboratuvar uzaydan gelen herhangi bir olası kontaminasyonu önlemek için itina ile ele alınmalıdır.</li>
	<li>Diyaliz boru durulama arabellek (50 mM Bis-tris propan, pH 7.5, 500 mM NaCl) 15 mL olun. Üç kez 1-2 mL durulama arabelleği ile diyaliz boru içine durulayın. Durulama arabelleğin bir pipet ve ince jeli ipucu yükleme mümkün olduğunca çoğunu olmaktan çıkarın.</li>
	<li>Gerekirse, bir temiz jilet veya neşter ince jel yükleme bahşiş hortumunun sonuna ulaşmak böylece diyaliz boru kesmek için kullanın.</li>
	<li>İntasome derleme bir pipet ve ince bir jeli ipucu yükleme diyaliz boru 2.3 adımından aktarın. Açık uçlu boru içinde tanıtılan hava miktarını en aza indirerek diyaliz hortumunun küçük. Boru diyaliz arabellek içine yerleştirin.</li>
	<li>Diyaliz tüp döner ama bir girdap içinde değil böylece nazik karıştırma ile bir gecede (16-20 h). Diyaliz boru batık ve mobil olduğundan emin olun. Yaklaşık bir saat sonra görünür bir çökelti tüp içinde gözlemlemek. Not: Cy3 veya vDNA fluorescently etiketli Cy5 ile çökelti daha açıktır. Bu son etiketli ve dahili olarak etiketli floresan vDNA için geçerlidir.</li>
</ol>3. Intasome Solubilization
<ol><li>İki hazırlamak geniş delik pipet ipuçları 2-4 mm 200 µL bahşiş sonundan itibaren yeni bir jilet ya da neşter bıçak temiz bir yüzey üzerinde kaldırarak. Not: İpuçları adım 3.3 ve 3.5 kullanılacaktır.</li>
	<li>Diyaliz boru diyaliz arabelleğinden kaldırın. Seyreltme klibi yakınındaki hortumunun sonuna kalabilir diyaliz arabelleği ile intasome örneğinin önlemek için bir micropipette bir küçük pipet ucu ile herhangi bir aşırı diyaliz arabellek kaldırmak için kullanın. Küçük resmi diyaliz hortumunun bir ucundan kaldır.</li>
	<li>Kullanım geniş bir adım çökelti diyaliz boru 1,5 mL tüp buz içinde de dahil olmak üzere örnek aktarmak için 3.1 pipet ucu delik. Not kurtarılan malzemenin toplam hacmi; Toplam genellikle ~ 140 µL birimdir.</li>
	<li>200 mM NaCl ile çökelti örneğidir; son konsantrasyonu 320 mm NaCl tuzu bir hisse senedi 5 M NaCl çözüm uygun hacmi ekleyerek artırmak. Örneğin, 150 µL örneği için 3,9 µL 5 M ekleyin NaCl ve 1.1 µL GKD2O 155 µL. Transfer buz kovası ile son bir birim için örnek bir 4 ˚C soğuk odaya.</li>
	<li>Kullanım geniş bir adım resuspend ve pipetting tarafından çökelti solubilize 3.1 pipet ucu delik. Her 20 dakikada en az 1 h. çökelti çoğunu çözüm gitmeli gözlemlemek için yineleyin. Not: çökelti zaman puan arasında artık belirgin bir şekilde azalır belli olduğunda çökelti resuspend için Pipetting durdurulabilir. VDNA değil etiketlenir veya dahili olarak etiketlenir, çökelti görsel inceleme üzerine dayalı ~ 90 oranında azalır. VDNA etiketli Cy5 son söz konusu olduğunda, çökelti sadece ~ 20 oranında azalır; vDNA etiketli fluorophore ucuyla çökelti çoğunu solubilize değil. Etkili çözündürüldükten çökelti değişkendir ve ampirik olarak kararlı olmalıdır.</li>
</ol>4. Intasome arıtma
<ol><li>250 mL boyutu dışlama Kromatografi (sn) arabellek (20 mM Bis-tris propan, pH 7.5, 320 mM NaCl, % 10 gliserol) çalıştıran hazırlayın. Steril filtre 0.2 µm ile tampon filtre ünitesi ve 4 ˚C saklayın. Not: Tüm arıtma adımlar 4 ˚C soğuk odada gerçekleştirilir.</li>
	<li>Bir çapraz bağlı özel sn sütun equilibrate (çapı = 10 mm; uzunluğu 300 mm =; yatak birim 24 mL =; örnek hacmi = 25-500 µL; maksimum basınç = 1,5 MPa; dışlama sınırı = 4 x 107 Da; moleküler ağırlık ayıran Mat tablo 5 ve 5000 kDa arasında görmek erials) sn 0.4 mL/dk akış hızında çalışan arabelleği ile. Not: etkin bir şekilde Superose 12 10/300 GL veya Superose 6 artırmak gibi 44 kDa 300 kDa ayırmak mümkün olup olmadığını bu arıtma farklı boyut dışlama sütunlar için adapte. Superose 12 10/300 GL daha düşük çözünürlük, zirveleri daha fazla çakışma için lider vardır. Tersine, Superose 6 artış daha yüksek çözünürlüğe sahip ve daha iyi renk ayrımı sunmaktadır.</li>
	<li>14.000 x g 4 ˚C kalan herhangi bir çökelti cips, 10 min için de bir microfuge intasome örnekte santrifüj kapasitesi. Dikkatli bir şekilde süpernatant çıkarın. Süpernatant 200 µL enjeksiyon döngü (~ 200 μL tutabilir boru) yükleyin. Örnek sn sütun için geçerlidir. Not: Daha küçük yük birimler sn tarafından daha fazla çözünürlük sağlar.</li>
