This project was funded by First Class Grassland Science Discipline Program of Shandong Province (China), National Natural Science Foundation of China (31301936, 31572383), the Special Fund for Agro-scientific Research in the Public Interest (201403071), National risk assessment major special project of milk product quality and safety (GJFP201800804) and Projects of Qingdao People&#39;s Livelihood Science and Technology (19-6-1-68-nsh, 14-2-3-45-nsh, 13-1-3-88-nsh).

1. sgRNA oligonucleotide design
<ol>
	<li>Design sgRNAs using online tools such as the Cas-Designer online tool (http://www.rgenome.net/cas-designer/). The PAM sequence is important based on the Cas9 being used. For xCas9, the relevant PAM sequences are NG and the former referred Cas-Designer online tool can generate xCas9 relevant sgRNAs.
	<ol>
		<li>Use sgRNA design tools that encompass algorithms for on- and off-target prediction (http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design)11. A score of 0.2 or greater is preferred.</li>
	</ol>
	</li>
	<li>Select up to 3 gene editing targets for an optimum screening (e.g., T1, T2 and T3 were designed for sheep DKK2 exon 1 gene targeting [Table 1]).</li>
</ol>
2. Oligonucleotide modification
<ol>
	<li>To modify the sgRNA oligonucleotide, delete the 3&#8217;-NG protospacer adjacent motif (PAM), keeping the protospacer sequence (e.g., starting sequence for T1: TGCCTGCTCCTACTGGCCGC [20 nt]).</li>
	<li>Add the pentanucleotide CACCG to the 5&#8217;-end of the oligo. 
	NOTE: Upon ligation to the pX330-xCas9 skeleton, this sequence will contain the 3&#8217;-end of the U6 promoter motivating sgRNA transcription. The array &#8220;CACC&#8221; guarantees that the oligo is matching with the overhangs of the BbsI-digested pX330-xCas9 plasmid. The base &#8220;G&#8221; is a prerequisite of RNA Polymerase III promoters and guarantees the effective startup of sgRNA transcription (e.g., appending the 5&#8217;-CACCG array to the protospacer of T1, achieving T1-F: CACCGTGCCTGCTCCTACTGGCCGC [25 nt]). The cleavage efficiency of 21 nt gRNA is significantly different from that of 20 nt gRNA1,12,13,14. It is generally advised to use 20 nt with 5&#39;-G by generating a shorter protospacer, if this is not possible then 21 nt with extra 5&#39;-G can be used.</li>
	<li>Create a reverse complement (rc) of the protospacer sequence. 
	NOTE: For example, the rc of the T1 protospacer is GCGGCCAGTAGGAGCAGGCA (20 nt).</li>
	<li>Append AAAC to the 5&#8217;-end of the rc protospacer sequence. Append an additional C to the 3&#8217;-end of the rc protospacer. 
	NOTE: The &#8220;AAAC&#8221; sequence ensures that the oligonucleotide is suitable for cloning into the BbsI-digested pX330-xCas9 plasmid. The additional&#8220;C&#8221;on the 3&#8217;-end is essential for annealing with the initiating &#8220;G&#8221; for the sgRNA transcription described above (e.g., AAACGCGGCCAGTAGGAGCAGGCAC [25 nt] is the final oligonucleotide sequence for T1 rc protospacer).</li>
	<li>Order the oligonucleotides.</li>
</ol>
3. Oligonucleotide annealing
<ol>
	<li>Dilute lyophilized oligonucleotides to a final concentration of 10 &#956;M in double distilled water (ddH2O).</li>
	<li>Mix forward and reverse oligonucleotides in a thin wall PCR tube maintaning a 1:1 ratio (e.g., 20 &#956;L each) without adding any extra buffer.</li>
	<li>Incubate the mixture at 95 &#176;C for 5 min and then ramp down the temperature to 72 &#176;C for 10 min. Follow with a cooling period at room temperature (RT) consisting of simply removing the sample from the PCR machine and placing it at RT. 
	NOTE: It is not necessary to phosphorylate the oligonucleotide mixtures to facilitate the ligation.</li>
</ol>
4. sgRNA/CRISPR vector digestion
<ol>
	<li>Digest 1 &#956;g of the selected pX330-xCas9 vector with BbsI (10 units of enzyme per 1 &#956;g of plasmid) for 2 h at 37 &#176;C (Figure 2). Conduct the digestion of the pX330-xCas9 sgRNA expression vector in a total volume of 50 &#956;L, containing 5 &#956;L of 10x digestion buffer and distilled water to achieve the final volume.</li>
	<li>Purify the digested vector by band extraction from a 2% agarose gel under 10 V/cm and subsequently purify using a silica column using a commercial gel extraction kit.</li>
</ol>
5. Ligation of the annealed sgRNA oligonucleotides to the expression vector
<ol>
	<li>Mix the annealed sgRNA oligonucleotides (5 &#956;L of the mixture from step 4) with the BbsI-digested pX330-xCas9 vector (purified, 100 ng).</li>
	<li>Add 1 &#956;L of ligase and 1 &#956;L of 10x ligase buffer.</li>
	<li>Add distilled water with appropriate volume, up to 10 &#956;L.</li>
	<li>Incubate overnight at 4 &#176;C.</li>
</ol>
6. Competent cell transformation
<ol>
	<li>Take out E. coli DH5&#945; competent cells from storage at -80 &#176;C and thaw it on ice.</li>
	<li>Add 5 &#956;L of the ligation mix to 50 &#956;L of competent E. coli DH5&#945; and keep the mixture on ice for 30 min.</li>
	<li>Heat shock the mixture at 42 &#176;C for 90 s.</li>
	<li>Rest it on ice for 2 min.</li>
	<li>Recover the culture on a rotary shaker in 500 &#956;L of LB media for 1 h at 37 &#176;C.</li>
	<li>Plate 200 &#956;L of the culture on an ampicillin resistance LB agarose plate and incubate it overnight at 37 &#176;C.</li>
</ol>
7. Identification of the correct recombinant plasmids by PCR
<ol>
	<li>Choose 5 to 10 bacterial colonies from the LB plate and use each of them to inoculate one 1.5 mL tube containing 1 mL of LB media with 60 mg/mL ampicillin.</li>
	<li>Incubate the tubes on a rotary shaker for 2-3 h.</li>
	<li>Carry out detection of correct recombinant plasmids by using specific primer pairs for the sgRNA oligonucleotides [e.g., forward primer for T1 sgRNA expression vector construction (T1-F): CACCGTGCCTGCTCCTACTGGCCGC, reverse primer (BbsI-R): AAAGTCCCTATTGGCGTTAC, producing a 287 bp amplicon (Figure 3)].
	<ol>
		<li>Prepare the PCR mixture (Table 2).</li>
