This project was funded by First Class Grassland Science Discipline Program of Shandong Province (China), National Natural Science Foundation of China (31301936, 31572383), the Special Fund for Agro-scientific Research in the Public Interest (201403071), National risk assessment major special project of milk product quality and safety (GJFP201800804) and Projects of Qingdao People&#39;s Livelihood Science and Technology (19-6-1-68-nsh, 14-2-3-45-nsh, 13-1-3-88-nsh).

1. sgRNA oligonucleotide design
<ol>
	<li>Design sgRNAs using online tools such as the Cas-Designer online tool (http://www.rgenome.net/cas-designer/). The PAM sequence is important based on the Cas9 being used. For xCas9, the relevant PAM sequences are NG and the former referred Cas-Designer online tool can generate xCas9 relevant sgRNAs.
	<ol>
		<li>Use sgRNA design tools that encompass algorithms for on- and off-target prediction (http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design)11. A score of 0.2 or greater is preferred.</li>
	</ol>
	</li>
	<li>Select up to 3 gene editing targets for an optimum screening (e.g., T1, T2 and T3 were designed for sheep DKK2 exon 1 gene targeting [Table 1]).</li>
</ol>
2. Oligonucleotide modification
<ol>
	<li>To modify the sgRNA oligonucleotide, delete the 3&#8217;-NG protospacer adjacent motif (PAM), keeping the protospacer sequence (e.g., starting sequence for T1: TGCCTGCTCCTACTGGCCGC [20 nt]).</li>
	<li>Add the pentanucleotide CACCG to the 5&#8217;-end of the oligo. 
	NOTE: Upon ligation to the pX330-xCas9 skeleton, this sequence will contain the 3&#8217;-end of the U6 promoter motivating sgRNA transcription. The array &#8220;CACC&#8221; guarantees that the oligo is matching with the overhangs of the BbsI-digested pX330-xCas9 plasmid. The base &#8220;G&#8221; is a prerequisite of RNA Polymerase III promoters and guarantees the effective startup of sgRNA transcription (e.g., appending the 5&#8217;-CACCG array to the protospacer of T1, achieving T1-F: CACCGTGCCTGCTCCTACTGGCCGC [25 nt]). The cleavage efficiency of 21 nt gRNA is significantly different from that of 20 nt gRNA1,12,13,14. It is generally advised to use 20 nt with 5&#39;-G by generating a shorter protospacer, if this is not possible then 21 nt with extra 5&#39;-G can be used.</li>
	<li>Create a reverse complement (rc) of the protospacer sequence. 
	NOTE: For example, the rc of the T1 protospacer is GCGGCCAGTAGGAGCAGGCA (20 nt).</li>
	<li>Append AAAC to the 5&#8217;-end of the rc protospacer sequence. Append an additional C to the 3&#8217;-end of the rc protospacer. 
	NOTE: The &#8220;AAAC&#8221; sequence ensures that the oligonucleotide is suitable for cloning into the BbsI-digested pX330-xCas9 plasmid. The additional&#8220;C&#8221;on the 3&#8217;-end is essential for annealing with the initiating &#8220;G&#8221; for the sgRNA transcription described above (e.g., AAACGCGGCCAGTAGGAGCAGGCAC [25 nt] is the final oligonucleotide sequence for T1 rc protospacer).</li>
	<li>Order the oligonucleotides.</li>
</ol>
3. Oligonucleotide annealing
<ol>
	<li>Dilute lyophilized oligonucleotides to a final concentration of 10 &#956;M in double distilled water (ddH2O).</li>
	<li>Mix forward and reverse oligonucleotides in a thin wall PCR tube maintaning a 1:1 ratio (e.g., 20 &#956;L each) without adding any extra buffer.</li>
	<li>Incubate the mixture at 95 &#176;C for 5 min and then ramp down the temperature to 72 &#176;C for 10 min. Follow with a cooling period at room temperature (RT) consisting of simply removing the sample from the PCR machine and placing it at RT. 