	<li>25 sn çalıştıran tampon ve 270 µL. 95 kesirler toplamak mL ile elute sn Kromatografik üç A280/A260 tepeler (şekil 1) görüntüler gözlemlemek. Not: İlk toplama (~9.0 - 11,5 mL elüsyon), ardından PFV tetramer intasome tepe (~12.0 - 14.75 mL elüsyon) ve PFV inç monomer ücretsiz vDNA tepe (~15.0 - 18,0 mL) ile olmalıdır.</li>
</ol>5. entegrasyon Strand Transfer tahlil, kesir seçimi ve depolama
<ol><li>Her intasome tepe kesir ve 50 2 µL birleştirmek ng 3 kb supercoiled plazmid DNA (hisse senedi toplama olduğunu 50 ng/µL) 15 µL son tepki hacmine tepki arabelleği (10 mM Bis-tris propan, pH 7.5, 110 mM NaCl, 5 mM MgSO4, 4 µM ZnCl2, 10 mM DTT). 5 min için 37 ˚C, kuluçkaya.</li>
	<li>Eklenen hiçbir PFV intasome ile bir negatif kontrol içerir. Reaksiyon (20 mg/mL stok çözelti) 0,75 µL İndinavir K ile ve 0,75 µL SDS durdurmak (% 10 hisse senedi çözüm). -20 ˚C daha sonraki analizler için gerektiği gibi 1 h. mağaza örnekleri için 55 ˚C, kuluçkaya. Not: Bu tahlil Tümleştirme faaliyet nitel bir değerlendirme olduğunu. Her kesir intasome molar konsantrasyon bu tahlil önce belirlenir değildir. Entegrasyon strand transfer tahlil dahil kesirler saklanabilir kadar entegrasyon (gece depolama da dahil olmak üzere) buzda etkinliğini doğruladı ve seçili kesirler bölünmemeli. Burada pMP2, bir pUC19 türev9kullanırız. Biz de başarıyla 5.4 kb plazmid pcDNA 3.1 kullandık. İçin çözülmüş olabilir herhangi bir plazmid daire, doğrusal, rahat ve supercoiled formları tümleştirme için bir hedef olarak kullanılabilir.</li>
	<li>120 mL % 1 kilo başına 1 X TAE (40 mM Tris-asetat, 1 mM EDTA) önbellekle 0,1 μg/mL arasında etidyum bromür (EtBr, 10 mg/mL stok solüsyon)10birim (w/v) özel jel hazırlayın. Özel çözüm eritmek ve 15 cm x 10 cm jel döküm tepsiye dökün. 15-iyi tarak 5 mm genişliğinde, 0,75 mm kalın kuyu ile ekleyin. Not: 1.5 mm kalınlığında wells için karşılaştırıldığında daha iyi grup çözünürlük daha dar kuyu verim.</li>
	<li>Ortam sıcaklığında katılaşmaya jel izin. 1 X TAE ile 0,1 μg/mL EtBr jel bırakın.</li>
	<li>3 µL % 50 gliserol her Tümleştirme tepki adım 5.2 ekleyin. Jel tüm reaksiyon birime yükleyin. 10 kb DNA boyutu işaretleyici (150 ng/µL hisse senedi toplama) örnekleri her iki tarafında kulvar için 1 µL yük; başka bir deyişle, DNA boyutu marker örnek şerit yan.</li>
	<li>Dış bir şeritte 6 µL Orange G boya (%0.25 portakal G, % 30 gliserol) yükleyin. Jel sabit voltaj, 10 V/cm (100 V), ortam sıcaklığında veya 1 h için Orange G boya açık jel sonuna ulaşana kadar çalıştırın.</li>
	<li>Hemen özel jel EtBr (532 nm uyarma, 610 nm emisyon filtre) tespit etmek için ayarla floresan bir tarayıcı ile resim. VDNAs etiketli fluorophore kullandıysanız, aynı zamanda uygun fluorophore ayarları ile görüntü. Not: Örneğin, Cy5 tespit etmek için DNA, 633 nm uyarma ve 670 nm emisyon filtreleri kullanarak görüntü etiketli. Uyumlu entegrasyon ürünleri (CI, doğrusal DNA) ~ 3 kb boyutu sadık çalıştırmalısınız, unreacted supercoiled plazmid (SC) daha hızlı (~ 2 kb) çalıştırmalısınız ve yarı-site entegrasyon ürünleri (HSI, rahat daire DNA) yavaş (~3.5 kb) çalıştırmalısınız. Unreacted vDNA ~ 40, gerçek boyutu çalıştırmak gerekir kan basıncı.</li>
	<li>Her yol, görüntüleme yazılım7bantlarında ölçmek. DNA kesir CI, HSI veya SC her şeritte hesaplamak; vDNA bu hesaba dahil değil. Not: Entegrasyon verimliliği veya doğrusal bir ürün, dönüştürülmüş SC kısmını uyumlu entegrasyon ürünleri (CI) piksel hacmi üç grup (HSI + CI + SC) toplam piksel Hacmen bölerek hesaplanmıştır. İntasomes etiketli fluorophore iseniz, HSI ve CI ürünleri de floresan tarafından quantitated.</li>
	<li>En uyumlu entegrasyon etkinliğine sahip kesirler seçin. Not: deneyim, tetrameric PFV intasomes tanımlanan protein en yüksek ile en yüksek uyumlu entegrasyon etkinlik denk geliyor. Her birinin bu kesirler A280 ölçmek ve son intasome konsantrasyonu hesaplayın. PFV inç vahşi türünde iki vDNAs burada anlatılan bir tetramer ε280 908,339 cm-1M-1 ve molekül ağırlığı 225.5 kDa. Konsantrasyonları aynı model olarak sn Kromatografik tepe ve strand transfer tahlil takip etmelidir.</li>
	<li>5 µL aliquots her kesir dağıtmak ve erken sıvı azot içinde dondurmak. Aliquots,-80 ˚C saklayın. Depolama birimi için seçilen kesirler genellikle 200-600 nM arasında bulunmaktadır.</li>
</ol>