		<li>Use the following PCR cycling conditions: 95 &#176;C for 5 min for pre-denaturation; 30 cycles of 95 &#176;C for 30 s for denaturation, 60 &#176;C for 30 s for annealing, and 72 &#176;C for 30 s for extension. After the 30 cycles are completed, perform a final extension step by heating for 5 min at 72 &#176;C.</li>
		<li>Run the PCR product on a 2% agarose gel under 10 V/cm. A band at the right size [e.g., 287 bp] is considered as positive.</li>
	</ol>
	</li>
</ol>
8. Validate the sequence of sgRNA expression plasmid
<ol>
	<li>Verify the sequence of PCR positive colonies by Sanger sequencing15 using the reverse primer BbsI-R (see step 7.3). This primer anneals at the site downstream of the sgRNA oligo insert. The pX330-xCas9-T1 expressing sgRNA sequence containing protospacer TGCCTGCTCCTACTGGCCGCGG and xCas9 was constructed.</li>
	<li>Use the forward primer T1-F to sequence the positive colonies. The forward one could not give complete sequence information for the site surrounding the insertion site of the sgRNA oligo, because 30-50 bp fragment following the sequencing primer could not be exactly read out.</li>
</ol>
9. Construction of dual luciferase reporter vector
<ol>
	<li>Synthesize 300-500 bp DNA fragments containing the sgRNA targets and subclone it into a dual luciferase reporter vector through double digestion [e.g., subclone 440 bp sheep DKK2 exon1 fragment into pSSA-Dual plasmid16,17 by using double digestion with AscI and SalI, resulting pSSA-Dual-DKK2].</li>
	<li>Synthesize 300-500 bp DNA fragments containing the sgRNA targets. Note that the sequences of the DNA fragments must be parts of the genomic sequences, which could be obtained from NCBI website (https://www.ncbi.nlm.nih.gov/) or related references.</li>
	<li>Select a suitable dual luciferase reporter vector such as pSSA-Dual16,17 (or two vectors expressing firefly luciferase and renilla luciferase respectively) and then digest this vector and the DNA fragments stated above with two endonucleases such as AscI and SalI.</li>
	<li>Finally ligate these two fragments with T4 DNA Ligase, resulting into pSSA-Dual-Target. Details for double digestion and ligation are displayed in Table 3 and Table 4, respectively. It is worth mentioning that the reporter vector should be amplified in stable bacteria strains (such as Top10), which are recommended to be cultured with lower rotational speed (typically no more than 200 rpm), for the purpose of avoiding DNA recombination.</li>
</ol>
10. Cell transfection
<ol>
	<li>Extract endotoxin-free plasmids for vectors stated above. Evaluate the purity and concentration of the plasmids by using suitable instruments. A final concentration of no less than 500 ng/&#956;L and a purity ratio of 1.7-1.9 at absorbance 260/280 nm (A260/A280) are recommended for these plasmids.</li>
	<li>Co-transfect an appropriate cell line such as PIEC18 with the plasmids in equal proportion (e.g., pX330-xCas9-T1: pSSA-Dual-DKK2=1:1, 0.5 &#956;g plasmid for each duplication when using 24 well plate). Use an empty vector such as pX330-xCas9 as a negative control.
	<ol>
		<li>One day before the transfection, plate cells in an 24-well culture plate at a density of 2 x 105 cells/well. Cells will be ready for transfection when they achieve a confluence of 60-80%.</li>
		<li>Before the transfection time point, remove the supernatant as much as possible and gently add 0.5 mL of fresh media for each well.</li>
		<li>Dilute transfection reagent in DMEM media at the ratio of 1:25 and mix well.</li>
		<li>Prepare master mix of DNA by diluting 0.5 &#956;g of DNA in 25 &#956;L of DMEM media, and then add 1 &#956;L of P3000 reagent.</li>
		<li>Add diluted DNA to each tube of diluted transfection reagent (1:1 ratio).</li>
		<li>Incubate for 10&#8211;15 min at room temperature.</li>
		<li>Add 50 &#956;L of DNA-lipid complex to cells.</li>
		<li>Incubate cells for 24 h at 37 &#176;C. Then, analyze transfected cells as in Step 11.</li>
	</ol>
	</li>
</ol>
11. Dual-luciferase detection
<ol>
	<li>Prepare a sufficient quantity of the 1x passive lysis buffer (PLB) by adding 1 volume of 5x PLB to 4 volumes of distilled water and mix well.</li>
	<li>Passive lysis of cells cultured in 24-well culture plates.
	<ol>
		<li>Remove the growth medium from the cultured cells, and gently apply a sufficient volume of phosphate buffered saline (PBS) to wash the surface of the culture vessel. Swirl the vessel briefly to remove detached cells and residual growth medium. Completely remove the rinse solution before applying PLB reagent.</li>
		<li>Dispense 100 &#956;L of 1x PLB into each culture well to completely cover the cell monolayer. Let the culture plates stand for 20 min.</li>
		<li>Transfer the lysate to a tube or vial for further handling or storage.</li>
	</ol>
	</li>
	<li>Prepare luciferase assay reagent (LAR) by resuspending the provided lyophilized luciferase assay substrate in 10 mL of the supplied luciferase assay buffer.</li>
	<li>Prepare an adequate volume to perform the desired number of dual-luciferase reporter assays (100 &#181;L reagent per assay). Add 1 volume of 50x stop substrate to 50 volumes of stop buffer in a glass or siliconized polypropylene tube.</li>
	<li>Dual-luciferase reporter (DLR) assay
	<ol>
		<li>Program luminometers to provide a 2-second pre-read delay, followed by a 10-second measurement period.</li>
		<li>Predispense 100 &#181;L of luciferase assay reagent into the appropriate number of luminometer tubes to complete the desired number of DLR Assays.</li>
		<li>Carefully transfer up to 20 &#181;L of cell lysate into the luminometer tube containing LAR; mix by pipetting 2 or 3 times. Place the tube in the luminometer and initiate reading.</li>
		<li>Remove the sample tube from the luminometer, add 100 &#181;L of stop reagent and vortex briefly to mix. Replace the sample in the luminometer, and initiate reading.</li>
		<li>Record the renilla luciferase activity normalized to the firefly luciferase activity, namely the reciprocal of the ratio displayed on screen.</li>
		<li>Discard the reaction tube, and proceed to the next assay.</li>
	</ol>
	</li>
</ol>