	NOTE: It is not necessary to phosphorylate the oligonucleotide mixtures to facilitate the ligation.</li>
</ol>
4. sgRNA/CRISPR vector digestion
<ol>
	<li>Digest 1 &#956;g of the selected pX330-xCas9 vector with BbsI (10 units of enzyme per 1 &#956;g of plasmid) for 2 h at 37 &#176;C (Figure 2). Conduct the digestion of the pX330-xCas9 sgRNA expression vector in a total volume of 50 &#956;L, containing 5 &#956;L of 10x digestion buffer and distilled water to achieve the final volume.</li>
	<li>Purify the digested vector by band extraction from a 2% agarose gel under 10 V/cm and subsequently purify using a silica column using a commercial gel extraction kit.</li>
</ol>
5. Ligation of the annealed sgRNA oligonucleotides to the expression vector
<ol>
	<li>Mix the annealed sgRNA oligonucleotides (5 &#956;L of the mixture from step 4) with the BbsI-digested pX330-xCas9 vector (purified, 100 ng).</li>
	<li>Add 1 &#956;L of ligase and 1 &#956;L of 10x ligase buffer.</li>
	<li>Add distilled water with appropriate volume, up to 10 &#956;L.</li>
	<li>Incubate overnight at 4 &#176;C.</li>
</ol>
6. Competent cell transformation
<ol>
	<li>Take out E. coli DH5&#945; competent cells from storage at -80 &#176;C and thaw it on ice.</li>
	<li>Add 5 &#956;L of the ligation mix to 50 &#956;L of competent E. coli DH5&#945; and keep the mixture on ice for 30 min.</li>
	<li>Heat shock the mixture at 42 &#176;C for 90 s.</li>
	<li>Rest it on ice for 2 min.</li>
	<li>Recover the culture on a rotary shaker in 500 &#956;L of LB media for 1 h at 37 &#176;C.</li>
	<li>Plate 200 &#956;L of the culture on an ampicillin resistance LB agarose plate and incubate it overnight at 37 &#176;C.</li>
</ol>
7. Identification of the correct recombinant plasmids by PCR
<ol>
	<li>Choose 5 to 10 bacterial colonies from the LB plate and use each of them to inoculate one 1.5 mL tube containing 1 mL of LB media with 60 mg/mL ampicillin.</li>
	<li>Incubate the tubes on a rotary shaker for 2-3 h.</li>
	<li>Carry out detection of correct recombinant plasmids by using specific primer pairs for the sgRNA oligonucleotides [e.g., forward primer for T1 sgRNA expression vector construction (T1-F): CACCGTGCCTGCTCCTACTGGCCGC, reverse primer (BbsI-R): AAAGTCCCTATTGGCGTTAC, producing a 287 bp amplicon (Figure 3)].
	<ol>
		<li>Prepare the PCR mixture (Table 2).</li>
		<li>Use the following PCR cycling conditions: 95 &#176;C for 5 min for pre-denaturation; 30 cycles of 95 &#176;C for 30 s for denaturation, 60 &#176;C for 30 s for annealing, and 72 &#176;C for 30 s for extension. After the 30 cycles are completed, perform a final extension step by heating for 5 min at 72 &#176;C.</li>
		<li>Run the PCR product on a 2% agarose gel under 10 V/cm. A band at the right size [e.g., 287 bp] is considered as positive.</li>
	</ol>
	</li>
</ol>
8. Validate the sequence of sgRNA expression plasmid
<ol>
	<li>Verify the sequence of PCR positive colonies by Sanger sequencing15 using the reverse primer BbsI-R (see step 7.3). This primer anneals at the site downstream of the sgRNA oligo insert. The pX330-xCas9-T1 expressing sgRNA sequence containing protospacer TGCCTGCTCCTACTGGCCGCGG and xCas9 was constructed.</li>