<ol>
	<li>Coffin, J. M., Hughes, S. H., Varmus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Retroviruses. , (1997).</li><li>Valkov, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+and+structural+characterization+of+the+integrase+from+the+prototype+foamy+virus.">Functional and structural characterization of the integrase from the prototype foamy virus.</a> Nucleic Acids Res. 37 (1), 243-255 (2009).</li><li>Hare, S., Gupta, S. S., Valkov, E., Engelman, A., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasome+assembly+and+inhibition+of+DNA+strand+transfer.">Retroviral intasome assembly and inhibition of DNA strand transfer.</a> Nature. 464 (7286), 232-236 (2010).</li><li>Li, M., Lin, S., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Outer+domains+of+integrase+within+retroviral+intasomes+are+dispensible+for+catalysis+of+DNA+integration.">Outer domains of integrase within retroviral intasomes are dispensible for catalysis of DNA integration.</a> Protein Sci. 25 (2), 472-478 (2016).</li><li>Gupta, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solution+conformations+of+prototype+foamy+virus+integrase+and+its+stable+synaptic+complex+with+U5+viral+DNA.">Solution conformations of prototype foamy virus integrase and its stable synaptic complex with U5 viral DNA.</a> Structure. 20 (11), 1918-1928 (2012).</li><li>Jones, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasomes+search+for+a+target+DNA+by+1D+diffusion+which+rarely+results+in+integration.">Retroviral intasomes search for a target DNA by 1D diffusion which rarely results in integration.</a> Nat Commun. 7, 11409 (2016).</li><li>Lopez, M. A., Mackler, R. M., Altman, M. P., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+and+removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Detection and removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Vis Exp. , (2017).</li><li>Lopez, M. A., Mackler, R. M., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Virol Methods. 235, 134-138 (2016).</li><li>Poirier, M. G., Bussiek, M., Langowski, J., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+access+to+DNA+target+sites+in+folded+chromatin+fibers.">Spontaneous access to DNA target sites in folded chromatin fibers.</a> J Mol Biol. 379 (4), 772-786 (2008).</li><li>Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments.">Agarose gel electrophoresis for the separation of DNA fragments.</a> J Vis Exp. (62), (2012).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+reveals+a+novel+octameric+integrase+structure+for+betaretroviral+intasome+function.">Cryo-EM reveals a novel octameric integrase structure for betaretroviral intasome function.</a> Nature. 530 (7590), 358-361 (2016).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+supramolecular+assembly+mediates+lentiviral+DNA+integration.">A supramolecular assembly mediates lentiviral DNA integration.</a> Science. 355 (6320), 93-95 (2017).</li><li>Passos, D. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+structures+and+atomic+model+of+the+HIV-1+strand+transfer+complex+intasome.">Cryo-EM structures and atomic model of the HIV-1 strand transfer complex intasome.</a> Science. 355 (6320), 89-92 (2017).</li><li>Yin, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Rous+sarcoma+virus+intasome.">Crystal structure of the Rous sarcoma virus intasome.</a> Nature. 530 (7590), 362-366 (2016).</li><li>Maertens, G. N., Hare, S., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mechanism+of+retroviral+integration+from+X-ray+structures+of+its+key+intermediates.">The mechanism of retroviral integration from X-ray structures of its key intermediates.</a> Nature. 468 (7321), 326-329 (2010).</li><li>Maskell, D. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+for+retroviral+integration+into+nucleosomes.">Structural basis for retroviral integration into nucleosomes.</a> Nature. 523 (7560), 366-369 (2015).</li></ol>