<ol><li>Zhang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+surrogate+reporter+system+for+multiplexable+evaluation+of+CRISPR%2FCas9+in+targeted+mutagenesis%5BTitle%5D)+AND+%22Scientific+Reports%22%5BJournal%5D)">A surrogate reporter system for multiplexable evaluation of CRISPR/Cas9 in targeted mutagenesis.</a> Scientific Reports. 8 (1), 1042(2018).</li>
<li>Nageshwaran, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR+Guide+RNA+Cloning+for+Mammalian+Systems%5BTitle%5D)+AND+%22Journal+of+Visualized+Experiments%22%5BJournal%5D)">CRISPR Guide RNA Cloning for Mammalian Systems.</a> Journal of Visualized Experiments. (140), (2018).</li>
<li>Dang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Optimizing+sgRNA+structure+to+improve+CRISPR-Cas9+knockout+efficiency%5BTitle%5D)+AND+%22Genome+Biology%22%5BJournal%5D)">Optimizing sgRNA structure to improve CRISPR-Cas9 knockout efficiency.</a> Genome Biology. 16, 280(2015).</li>
<li>Doench, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Optimized+sgRNA+design+to+maximize+activity+and+minimize+off-target+effects+of+CRISPR-Cas9%5BTitle%5D)+AND+%22Nature+Biotechnology%22%5BJournal%5D)">Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9.</a> Nature Biotechnology. 34 (2), 184-191 (2016).</li>
<li>Moreno-Mateos, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPRscan%3A+designing+highly+efficient+sgRNAs+for+CRISPR-Cas9+targeting+in+vivo%5BTitle%5D)+AND+%22Nature+Methods%22%5BJournal%5D)">CRISPRscan: designing highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo.</a> Nature Methods. 12 (10), 982-988 (2015).</li>
<li>Joung, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome-scale+CRISPR-Cas9+knockout+and+transcriptional+activation+screening%5BTitle%5D)+AND+%22Nature+Protocols%22%5BJournal%5D)">Genome-scale CRISPR-Cas9 knockout and transcriptional activation screening.</a> Nature Protocols. 12 (4), 828-863 (2017).</li>
<li>Yang, L., Yang, J. L., Byrne, S., Pan, J., Church, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR%2FCas9-Directed+Genome+Editing+of+Cultured+Cells%5BTitle%5D)+AND+%22Current+Protocols+in+Molecular+Biology%22%5BJournal%5D)">CRISPR/Cas9-Directed Genome Editing of Cultured Cells.</a> Current Protocols in Molecular Biology. 107, 1-17 (2014).</li>
<li>Yang, L., Mali, P., Kim-Kiselak, C., Church, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR-Cas-mediated+targeted+genome+editing+in+human+cells%5BTitle%5D)+AND+%22Methods+in+Molecular+Biology%22%5BJournal%5D)">CRISPR-Cas-mediated targeted genome editing in human cells.</a> Methods in Molecular Biology. 1114, 245-267 (2014).</li>
<li>Vidigal, J. A., Ventura, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Rapid+and+efficient+one-step+generation+of+paired+gRNA+CRISPR-Cas9+libraries%5BTitle%5D)+AND+%22Nature+Communications%22%5BJournal%5D)">Rapid and efficient one-step generation of paired gRNA CRISPR-Cas9 libraries.</a> Nature Communications. 6, 8083(2015).</li>
<li>Mazon, G., Mimitou, E. P., Symington, L. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((SnapShot%3A+Homologous+recombination+in+DNA+double-strand+break+repair%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">SnapShot: Homologous recombination in DNA double-strand break repair.</a> Cell. 142 (4), 646(2010).</li>
<li>Doench, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Rational+design+of+highly+active+sgRNAs+for+CRISPR-Cas9-mediated+gene+inactivation%5BTitle%5D)+AND+%22Nature+Biotechnology%22%5BJournal%5D)">Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation.</a> Nature Biotechnology. 32 (12), 1262-1267 (2014).</li>
<li>Lee, J. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Directed+evolution+of+CRISPR-Cas9+to+increase+its+specificity%5BTitle%5D)+AND+%22Nature+Communications%22%5BJournal%5D)">Directed evolution of CRISPR-Cas9 to increase its specificity.</a> Nature Communications. 9 (1), 3048(2018).</li>
<li>Sung, Y. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Highly+efficient+gene+knockout+in+mice+and+zebrafish+with+RNA-guided+endonucleases%5BTitle%5D)+AND+%22Genome+Research%22%5BJournal%5D)">Highly efficient gene knockout in mice and zebrafish with RNA-guided endonucleases.</a> Genome Research. 24 (1), 125-131 (2014).</li>
<li>Ran, F. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Double+nicking+by+RNA-guided+CRISPR+Cas9+for+enhanced+genome+editing+specificity%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity.</a> Cell. 154 (6), 1380-1389 (2013).</li>
<li>Sanger, F., Nicklen, S., Coulson, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNA+sequencing+with+chain-terminating+inhibitors%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Sciences+of+the+United+States+of+America%22%5BJournal%5D)">DNA sequencing with chain-terminating inhibitors.</a> Proceedings of the National Academy of Sciences of the United States of America. 74 (12), 5463-5467 (1977).</li>
<li>Ruan, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Highly+efficient+CRISPR%2FCas9-mediated+transgene+knockin+at+the+H11+locus+in+pigs%5BTitle%5D)+AND+%22Scientific+Reports%22%5BJournal%5D)">Highly efficient CRISPR/Cas9-mediated transgene knockin at the H11 locus in pigs.</a> Scientific Reports. 5, 14253(2015).</li>
<li>An plasmid with double fluorescent groups and its application as standard substance. China patent. , 201210509946.1 (2012).</li>
<li>Li, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Characterization+of+the+porcine+p65+subunit+of+NF-kappaB+and+its+association+with+virus+antibody+levels%5BTitle%5D)+AND+%22Molecular+Immunology%22%5BJournal%5D)">Characterization of the porcine p65 subunit of NF-kappaB and its association with virus antibody levels.</a> Molecular Immunology. 48 (6-7), 914-923 (2011).</li>
<li>A pair of sgRNAs targeting porcine RELA gene. China patent. , 201510398717.0 (2015).</li>
</ol>