	<li>Use the forward primer T1-F to sequence the positive colonies. The forward one could not give complete sequence information for the site surrounding the insertion site of the sgRNA oligo, because 30-50 bp fragment following the sequencing primer could not be exactly read out.</li>
</ol>
9. Construction of dual luciferase reporter vector
<ol>
	<li>Synthesize 300-500 bp DNA fragments containing the sgRNA targets and subclone it into a dual luciferase reporter vector through double digestion [e.g., subclone 440 bp sheep DKK2 exon1 fragment into pSSA-Dual plasmid16,17 by using double digestion with AscI and SalI, resulting pSSA-Dual-DKK2].</li>
	<li>Synthesize 300-500 bp DNA fragments containing the sgRNA targets. Note that the sequences of the DNA fragments must be parts of the genomic sequences, which could be obtained from NCBI website (https://www.ncbi.nlm.nih.gov/) or related references.</li>
	<li>Select a suitable dual luciferase reporter vector such as pSSA-Dual16,17 (or two vectors expressing firefly luciferase and renilla luciferase respectively) and then digest this vector and the DNA fragments stated above with two endonucleases such as AscI and SalI.</li>
	<li>Finally ligate these two fragments with T4 DNA Ligase, resulting into pSSA-Dual-Target. Details for double digestion and ligation are displayed in Table 3 and Table 4, respectively. It is worth mentioning that the reporter vector should be amplified in stable bacteria strains (such as Top10), which are recommended to be cultured with lower rotational speed (typically no more than 200 rpm), for the purpose of avoiding DNA recombination.</li>
</ol>
10. Cell transfection
<ol>
	<li>Extract endotoxin-free plasmids for vectors stated above. Evaluate the purity and concentration of the plasmids by using suitable instruments. A final concentration of no less than 500 ng/&#956;L and a purity ratio of 1.7-1.9 at absorbance 260/280 nm (A260/A280) are recommended for these plasmids.</li>
	<li>Co-transfect an appropriate cell line such as PIEC18 with the plasmids in equal proportion (e.g., pX330-xCas9-T1: pSSA-Dual-DKK2=1:1, 0.5 &#956;g plasmid for each duplication when using 24 well plate). Use an empty vector such as pX330-xCas9 as a negative control.
	<ol>
		<li>One day before the transfection, plate cells in an 24-well culture plate at a density of 2 x 105 cells/well. Cells will be ready for transfection when they achieve a confluence of 60-80%.</li>
		<li>Before the transfection time point, remove the supernatant as much as possible and gently add 0.5 mL of fresh media for each well.</li>
		<li>Dilute transfection reagent in DMEM media at the ratio of 1:25 and mix well.</li>
		<li>Prepare master mix of DNA by diluting 0.5 &#956;g of DNA in 25 &#956;L of DMEM media, and then add 1 &#956;L of P3000 reagent.</li>
		<li>Add diluted DNA to each tube of diluted transfection reagent (1:1 ratio).</li>
		<li>Incubate for 10&#8211;15 min at room temperature.</li>
		<li>Add 50 &#956;L of DNA-lipid complex to cells.</li>
		<li>Incubate cells for 24 h at 37 &#176;C. Then, analyze transfected cells as in Step 11.</li>
	</ol>
	</li>
</ol>
11. Dual-luciferase detection
<ol>
	<li>Prepare a sufficient quantity of the 1x passive lysis buffer (PLB) by adding 1 volume of 5x PLB to 4 volumes of distilled water and mix well.</li>
	<li>Passive lysis of cells cultured in 24-well culture plates.