Yazarlar ifşa gerek yok.

Retroviral Ins entegrasyonu gerçekleştirmek için ve viral ömrünün devam viral genomik DNA ile karmaşık bir multimeric oluştururlar. Monomer intasome başına sayısı tetramers, octamers ya da muhtemelen daha yüksek sipariş multimers11,12,13,14olabilir. PFV intasomes3. bir tetramer rekombinant viral genomik DNA taklit çift iplikçikli DNA reaksiyonla...

Ana bilgisayar genom viral genom entegrasyonu döngüsündeki tüm Retrovirüsler1zorunlu bir adımdır. Viral enzim integrase (IN) viral DNA genom DNA ağırlamaktan her iki ucuna kovalent katılmadan tromboksan. Hücresel bir enfeksiyon sırasında Tümleştirme aracılık eder öncesi entegrasyonu karmaşık bir parçasıdır. Rekombinant inç viral DNA uçları taklit çift iplikçikli DNA reaksiyonlar ile complexed da bir hedef DNA vitro2entegrasyon gerçekleştirebilirsiniz. Bir ortak Tümleştirme tahlil vitro supercoiled plazmid DNA hedef kullanır. Her iki viral DNA reaksiyonlar (vDNA) için plazmid bütünleştirilmesi doğrusal bir üründe sonuçları ve uyumlu entegrasyon (şekil 2A) olarak adlandırılır. Entegrasyon tahlil vitro da tek bir vDNA kovalent rahat bir daire içinde sonuçlanan hedef plazmid katıldı ile ürün verim. Bu yarı-site Tümleştirme ürün tahlil içinde in vitrobir eşya gibi görünüyor.
Rekombinant inç ve vDNA entegrasyonu vitrogerçekleştirebilir, ama monomeric inç ilgili görselleştirme karanlık onlar Tümleştirme kompleksleri yapısını veya çalışması dinamikleri ile ideal Kimyasalları değil. Arıtılmış Tümleştirme kompleksleri veya "intasomes," dinamik tek molekül analiz veya yapısal çalışmalar için gereklidir. PFV inç ve vDNAs diyaliz tarafından bir daha düşük tuz konsantrasyonu3,4' e bir nispeten yüksek tuz konsantrasyonu arabelleğinden monte. Diyaliz, bir çökelti sırasında formları. Bu çökelti diyaliz kaldırılır ve tuz konsantrasyonu artar. Yüksek tuz konsantrasyonu acele içeren PFV intasomes solubilizes. İntasomes o zaman boyutu dışlama Kromatografi (sn) tarafından saf. Rekombinant prototip köpüklü virüs (PFV) inç 225 µM5konsantrasyonlarda çözümde bir monomer olarak bulunmaya gösterilmiştir. SN ayırma etkili bir tetramer PFV inç ve iki vDNAs içeren PFV intasomes (225.5 kDa), monomeric PFV (44,4 kDa) ve ücretsiz vDNA (24.0 kDa) ayırır. PFV intasomes dondurulmuş olabilirler ve en az altı ay-80 ˚C, Muhafazası için Tümleştirme etkinliğini korumak.
Rekombinant PFV intasomes de amino asit oyuncu değişikliği veya kesilme mutasyonlar veya fluorophores veya biotin4,6ile etiketli vDNAs içerecek şekilde değiştirilmiş. Saf PFV intasomes kolayca supercoiled plazmid hedef DNA vitroentegrasyonu gerçekleştirmek. Toplu biyokimyasal Tümleştirme deneyleri ile intasomes etkilerini mutasyonların inhibitörleri veya diğer maddeleri, kimyevî test. Biotinylated intasomes nükleik asit veya proteinler ile ilgi soruşturma için kullanılabilir. PFV intasomes iki vDNA ucu veya intasome arama hedef görselleştirmek için toplam iç yansıma Floresans katılmadan arasında geçen zamanı ölçmek için manyetik cımbız tarafından tek molekül mikroskobu analiz için izin ortam sıcaklığında işlevsel olduğundan DNA6. Ayrıca, PFV intasomes ilk yapısal olarak olacak önemli ölçüde etkileyen retroviral entegrasyon3alan ile karakterize edildi.

<table><tbody><tr><td>DNA Oligomers</td><td>IDT</td><td>N/A</td><td>Custom DNA Oligos</td></tr><tr><td>Tris Ultra Pure</td><td>Gojira Fine Chemicals</td><td>UTS1003</td><td></td></tr><tr><td>NaCl</td><td>P212121</td><td>RP-S23020</td><td></td></tr><tr><td>UltraPure EDTA</td><td>Invitrogen/Gibco</td><td>15575</td><td></td></tr><tr><td>Amicon Ultra 0.5 mL centrifugal filters</td><td>Sigma-Aldrich</td><td>Z677094-24EA</td><td>3 kDa MWCO</td></tr><tr><td>DTT</td><td>P212121</td><td>SV-DTT</td><td></td></tr><tr><td>BIS-TRIS propane,&gt;=99.0% (titration)</td><td>Sigma-Aldrich</td><td>B6755-500G</td><td></td></tr><tr><td>ZnCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Sigma-Aldrich</td><td>208086</td><td></td></tr><tr><td>MgSO&lt;sub&gt;4&lt;/sub&gt;</td><td>Amresco</td><td>0662</td><td></td></tr><tr><td>Glycerol</td><td>Thermo Fisher Scientific</td><td>G37-20</td><td></td></tr><tr><td>Gel-loading tips, 1 - 200 &amp;mu;L</td><td>Corning</td><td>CLS4853-400EA</td><td></td></tr><tr><td>Razor blade; Single-edged; 100/Pk.; Pack of 100</td><td>Fisher Scientific</td><td>12-640</td><td></td></tr><tr><td>Sterile Disposable Filter Units with PES Membrane &gt; 250mL</td><td>Thermo Fisher Scientific</td><td>568-0020</td><td></td></tr><tr><td>Dialysis tubing clips</td><td>Spectrum Labs</td><td>132734</td><td></td></tr><tr><td>6-8 kDa 10 mm Dialysis Tubing</td><td>Spectrum Medical</td><td>132645</td><td></td></tr><tr><td>Superose 6 10/300 GL</td><td>GE Healthcare Life Sciences</td><td>17517201</td><td></td></tr><tr><td>Hi-Res Standard Agarose</td><td>AGTC Bioproducts</td><td>AG500D1</td><td></td></tr><tr><td>Ethidium bromide</td><td>Thermo Fisher Scientific</td><td>BP1302</td><td></td></tr><tr><td>Orange G</td><td>Fisher Scientific</td><td>0-267</td><td></td></tr><tr><td>Hyladder 10kb, 500 lanes</td><td>Denville Scientific</td><td>CB4225-4</td><td></td></tr></tbody></table>