The authors declare that they have no competing financial interests.

The sgRNA vector cloning procedures we have described here facilitates efficient production of sgRNAs, with most of the costs derived from the oligonucleotide ordering and vector sequencing. While the outlined method is designed to allow users to generate sgRNAs for use with CRISPR/Cas9, the protocol can easily be adapted for use with Cas9 orthologues or other RNA-guided endonucleases such as Cpf1, introducing minor modifications to the vector backbone and the oligonucleotide overhanging sequences.
<p class="jove_con...

The CRISPR sgRNAs comprise a 20-nucleotide sequence (the protospacer), which is complementary to the genomic target sequence1,2. Although highly efficient, the ability of the CRISPR/Cas system to modify a given genomic site requires the generation of a vector carrying an efficient sgRNA unique to the target site(s)2. This paper describes the key steps in the generation of that sgRNA vector.
For successful genome editing using the CRISPR/Cas system, the use of highly efficient sgRNAs is a crucial prerequisite3,4,5. Since engineered nucleases used in genome editing manifest diverse efficiencies at different targeted loci1, a pre-selection of candidate sgRNA targets is necessary in order to save time and effort6,7,8,9. A dual luciferase reporter system has been developed to evaluate knockout efficiency by examining double-strand break repair via single strand annealing3,10. Here we use this reporter system to choose a preferred CRISPR sgRNA target from different candidate sgRNA vectors designed for specific gene editing. The protocol stated here has been implemented in our group and collaborating laboratories for the last few years to generate and evaluate CRISPR sgRNAs.
The following protocol sums up how to design suitable sgRNA through network software. Once the suitable sgRNAs are selected, we describe the different steps to obtain the required oligonucleotides as well as the approach for inserting the paired oligonucleotides into the pX330-xCas9 expression vector. We also present a method for assembling sgRNA-expressing and dual luciferase reporter vectors based on the ligation of these sequences into a predigested expression vector (steps 2-10, Figure 1A). Finally we describe how to analyze the the DNA cutting efficiency for each of the sgRNAs (steps 11-12).