assembly and purification of prototype foamy virus intasomes

A özelliği ve gerekli adım retrovirüsü yaşam döngüsünün tanimlar viral genom entegrasyon ana bilgisayar genom. Tüm Retrovirüsler kovalent ana bilgisayara strand transfer olarak bilinen DNA viral birleştirilmesi tromboksan integrase (IN) enzim kodlamak. Entegrasyon modellenmiş vitro rekombinant retroviral inç ile olmak ve viral genom uçları taklit eden DNA reaksiyonlar olabilir. Daha yakından vivo içindeentegrasyon oluşur Tümleştirme tepki özetlemek için kompleksleri rekombinant inç ve sentetik reaksiyonlar diyaliz azaltılmış tuz konsantrasyonu arabellekte tarafından monte edilir. Entegrasyonu karmaşık, bir intasome olarak adlandırılan boyut dışlama Kromatografi tarafından saf. Prototip köpüklü virüs (PFV), söz konusu olduğunda intasome inç bir tetramer ve iki DNA reaksiyonlar ve kolayca monomeric inç ve ücretsiz oligomer DNA ayrılır. PFV intasomes entegrasyon verimliliği daha iyi dinamiklerini anlamak için deneysel koşullar çeşitli ve mekanik retroviral entegrasyon altında denetlesinler.

PFV intasomes rekombinant inç vDNA toplanır. Derleme sonra intasomes (şekil 1) SEC tarafından saf. Entegrasyon etkinliği her kesir bir supercoiled DNA hedef ve özel Jel Elektroforez ile (Şekil 2) denetlesinler. Bu jel EtBr (ve fluorophore, fluorophore etiketli vDNA kullanılırsa) algılamak için ayarla floresan tarayıcıyla görüntüsü. Görüntü analiz yazılımı kullanarak, grup piksel birimleri entegrasyon veriml...

Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

Assembly and Purification of Prototype Foamy Virus Intasomes

Rekombinant retroviral integrase ve DNA reaksiyonlar viral DNA uçları taklit eden bir intasome bilinen bir enzimatik etkin kompleks oluşabilir. Intasomes biyokimyasal, yapısal ve Kinetik çalışmalar için kullanılır. Bu protokolü nasıl bir araya getiren ve prototip köpüklü virüs intasomes arındırmak ayrıntılı.

Derleme ve prototip köpüklü virüs Intasomes arıtma

A defining feature and necessary step of the retrovirus life cycle is the integration of the viral genome into the host genome. All retroviruses encode an ...

assembly-and-purification-of-prototype-foamy-virus-intasomes

Research

JoVE Journal

Immunology and Infection

5.4K Görüntüleme.  The Ohio State University College of Medicine. Rekombinant retroviral integrase ve DNA reaksiyonlar viral DNA uçları taklit eden bir intasome bilinen bir enzimatik etkin kompleks oluşabilir. Intasomes biyokimyasal, yapısal ve Kinetik çalışmalar için kullanılır. Bu protokolü nasıl bir araya getiren ve prototip köpüklü virüs intasomes arındırmak ayrıntılı.

Video: Assembly and Purification of Prototype Foamy Virus Intasomes

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal phase during establishment of infection in a given host. Consequently, study of encapsidation deciphers the information regarding the know-how of the mechanism regulating virus assembly to form infectious virions. Such information is vital in formulating novel methods of curbing virus spread and disease control. Virus encapsidation can be studied in vivo and in vitro. Genome encapsidation in vivo is a highly regulated selective process involving macromolecular interactions and subcellular compartmentalization. Therefore, study leading to dissect events encompassing virus encapsidation in vivo would provide basic knowledge to understand how viruses proliferate and assemble. Recently in vitro encapsidation has been exploited for the research in the area of biomedical imaging and therapeutic applications. Non-enveloped plant viruses stand far ahead in the venture of in vitro encapsidation of the negatively charged foreign material. Brome mosaic virus (BMV), a non-enveloped multicomponent RNA virus pathogenic to plants, has been used as a model system for studying genome packaging in vivo and in vitro. For encapsidation assays in Nicotiana benthamiana plants, Agrobacterium -mediated transient expression, refer to as agroinfiltration, is an efficient and robust technique for the synchronized delivery and expression of multiple components to the same cell. In this approach, a suspension of Agrobacterium tumefaciens cells carrying binary plasmid vectors carrying cDNAs of desiredviral mRNAs is infiltrated into the intercellular space withina leaf using nothing more sophisticated than a 1 ml disposable syringe (without needle). This process results in the transfer of DNA insert into plant cells; the T-DNA insert remains transiently in the nucleus and is then transcribed by the host polymerase II, leading to the transient expression. The resulting mRNA transcript (capped and polyadenylated) is then exported to the cytoplasm for translation. After approximately 24 to 48 hours of incubation,sections of infiltrated leaves can be sampled for microscopyor biochemical analyses. Agroinfiltration permits large numbers (hundreds to thousands) of cells to be transfected simultaneously. For in vitro encapsidation, purified virions of BMV are dissociated into capsid protein by dialyzing against dissociation buffer containing calcium chloride followed by removal of RNA and un-dissociated virions by centrifugation. Genome depleted capsid protein subunits are then reassembled with desired viral genome components or non-viral components such as indocyanine dye.