<table><tbody><tr><td>A new generation of full touch screen gradient PCR instrument</td><td>LongGene</td><td>A200</td><td>Target gene amplification</td></tr><tr><td>AscI restriction enzymes</td><td>New England Biolabs</td><td>R0558V</td><td>Cutting target vectors</td></tr><tr><td>BbsI restriction enzyme</td><td>New England Biolabs</td><td>R0539S</td><td>Cutting target vectors</td></tr><tr><td>Clean workbench</td><td>AIRTECH</td><td>SW-CJ-2FD/VS-1300L-U</td><td>A partial purification device in the form of a vertical laminar flow, which creates a local high clean air environment</td></tr><tr><td>DH5&amp;alpha; Competent Cells</td><td>TaKaRa</td><td>K613</td><td>Plasmid vector transformation</td></tr><tr><td>Dual-Luciferas Reporter Assay System</td><td>Promega</td><td>E1910</td><td>Dual-luciferas reporter assay</td></tr><tr><td>Electric thermostatic water bath</td><td>Sanfa Scientific Instruments</td><td>DK-S24</td><td>Heating reagent by constant temperature in water bath</td></tr><tr><td>Electrophoresis</td><td>Beijing Liuyi Biotechnology Co., Ltd.</td><td>DYY-6C</td><td>Control voltage, current, etc.</td></tr><tr><td>Eppendorf Reference 2</td><td>Eppendorf China Ltd.</td><td>Reference 2</td><td>Accurately draw and transfer traces of liquid</td></tr><tr><td>Gel imaging analyzer</td><td>Beijing Liuyi Biotechnology Co., Ltd.</td><td>WD-9413B</td><td>For the analysis of electrophoresis gel images</td></tr><tr><td>GloMax 20/20 Luminometer</td><td>Promega</td><td>E5311</td><td>Detect dual luciferase activity</td></tr><tr><td>High speed refrigerated centrifuge</td><td>BMH</td><td>sigma 3K15</td><td>Nucleic acid extraction and purification</td></tr><tr><td>Intelligent biochemical incubator</td><td>Sanfa Scientific Instruments</td><td>SHP-160</td><td>Provide a suitable temperature environment for the enzyme digestion experiment</td></tr><tr><td>LB Broth Agar</td><td>Sangon Biotech</td><td>A507003-0250</td><td>For the cultivation of E.coli</td></tr><tr><td>Lipofectamine 3000 Transfection Reagent Kit</td><td>Thermo Fisher</td><td>L3000015</td><td>DNA Transfection</td></tr><tr><td>SalI restriction enzymes</td><td>New England Biolabs</td><td>R3138V</td><td>Cutting target vectors</td></tr><tr><td>SanPrep Column DNA Gel Extraction Kit</td><td>Sangon Biotech</td><td>B518131-0050</td><td>Recycling DNA fragments</td></tr><tr><td>SanPrep Column Plasmid Mini-Preps Kit</td><td>Sangon Biotech</td><td>B518191-0100</td><td>Extraction of plasmid DNA</td></tr><tr><td>T4 DNA Ligase</td><td>New England Biolabs</td><td>M0202V</td><td>Link DNA fragment</td></tr><tr><td>TaKaRa MiniBEST DNA Fragment Purification Kit Ver.4.0</td><td>TaKaRa</td><td>9761</td><td>DNA purification</td></tr><tr><td>Vertical pressure steam sterilizer</td><td>JIBIMED</td><td>LS-50LD</td><td>High temperature and autoclave to kill bacteria, fungi and other microorganisms in laboratory equipment</td></tr><tr><td>Water bath thermostat</td><td>Changzhou Guoyu Instrument Manufacturing Co., Ltd.</td><td>SHZ-82</td><td>Let the bacteria keep shaking, which is good for contact with air.</td></tr></tbody></table>

construction of crispr plasmids and detection of knockout efficiency in mammalian cells through a dual luciferase reporter system

Although highly efficient, modification of a genomic site by the CRISPR enzyme requires the generation of a sgRNA unique to the target site(s) beforehand. This work describes the key steps leading to the construction of efficient sgRNA vectors using a strategy that allows the efficient detection of the positive colonies by PCR prior to DNA sequencing. Since efficient genome editing using the CRISPR system requires a highly efficient sgRNA, a preselection of candidate sgRNA targets is necessary to save time and effort. A dual luciferase reporter system has been developed to evaluate knockout efficiency by examining double-strand break repair via single strand annealing. Here, we use this reporter system to pick up the preferred xCas9/sgRNA target from candidate sgRNA vectors for specific gene editing. The protocol outlined will provide a preferred sgRNA/CRISPR enzyme vector in 10 days (starting with appropriately designed oligonucleotides).

The methods outlined in this protocol are for the construction of sgRNA and xCas9 expression vectors and then for the optimization screening of sgRNA oligos with relatively higher gene targeting efficiencies. Here we display a representative example of 3 sgRNA targets to sheep DKK2 exon 1. SgRNA and xCas9 expressing vectors can be built by predigesting the vector backbone (Figure 2) followed by ligating it in a series of short double-strand DNA fragments through annealing oligo pair...

Watch this Scientific Journal Video about Construction of CRISPR Plasmids and Detection of Knockout Efficiency in Mammalian Cells through a Dual Luciferase Reporter System at JoVE.com

Construction of CRISPR Plasmids and Detection of Knockout Efficiency in Mammalian Cells through a Dual Luciferase Reporter System

Here, we present a protocol describing a streamlined method for the efficient generation of plasmids expressing both the CRISPR enzyme and associated single guide RNA (sgRNAs). Co-transfection of mammalian cells with this sgRNA/CRISPR vector and a dual luciferase reporter vector that examines double-strand break repair allows evaluation of knockout efficiency.

Although highly efficient, modification of a genomic site by the CRISPR enzyme requires the generation of a sgRNA unique to the target site(s) beforehand. ...

construction-crispr-plasmids-detection-knockout-efficiency-mammalian

Research

JoVE Journal

Bioengineering

6.2K Views.  Qingdao Agricultural University, Qingdao, China. Dit protocol beschrijft de belangrijkste stappen in het genereren en optimaliseren van efficiënte sgRNA-vectoren. Onze preacceleratie van kandidaat sgRNA richt zich op relatieve tijd en gevolgtrekking. Het belangrijkste voordeel van dit protocol is dat het mogelijk is om de DNA-coderingsverdrukken voor elk van de sgRNAs te analyseren zonder endogene genen te bewerken.Deze preselectiemethode kan ook worden toegepast op andere genbewerkingsmaatregelen door middel van dubbelstrengs pauze...