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

A simple, efficient and robust way to synchronize the delivery of multiple viral components to plant cells via Agrobacterium-mediated transient expression is described. This approach is amenable for studying replication, encapsidation followed by in vitro reassembly of non-viral components into genome depleted optical viral ghosts suitable for biomedical applications.

Basit ve Sağlam In vivo Ve In vitro</emVirüs Meclisi Öğrenmenin> Yaklaşım

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal ...

İmmünoloji ve Enfeksiyon

Multi-target Parallel Processing Approach for Gene-to-structure Determination of the Influenza Polymerase PB2 Subunit

Pandemic outbreaks of highly virulent influenza strains can cause widespread morbidity and mortality in human populations worldwide. In the United States alone, an average of 41,400 deaths and 1.86 million hospitalizations are caused by influenza virus infection each year 1. Point mutations in the polymerase basic protein 2 subunit (PB2) have been linked to the adaptation of the viral infection in humans 2. Findings from such studies have revealed the biological significance of PB2 as a virulence factor, thus highlighting its potential as an antiviral drug target.
The structural genomics program put forth by the National Institute of Allergy and Infectious Disease (NIAID) provides funding to Emerald Bio and three other Pacific Northwest institutions that together make up the Seattle Structural Genomics Center for Infectious Disease (SSGCID). The SSGCID is dedicated to providing the scientific community with three-dimensional protein structures of NIAID category A-C pathogens. Making such structural information available to the scientific community serves to accelerate structure-based drug design.
Structure-based drug design plays an important role in drug development. Pursuing multiple targets in parallel greatly increases the chance of success for new lead discovery by targeting a pathway or an entire protein family. Emerald Bio has developed a high-throughput, multi-target parallel processing pipeline (MTPP) for gene-to-structure determination to support the consortium. Here we describe the protocols used to determine the structure of the PB2 subunit from four different influenza A strains.

Structure-based drug design plays an important role in drug development. Pursuing multiple targets in parallel greatly increases the chance of success for lead discovery. The following article highlights how the Seattle Structural Genomics Center for Infectious Disease utilizes a multi-target approach for gene-to-structure determination of the PB2 influenza A subunit.

Grip Polimeraz Gen-to-yapı belirlenmesi PB2 alt birimi için çoklu hedef Paralel İşleme Yaklaşımı

Pandemic outbreaks of highly virulent influenza strains can cause widespread morbidity and mortality in human populations worldwide. In the United States ...

Detergent-assisted Reconstitution of Recombinant Drosophila Atlastin into Liposomes for Lipid-mixing Assays

Membrane fusion is a crucial process in the eukaryotic cell. Specialized proteins are necessary to catalyze fusion. Atlastins are endoplasmic reticulum (ER) resident proteins implicated in homotypic fusion of the ER. We detail here a method for purifying a glutathione S-transferase (GST) and poly-histidine tagged Drosophila atlastin by two rounds of affinity chromatography. Studying fusion reactions in vitro requires purified fusion proteins to be inserted into a lipid bilayer. Liposomes are ideal model membranes, as lipid composition and size may be adjusted. To this end, we describe a reconstitution method by detergent removal for Drosophila atlastin into preformed liposomes. While several reconstitution methods are available, reconstitution by detergent removal has several advantages that make it suitable for atlastins and other similar proteins. The advantage of this method includes a high reconstitution yield and correct orientation of the reconstituted protein. This method can be extended to other membrane proteins and for other applications that require proteoliposomes. Additionally, we describe a FRET based lipid mixing assay of proteoliposomes used as a measurement of membrane fusion.

Detergent-assisted Reconstitution of Recombinant Drosophila Atlastin into Liposomes for Lipid-mixing Assays

Biological membrane fusion is catalyzed by specialized fusion proteins. Measuring the fusogenic properties of proteins can be achieved by lipid mixing assays. We present a method for purifying recombinant Drosophila atlastin, a protein that mediates homotypic fusion of the ER, reconstituting it to preformed liposomes, and testing for fusion capacity.

Rekombinant Drosophila , lipid karıştırıcılar Için lipozomlar halinde deterjan destekli yeniden yapılanma

Membrane fusion is a crucial process in the eukaryotic cell. Specialized proteins are necessary to catalyze fusion. Atlastins are endoplasmic reticulum ...

Biyokimya

Generation and Assembly of Virus-Specific Nucleocapsids of the Respiratory Syncytial Virus

The use of an authentic RNA template is critical to advance the fundamental knowledge of viral RNA synthesis that can guide both mechanistic discovery and assay development in virology. The RNA template of nonsegmented negative-sense (NNS) RNA viruses, such as the respiratory syncytial virus (RSV), is not an RNA molecule alone but rather a nucleoprotein (N) encapsidated ribonucleoprotein complex. Despite the importance of the authentic RNA template, the generation and assembly of such a ribonucleoprotein complex remain sophisticated and require in-depth elucidation. The main challenge is that the overexpressed RSV N binds non-specifically to cellular RNAs to form random nucleocapsid-like particles (NCLPs). Here, we established a protocol to obtain RNA-free N (N0) first by co-expressing N with a chaperone phosphoprotein (P), then assembling N0 with RNA oligos with the RSV-specific RNA sequence to obtain virus-specific nucleocapsids (NCs). This protocol shows how to overcome the difficulty in the preparation of this traditionally challenging viral ribonucleoprotein complex.

For in-depth mechanistic analysis of the respiratory syncytial virus (RSV) RNA synthesis, we report a protocol of utilizing the chaperone phosphoprotein (P) for coexpression of the RNA-free nucleoprotein (N0) for subsequent in vitro assembly of the virus-specific nucleocapsids (NCs).

Solunum Sinsitial Virüsünün Virüse Özgü Nükleopapsidlerinin Üretimi ve Montajı

The use of an authentic RNA template is critical to advance the fundamental knowledge of viral RNA synthesis that can guide both mechanistic discovery and ...

In Vitro Disassembly of Influenza A Virus Capsids by Gradient Centrifugation

Acid-triggered molecular processes closely control cell entry of many viruses that enter through the endocytic system. In the case of influenza A virus (IAV), virus fusion with the endosomal membrane as well as the subsequent disassembly of the viral capsid, called uncoating, is governed by the ionic conditions inside endocytic vesicles. The early steps in the virus life cycle are hard to study because endosomes cannot be directly accessed experimentally, creating the need for an in vitro approach. Here, we describe a method based on velocity gradient centrifugation of purified virions through a two-layer glycerol gradient, which enables analysis of the IAV core and its stability. The gradient contains a non-ionic detergent (NP-40) in its lower layer to remove the viral membrane by solubilization as the virus sediments toward the bottom. At neutral pH, viral cores are pelleted as stable structures. The major core components, matrix protein (M1) and the viral ribonucleoproteins (vRNPs), can be clearly identified in the pellet fraction by SDS-PAGE. Decreasing the pH to 6.0 or lower in the bottom layer selectively removes M1 from the pellet followed by release of vRNPs at more acidic conditions. Viral protein bands on Coomassie-stained gels can be subjected to densitometric quantification to monitor intermediate states of IAV disassembly. Besides pH, other factors that influence viral core stability can be assessed, such as salt concentration and putative viral uncoating factors, simply by modifying the detergent-containing glycerol layer accordingly. Taken together, the presented technique allows highly reproducible and quantitative analysis of viral uncoating in vitro. It can be applied to other enveloped viruses that undergo complex uncoating processes.

In Vitro Disassembly of Influenza A Virus Capsids by Gradient Centrifugation

Disassembly of influenza A virus cores during virus entry into host cells is a multistep process. We describe an in vitro method to analyze the early stages of viral uncoating. In this approach, velocity gradient centrifugation is used to biochemically dissect the steps that initiate uncoating under defined conditions.

Gradient Santrifüj tarafından İnfluenza A Virüsü Kapsidlerin Vitro Demontaj içinde

Acid-triggered molecular processes closely control cell entry of many viruses that enter through the endocytic system. In the case of influenza A virus ...

Advancing High-Resolution Imaging of Virus Assemblies in Liquid and Ice

Interest in liquid-electron microscopy (liquid-EM) has skyrocketed in recent years as scientists can now observe real-time processes at the nanoscale. It is extremely desirable to pair high-resolution cryo-EM information with dynamic observations as many events occur at rapid timescales - in the millisecond range or faster. Improved knowledge of flexible structures can also assist in the design of novel reagents to combat emerging pathogens, such as SARS-CoV-2. More importantly, viewing biological materials in a fluid environment provides a unique glimpse of their performance in the human body. Presented here are newly developed methods to investigate the nanoscale properties of virus assemblies in liquid and vitreous ice. To accomplish this goal, well-defined samples were used as model systems. Side-by-side comparisons of sample preparation methods and representative structural information are presented. Sub-nanometer features are shown for structures resolved in the range of ~3.5-&#197;-10 &#197;. Other recent results that support this complementary framework include dynamic insights of vaccine candidates and antibody-based therapies imaged in liquid. Overall, these correlative applications advance our ability to visualize molecular dynamics, providing a unique context for their use in human health and disease.

Here protocols are described to prepare virus assemblies suitable for liquid-EM and cryo-EM analysis at the nanoscale using transmission electron microscopy.

Sıvı ve Buzdaki Virüs Düzeneklerinin Yüksek Çözünürlüklü Görüntülenmesinin İlerlemesi

Interest in liquid-electron microscopy (liquid-EM) has skyrocketed in recent years as scientists can now observe real-time processes at the nanoscale. It ...

Detection and Removal of Nuclease Contamination During Purification of Recombinant Prototype Foamy Virus Integrase

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared to IN from other retroviruses, PFV IN is more soluble and more amenable to experimental manipulation. Additionally, it is sensitive to clinically relevant human immunodeficiency virus (HIV-1) IN inhibitors, suggesting that the catalytic mechanism of PFV IN is similar to that of HIV-1 IN. IN catalyzes the covalent joining of viral complementary DNA (cDNA) to target DNA in a process called strand transfer. This strand transfer reaction introduces nicks to the target DNA. Analysis of integration reaction products can be confounded by the presence of nucleases that similarly nick DNA. A bacterial nuclease has been shown to co-purify with recombinant PFV IN expressed in Escherichia coli (E. coli). Here we describe a method to isolate PFV IN from the contaminating nuclease by heparin affinity chromatography. Fractions are easily screened for nuclease contamination with a supercoiled plasmid and agarose gel electrophoresis. PFV IN and the contaminating nuclease display alternative affinities for heparin sepharose allowing a nuclease-free preparation of recombinant PFV IN suitable for bulk biochemical or single molecule analysis of integration.