Video: Construction of CRISPR Plasmids and Detection of Knockout Efficiency in Mammalian Cells through a Dual Luciferase Reporter System

Using a Fluorescent PCR-capillary Gel Electrophoresis Technique to Genotype CRISPR/Cas9-mediated Knockout Mutants in a High-throughput Format

The development of programmable genome-editing tools has facilitated the use of reverse genetics to understand the roles specific genomic sequences play in the functioning of cells and whole organisms. This cause has been tremendously aided by the recent introduction of the CRISPR/Cas9 system-a versatile tool that allows researchers to manipulate the genome and transcriptome in order to, among other things, knock out, knock down, or knock in genes in a targeted manner. For the purpose of knocking out a gene, CRISPR/Cas9-mediated double-strand breaks recruit the non-homologous end-joining DNA repair pathway to introduce the frameshift-causing insertion or deletion of nucleotides at the break site. However, an individual guide RNA may cause undesirable off-target effects, and to rule these out, the use of multiple guide RNAs is necessary. This multiplicity of targets also means that a high-volume screening of clones is required, which in turn begs the use of an efficient high-throughput technique to genotype the knockout clones. Current genotyping techniques either suffer from inherent limitations or incur high cost, hence rendering them unsuitable for high-throughput purposes. Here, we detail the protocol for using fluorescent PCR, which uses genomic DNA from crude cell lysate as a template, and then resolving the PCR fragments via capillary gel electrophoresis. This technique is accurate enough to differentiate one base-pair difference between fragments and hence is adequate in indicating the presence or absence of a frameshift in the coding sequence of the targeted gene. This precise knowledge effectively precludes the need for a confirmatory sequencing step and allows users to save time and cost in the process. Moreover, this technique has proven to be versatile in genotyping various mammalian cells of various tissue origins targeted by guide RNAs against numerous genes, as shown here and elsewhere.

The genotyping technique described here, which couples fluorescent polymerase chain reaction (PCR) to capillary gel electrophoresis, allows for high-throughput genotyping of nuclease-mediated knockout clones. It circumvents limitations faced by other genotyping techniques and is more cost effective than sequencing methods.

The development of programmable genome-editing tools has facilitated the use of reverse genetics to understand the roles specific genomic sequences play ...

Genetics

Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide RNA (sgRNA) that confers specificity, the Cas9 protein cleaves both DNA strands at the targeted locus. The DNA break can trigger either non-homologous end joining (NHEJ) or homology directed repair (HDR). NHEJ can introduce small deletions or insertions which lead to frame-shift mutations, while HDR allows for larger and more precise perturbations. Here, we present protocols for generating knockout cell lines by coupling established CRISPR/Cas9 methods with two options for downstream selection/screening. The NHEJ approach uses a single sgRNA cut site and selection-independent screening, where protein production is assessed by dot immunoblot in a high-throughput manner. The HDR approach uses two sgRNA cut sites that span the gene of interest. Together with a provided HDR template, this method can achieve deletion of tens of kb, aided by the inserted selectable resistance marker. The appropriate applications and advantages of each method are discussed.

Recent advances in the ability to genetically manipulate somatic cell lines hold great potential for basic and applied research. Here, we present two approaches for CRISPR/Cas9 generated knockout production and screening in mammalian cell lines, with and without the use of selectable markers.

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide ...

Genome Editing in Mammalian Cell Lines using CRISPR-Cas

The clustered regularly interspaced short palindromic repeats (CRISPR) system functions naturally in bacterial adaptive immunity, but has been successfully repurposed for genome engineering in many different living organisms. Most commonly, the wildtype CRISPR associated 9 (Cas9) or Cas12a endonuclease is used to cleave specific sites in the genome, after which the DNA double-stranded break is repaired via the non-homologous end joining (NHEJ) pathway or the homology-directed repair (HDR) pathway depending on whether a donor template is absent or present respectively. To date, CRISPR systems from different bacterial species have been shown to be capable of performing genome editing in mammalian cells. However, despite the apparent simplicity of the technology, multiple design parameters need to be considered, which often leave users perplexed about how best to carry out their genome editing experiments. Here, we describe a complete workflow from experimental design to identification of cell clones that carry desired DNA modifications, with the goal of facilitating successful execution of genome editing experiments in mammalian cell lines. We highlight key considerations for users to take note of, including the choice of CRISPR system, the spacer length, and the design of a single-stranded oligodeoxynucleotide (ssODN) donor template. We envision that this workflow will be useful for gene knockout studies, disease modeling efforts, or the generation of reporter cell lines.

CRISPR-Cas is a powerful technology to engineer the complex genomes of plants and animals. Here, we detail a protocol to efficiently edit the human genome using different Cas endonucleases. We highlight important considerations and design parameters to optimize editing efficiency.

The clustered regularly interspaced short palindromic repeats (CRISPR) system functions naturally in bacterial adaptive immunity, but has been ...

Pooled CRISPR-Based Genetic Screens in Mammalian Cells

Genome editing using the CRISPR-Cas system has vastly advanced the ability to precisely edit the genomes of various organisms. In the context of mammalian cells, this technology represents a novel means to perform genome-wide genetic screens for functional genomics studies. Libraries of guide RNAs (sgRNA) targeting all open reading frames permit the facile generation of thousands of genetic perturbations in a single pool of cells that can be screened for specific phenotypes to implicate gene function and cellular processes in an unbiased and systematic way. CRISPR-Cas screens provide researchers with a simple, efficient, and inexpensive method to uncover the genetic blueprints for cellular phenotypes. Furthermore, differential analysis of screens performed in various cell lines and from different cancer types can identify genes that are contextually essential in tumor cells, revealing potential targets for specific anticancer therapies. Performing genome-wide screens in human cells can be daunting, as this involves the handling of tens of millions of cells and requires analysis of large sets of data. The details of these screens, such as cell line characterization, CRISPR library considerations, and understanding the limitations and capabilities of CRISPR technology during analysis, are often overlooked. Provided here is a detailed protocol for the successful performance of pooled genome-wide CRISPR-Cas9 based screens.

CRISPR-Cas9 technology provides an efficient method to precisely edit the mammalian genome in any cell type and represents a novel means to perform genome-wide genetic screens. A detailed protocol discussing the steps required for the successful performance of pooled genome-wide CRISPR-Cas9 screens is provided here.

Genome editing using the CRISPR-Cas system has vastly advanced the ability to precisely edit the genomes of various organisms. In the context of mammalian ...

Cell Surface Receptor Identification Using Genome-Scale CRISPR/Cas9 Genetic Screens

Intercellular communication mediated by direct interactions between membrane-embedded cell surface receptors is crucial for the normal development and functioning of multicellular organisms. Detecting these interactions remains technically challenging, however. This manuscript describes a systematic genome-scale CRISPR/Cas9 knockout genetic screening approach that reveals cellular pathways required for specific cell surface recognition events. This assay utilizes recombinant proteins produced in a mammalian protein expression system as avid binding probes to identify interaction partners in a cell-based genetic screen. This method can be used to identify the genes necessary for cell surface interactions detected by recombinant binding probes corresponding to the ectodomains of membrane-embedded receptors. Importantly, given the genome-scale nature of this approach, it also has the advantage of not only identifying the direct receptor but also the cellular components that are required for the presentation of the receptor at the cell surface, thereby providing valuable insights into the biology of the receptor.

This manuscript describes a genome-scale cell-based screening approach to identify extracellular receptor-ligand interactions.

Intercellular communication mediated by direct interactions between membrane-embedded cell surface receptors is crucial for the normal development and ...

A Multiplexed Luciferase-based Screening Platform for Interrogating Cancer-associated Signal Transduction in Cultured Cells

Genome-scale interrogation of gene function using RNA interference (RNAi) holds tremendous promise for the rapid identification of chemically tractable cancer cell vulnerabilities. Limiting the potential of this technology is the inability to rapidly delineate the mechanistic basis of phenotypic outcomes and thus inform the development of molecularly targeted therapeutic strategies. We outline here methods to deconstruct cellular phenotypes induced by RNAi-mediated gene targeting using multiplexed reporter systems that allow monitoring of key cancer cell-associated processes. This high-content screening methodology is versatile and can be readily adapted for the screening of other types of large molecular libraries.

Achieving a systems level understanding of cellular processes is a goal of modern-day cell biology. We describe here strategies for multiplexing luciferase reporters of various cellular function end-points to interrogate gene function using genome-scale RNAi libraries.

Genome-scale interrogation of gene function using RNA interference (RNAi)  holds tremendous promise for the rapid identification of chemically tractable  ...

Medicine

Monitoring Cell-autonomous Circadian Clock Rhythms of Gene Expression Using Luciferase Bioluminescence Reporters

In mammals, many aspects of behavior and physiology such as sleep-wake cycles and liver metabolism are regulated by endogenous circadian clocks (reviewed1,2). The circadian time-keeping system is a hierarchical multi-oscillator network, with the central clock located in the suprachiasmatic nucleus (SCN) synchronizing and coordinating extra-SCN and peripheral clocks elsewhere1,2. Individual cells are the functional units for generation and maintenance of circadian rhythms3,4, and these oscillators of different tissue types in the organism share a remarkably similar biochemical negative feedback mechanism. However, due to interactions at the neuronal network level in the SCN and through rhythmic, systemic cues at the organismal level, circadian rhythms at the organismal level are not necessarily cell-autonomous5-7. Compared to traditional studies of locomotor activity in vivo and SCN explants ex vivo, cell-based in vitro assays allow for discovery of cell-autonomous circadian defects5,8. Strategically, cell-based models are more experimentally tractable for phenotypic characterization and rapid discovery of basic clock mechanisms5,8-13.
Because circadian rhythms are dynamic, longitudinal measurements with high temporal resolution are needed to assess clock function. In recent years, real-time bioluminescence recording using firefly luciferase as a reporter has become a common technique for studying circadian rhythms in mammals14,15, as it allows for examination of the persistence and dynamics of molecular rhythms. To monitor cell-autonomous circadian rhythms of gene expression, luciferase reporters can be introduced into cells via transient transfection13,16,17 or stable transduction5,10,18,19. Here we describe a stable transduction protocol using lentivirus-mediated gene delivery. The lentiviral vector system is superior to traditional methods such as transient transfection and germline transmission because of its efficiency and versatility: it permits efficient delivery and stable integration into the host genome of both dividing and non-dividing cells20. Once a reporter cell line is established, the dynamics of clock function can be examined through bioluminescence recording. We first describe the generation of P(Per2)-dLuc reporter lines, and then present data from this and other circadian reporters. In these assays, 3T3 mouse fibroblasts and U2OS human osteosarcoma cells are used as cellular models. We also discuss various ways of using these clock models in circadian studies. Methods described here can be applied to a great variety of cell types to study the cellular and molecular basis of circadian clocks, and may prove useful in tackling problems in other biological systems.

Circadian clocks function within individual cells, i.e., they are cell-autonomous. Here, we describe methods for generating cell-autonomous clock models using non-invasive, luciferase-based real-time bioluminescence technology. Reporter cells provide tractable, functional model systems for studying circadian biology.

In mammals, many aspects of behavior and physiology such as sleep-wake cycles and liver metabolism are regulated by endogenous circadian clocks ...

Biology

Monitoring Plasmid Replication in Live Mammalian Cells over Multiple Generations by Fluorescence Microscopy