Recombinant prototype foamy virus integrase protein is often contaminated with a bacterial nuclease during purification. This method identifies nuclease contamination and removes it from the final preparation of the enzyme.

Algılama ve kaldırma nükleaz kirlenme rekombinant prototip köpüklü virüs Integrase saflaştırılması sırasında

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared ...

In Vitro Reconstitution of the Actin Cytoskeleton Inside Giant Unilamellar Vesicles

The actin cytoskeleton, the principal mechanical machinery in the cell, mediates numerous essential physical cellular activities, including cell deformation, division, migration, and adhesion. However, studying the dynamics and structure of the actin network in vivo is complicated by the biochemical and genetic regulation within live cells. To build a minimal model devoid of intracellular biochemical regulation, actin is encapsulated inside giant unilamellar vesicles (GUVs, also called liposomes). The biomimetic liposomes are cell-sized and facilitate a quantitative insight into the mechanical and dynamical properties of the cytoskeleton network, opening a viable route for bottom-up synthetic biology. To generate liposomes for encapsulation, the inverted emulsion method (also referred to as the emulsion transfer method) is utilized, which is one of the most successful techniques for encapsulating complex solutions into liposomes to prepare various cell-mimicking systems. With this method, a mixture of proteins of interest is added to the inner buffer, which is later emulsified in a phospholipid-containing mineral oil solution to form monolayer lipid droplets. The desired liposomes are generated from monolayer lipid droplets crossing a lipid/oil-water interface. This method enables the encapsulation of concentrated actin polymers into the liposomes with desired lipid components, paving the way for in vitro reconstitution of a biomimicking cytoskeleton network.

In Vitro Reconstitution of the Actin Cytoskeleton Inside Giant Unilamellar Vesicles

In this manuscript, we demonstrate the experimental techniques to encapsulate the F-actin cytoskeleton into giant unilamellar lipid vesicles (also called liposomes), and the method to form a cortex-biomimicking F-actin layer at the inner leaflet of the liposome membrane.

İn Vitro Aktin Hücre İskeletinin Dev Unilameller Veziküller İçinde Yeniden Sulandırılması

The actin cytoskeleton, the principal mechanical machinery in the cell, mediates numerous essential physical cellular activities, including cell ...

Biyomühendislik

Sample Preparation for Single Virion Atomic Force Microscopy and Super-resolution Fluorescence Imaging

Immobilization of virions to glass surfaces is a critical step in single virion imaging. Here we present a technique&#160;adopted from single molecule imaging assays which allows adhesion of single virions to glass surfaces with specificity. This preparation is based on grafting the surface of the glass with a mixture of PLL-g-PEG and PLL-g-PEG-Biotin, adding a layer of avidin, and finally creating virion anchors through attachment of biotinylated virus specific antibodies. We have applied this technique across a range of experiments including atomic force microscopy (AFM) and super-resolution fluorescence imaging. This sample preparation method results in a control adhesion of the virions to the surface.

The attachment of virions to a surface is a requirement for single virion imaging by Super-resolution fluorescence imaging or atomic force microscopy (AFM). Here we demonstrate a sample preparation method for controlled adhesion of virions to glass surfaces suitable for use in AFM and super-resolution fluorescence imaging.

Tek Virion Atomik Kuvvet Mikroskopisi ve Süper Çözünürlüklü Floresan Görüntüleme için Numune Hazırlama

Immobilization of virions to glass surfaces is a critical step in single virion imaging. Here we present a technique&#160;adopted from single molecule ...

Biyoloji

Expression and Purification of Virus-like Particles for Vaccination

Virus-like particles (VLPs) and subviral particles (SVPs) are an alternative approach to viral vaccine design that offers the advantages of increased biosafety and stability over use of live pathogens. Non-infectious and self-assembling, VLPs are used to present structural proteins as immunogens, bypassing the need for live pathogens or recombinant viral vectors for antigen delivery. In this article, we demonstrate the different stages of VLP design and development for future applications in preclinical animal testing. The procedure includes the following stages: selection of antigen, expression of antigen in cell line of choice, purification of VLPs/SVPs, and quantification for antigen dosing. We demonstrate use of both mammalian and insect cell lines for expression of our antigens and demonstrate how methodologies differ in yield. The methodology presented may apply to a variety of pathogens and can be achieved by substituting the antigens with immunogenic structural proteins of the user&#39;s microorganism of interest. VLPs and SVPs assist with antigen characterization and selection of the best vaccine candidates.

Here, we present a protocol for synthesizing virus-like particles using either baculovirus or mammalian expression systems, and ultracentrifugation purification. This highly customizable approach is used to identify viral antigens as vaccine targets in a safe and flexible manner.

İfade ve Aşılama için Virüs benzeri Parçacıkların saflaştırılması

Virus-like particles (VLPs) and subviral particles (SVPs) are an alternative approach to viral vaccine design that offers the advantages of increased ...