Few naturally-occurring plasmids are maintained in mammalian cells. Among these are genomes of gamma-herpesviruses, including Epstein-Barr virus (EBV) and Kaposi's Sarcoma-associated herpesvirus (KSHV), which cause multiple human malignancies 1-3. These two genomes are replicated in a licensed manner, each using a single viral protein and cellular replication machinery, and are passed to daughter cells during cell division despite their lacking traditional centromeres 4-8.
Much work has been done to characterize the replications of these plasmid genomes using methods such as Southern blotting and fluorescence in situ hybridization (FISH). These methods are limited, though. Quantitative PCR and Southern blots provide information about the average number of plasmids per cell in a population of cells. FISH is a single-cell assay that reveals both the average number and the distribution of plasmids per cell in the population of cells but is static, allowing no information about the parent or progeny of the examined cell.
Here, we describe a method for visualizing plasmids in live cells. This method is based on the binding of a fluorescently tagged lactose repressor protein to multiple sites in the plasmid of interest 9. The DNA of interest is engineered to include approximately 250 tandem repeats of the lactose operator (LacO) sequence. LacO is specifically bound by the lactose repressor protein (LacI), which can be fused to a fluorescent protein. The fusion protein can either be expressed from the engineered plasmid or introduced by a retroviral vector. In this way, the DNA molecules are fluorescently tagged and therefore become visible via fluorescence microscopy. The fusion protein is blocked from binding the plasmid DNA by culturing cells in the presence of IPTG until the plasmids are ready to be viewed.
This system allows the plasmids to be monitored in living cells through several generations, revealing properties of their synthesis and partitioning to daughter cells. Ideal cells are adherent, easily transfected, and have large nuclei. This technique has been used to determine that 84% of EBV-derived plasmids are synthesized each generation and 88% of the newly synthesized plasmids partition faithfully to daughter cells in HeLa cells. Pairs of these EBV plasmids were seen to be tethered to or associated with sister chromatids after their synthesis in S-phase until they were seen to separate as the sister chromatids separated in Anaphase10. The method is currently being used to study replication of KSHV genomes in HeLa cells and SLK cells. HeLa cells are immortalized human epithelial cells, and SLK cells are immortalized human endothelial cells. Though SLK cells were originally derived from a KSHV lesion, neither the HeLa nor SLK cell line naturally harbors KSHV genomes11. In addition to studying viral replication, this visualization technique can be used to investigate the effects of the addition, removal, or mutation of various DNA sequence elements on synthesis, localization, and partitioning of other recombinant plasmid DNAs.

A method of observing individual DNA molecules in live cells is described. The technique is based on the binding of a fluorescently tagged lac repressor protein to binding sites engineered into the DNA of interest. This method can be adapted to follow many recombinant DNAs in live cells over time.

Few naturally-occurring plasmids are maintained in mammalian cells.  Among these are genomes of gamma-herpesviruses, including Epstein-Barr virus  (EBV) ...

High-throughput Functional Screening using a Homemade Dual-glow Luciferase Assay

We present a rapid and inexpensive high-throughput screening protocol to identify transcriptional regulators of alpha-synuclein, a gene associated with Parkinson&#39;s disease. 293T cells are transiently transfected with plasmids from an arrayed ORF expression library, together with luciferase reporter plasmids, in a one-gene-per-well microplate format. Firefly luciferase activity is assayed after 48 hr to determine the effects of each library gene upon alpha-synuclein transcription, normalized to expression from an internal control construct (a hCMV promoter directing Renilla luciferase). This protocol is facilitated by a bench-top robot enclosed in a biosafety cabinet, which performs aseptic liquid handling in 96-well format. Our automated transfection protocol is readily adaptable to high-throughput lentiviral library production or other functional screening protocols requiring triple-transfections of large numbers of unique library plasmids in conjunction with a common set of helper plasmids. We also present an inexpensive and validated alternative to commercially-available, dual luciferase reagents which employs PTC124, EDTA, and pyrophosphate to suppress firefly luciferase activity prior to measurement of Renilla luciferase. Using these methods, we screened 7,670 human genes and identified 68 regulators of alpha-synuclein. This protocol is easily modifiable to target other genes of interest.

We present a rapid and inexpensive screening method for identifying transcriptional regulators using high-throughput robotic transfections and a homemade dual-glow luciferase assay. This protocol rapidly generates direct side-by-side functional data for thousands of genes and is easily modifiable to target any gene of interest.

We present a rapid and inexpensive high-throughput screening protocol to identify transcriptional regulators of alpha-synuclein, a gene associated with ...

Gene Knock-in by CRISPR/Cas9 and Cell Sorting in Macrophage and T Cell Lines

Functional genomics studies of the immune system require genetic manipulations that involve both deletion of target genes and addition of elements to proteins of interest. Identification of gene functions in cell line models is important for gene discovery and exploration of cell-intrinsic mechanisms. However, genetic manipulations of immune cells such as T cells and macrophage cell lines using CRISPR/Cas9-mediated knock-in are difficult because of the low transfection efficiency of these cells, especially in a quiescent state. To modify genes in immune cells, drug-resistance selection and viral vectors are typically used to enrich for cells expressing the CRIPSR/Cas9 system, which inevitably results in undesirable intervention of the cells. In a previous study, we designed dual fluorescent reporters coupled to CRISPR/Cas9 that were transiently expressed after electroporation. This technical solution leads to rapid gene deletion in immune cells; however, gene knock-in in immune cells such as T cells and macrophages without the use of drug-resistance selection or viral vectors is even more challenging. In this article, we show that by using cell sorting to aid selection of cells transiently expressing CRISPR/Cas9 constructs targeting the Rosa26 locus in combination with a donor plasmid, gene knock-in can be achieved in both T cells and macrophages without drug-resistance enrichment. As an example, we show how to express human ACE2, a receptor of SARS-Cov-2, which is responsible for the current Covid-19 pandemic, in RAW264.7 macrophages by performing knock-in experiments. Such gene knock-in cells can be widely used for mechanistic studies.

This protocol uses fluorescent reporters and cell sorting to simplify knock-in experiments in macrophage and T cell lines. Two plasmids are used for these simplified knock-in experiments, namely a CRISPR/Cas9- and DsRed2-expressing plasmid and a homologous recombination donor plasmid expressing EBFP2, which is permanently integrated at the Rosa26 locus in immune cells.

Functional genomics studies of the immune system require genetic manipulations that involve both deletion of target genes and addition of elements to ...

Construction of CRISPR Plasmids and Detection of Knockout Efficiency in Mammalian Cells through a Dual Luciferase Reporter System

Samenvatting

Meer video's verkennen