	<ol>
		<li>Remove the growth medium from the cultured cells, and gently apply a sufficient volume of phosphate buffered saline (PBS) to wash the surface of the culture vessel. Swirl the vessel briefly to remove detached cells and residual growth medium. Completely remove the rinse solution before applying PLB reagent.</li>
		<li>Dispense 100 &#956;L of 1x PLB into each culture well to completely cover the cell monolayer. Let the culture plates stand for 20 min.</li>
		<li>Transfer the lysate to a tube or vial for further handling or storage.</li>
	</ol>
	</li>
	<li>Prepare luciferase assay reagent (LAR) by resuspending the provided lyophilized luciferase assay substrate in 10 mL of the supplied luciferase assay buffer.</li>
	<li>Prepare an adequate volume to perform the desired number of dual-luciferase reporter assays (100 &#181;L reagent per assay). Add 1 volume of 50x stop substrate to 50 volumes of stop buffer in a glass or siliconized polypropylene tube.</li>
	<li>Dual-luciferase reporter (DLR) assay
	<ol>
		<li>Program luminometers to provide a 2-second pre-read delay, followed by a 10-second measurement period.</li>
		<li>Predispense 100 &#181;L of luciferase assay reagent into the appropriate number of luminometer tubes to complete the desired number of DLR Assays.</li>
		<li>Carefully transfer up to 20 &#181;L of cell lysate into the luminometer tube containing LAR; mix by pipetting 2 or 3 times. Place the tube in the luminometer and initiate reading.</li>
		<li>Remove the sample tube from the luminometer, add 100 &#181;L of stop reagent and vortex briefly to mix. Replace the sample in the luminometer, and initiate reading.</li>
		<li>Record the renilla luciferase activity normalized to the firefly luciferase activity, namely the reciprocal of the ratio displayed on screen.</li>
		<li>Discard the reaction tube, and proceed to the next assay.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Zhang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+surrogate+reporter+system+for+multiplexable+evaluation+of+CRISPR/Cas9+in+targeted+mutagenesis.">A surrogate reporter system for multiplexable evaluation of CRISPR/Cas9 in targeted mutagenesis.</a> Scientific Reports. 8 (1), 1042 (2018).</li><li>Nageshwaran, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+Guide+RNA+Cloning+for+Mammalian+Systems.">CRISPR Guide RNA Cloning for Mammalian Systems.</a> Journal of Visualized Experiments. (140), (2018).</li><li>Dang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimizing+sgRNA+structure+to+improve+CRISPR-Cas9+knockout+efficiency.">Optimizing sgRNA structure to improve CRISPR-Cas9 knockout efficiency.</a> Genome Biology. 16, 280 (2015).</li><li>Doench, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimized+sgRNA+design+to+maximize+activity+and+minimize+off-target+effects+of+CRISPR-Cas9.">Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9.</a> Nature Biotechnology. 34 (2), 184-191 (2016).</li><li>Moreno-Mateos, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPRscan:+designing+highly+efficient+sgRNAs+for+CRISPR-Cas9+targeting+in+vivo.">CRISPRscan: designing highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo.</a> Nature Methods. 12 (10), 982-988 (2015).</li><li>Joung, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-scale+CRISPR-Cas9+knockout+and+transcriptional+activation+screening.">Genome-scale CRISPR-Cas9 knockout and transcriptional activation screening.</a> Nature Protocols. 12 (4), 828-863 (2017).</li><li>Yang, L., Yang, J. L., Byrne, S., Pan, J., Church, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas9-Directed+Genome+Editing+of+Cultured+Cells.">CRISPR/Cas9-Directed Genome Editing of Cultured Cells.</a> Current Protocols in Molecular Biology. 107, 1-17 (2014).</li><li>Yang, L., Mali, P., Kim-Kiselak, C., Church, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas-mediated+targeted+genome+editing+in+human+cells.">CRISPR-Cas-mediated targeted genome editing in human cells.</a> Methods in Molecular Biology. 1114, 245-267 (2014).</li><li>Vidigal, J. A., Ventura, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+and+efficient+one-step+generation+of+paired+gRNA+CRISPR-Cas9+libraries.">Rapid and efficient one-step generation of paired gRNA CRISPR-Cas9 libraries.</a> Nature Communications. 6, 8083 (2015).</li><li>Mazon, G., Mimitou, E. P., Symington, L. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SnapShot:+Homologous+recombination+in+DNA+double-strand+break+repair.">SnapShot: Homologous recombination in DNA double-strand break repair.</a> Cell. 142 (4), 646 (2010).</li><li>Doench, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rational+design+of+highly+active+sgRNAs+for+CRISPR-Cas9-mediated+gene+inactivation.">Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation.</a> Nature Biotechnology. 32 (12), 1262-1267 (2014).</li><li>Lee, J. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+CRISPR-Cas9+to+increase+its+specificity.">Directed evolution of CRISPR-Cas9 to increase its specificity.</a> Nature Communications. 9 (1), 3048 (2018).</li><li>Sung, Y. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+gene+knockout+in+mice+and+zebrafish+with+RNA-guided+endonucleases.">Highly efficient gene knockout in mice and zebrafish with RNA-guided endonucleases.</a> Genome Research. 24 (1), 125-131 (2014).</li><li>Ran, F. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Double+nicking+by+RNA-guided+CRISPR+Cas9+for+enhanced+genome+editing+specificity.">Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity.</a> Cell. 154 (6), 1380-1389 (2013).</li><li>Sanger, F., Nicklen, S., Coulson, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+sequencing+with+chain-terminating+inhibitors.">DNA sequencing with chain-terminating inhibitors.</a> Proceedings of the National Academy of Sciences of the United States of America. 74 (12), 5463-5467 (1977).</li><li>Ruan, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+CRISPR/Cas9-mediated+transgene+knockin+at+the+H11+locus+in+pigs.">Highly efficient CRISPR/Cas9-mediated transgene knockin at the H11 locus in pigs.</a> Scientific Reports. 5, 14253 (2015).</li><li>Li, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+plasmid+with+double+fluorescent+groups+and+its+application+as+standard+substance.">An plasmid with double fluorescent groups and its application as standard substance.</a> China patent. , (2012).</li><li>Li, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+the+porcine+p65+subunit+of+NF-kappaB+and+its+association+with+virus+antibody+levels.">Characterization of the porcine p65 subunit of NF-kappaB and its association with virus antibody levels.</a> Molecular Immunology. 48 (6-7), 914-923 (2011).</li><li>Li, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+pair+of+sgRNAs+targeting+porcine+RELA+gene.">A pair of sgRNAs targeting porcine RELA gene.</a> China patent. , (2015).</li></ol>

The authors declare that they have no competing financial interests.

The sgRNA vector cloning procedures we have described here facilitates efficient production of sgRNAs, with most of the costs derived from the oligonucleotide ordering and vector sequencing. While the outlined method is designed to allow users to generate sgRNAs for use with CRISPR/Cas9, the protocol can easily be adapted for use with Cas9 orthologues or other RNA-guided endonucleases such as Cpf1, introducing minor modifications to the vector backbone and the oligonucleotide overhanging sequences.
<p class="jove_con...

The CRISPR sgRNAs comprise a 20-nucleotide sequence (the protospacer), which is complementary to the genomic target sequence1,2. Although highly efficient, the ability of the CRISPR/Cas system to modify a given genomic site requires the generation of a vector carrying an efficient sgRNA unique to the target site(s)2. This paper describes the key steps in the generation of that sgRNA vector.
For successful genome editing using the CRISPR/Cas system, the use of highly efficient sgRNAs is a crucial prerequisite3,4,5. Since engineered nucleases used in genome editing manifest diverse efficiencies at different targeted loci1, a pre-selection of candidate sgRNA targets is necessary in order to save time and effort6,7,8,9. A dual luciferase reporter system has been developed to evaluate knockout efficiency by examining double-strand break repair via single strand annealing3,10. Here we use this reporter system to choose a preferred CRISPR sgRNA target from different candidate sgRNA vectors designed for specific gene editing. The protocol stated here has been implemented in our group and collaborating laboratories for the last few years to generate and evaluate CRISPR sgRNAs.
The following protocol sums up how to design suitable sgRNA through network software. Once the suitable sgRNAs are selected, we describe the different steps to obtain the required oligonucleotides as well as the approach for inserting the paired oligonucleotides into the pX330-xCas9 expression vector. We also present a method for assembling sgRNA-expressing and dual luciferase reporter vectors based on the ligation of these sequences into a predigested expression vector (steps 2-10, Figure 1A). Finally we describe how to analyze the the DNA cutting efficiency for each of the sgRNAs (steps 11-12).

<table>
	<tbody>
		<tr>
			<td>A new generation of full touch screen gradient PCR instrument</td>
			<td>LongGene</td>
			<td>A200</td>
			<td>Target gene amplification</td>
		</tr>
		<tr>
			<td>AscI restriction enzymes</td>
			<td>New England Biolabs</td>
			<td>R0558V</td>
			<td>Cutting target vectors</td>
		</tr>
		<tr>
			<td>BbsI restriction enzyme</td>
			<td>New England Biolabs</td>
			<td>R0539S</td>
			<td>Cutting target vectors</td>
		</tr>
		<tr>
			<td>Clean workbench</td>
			<td>AIRTECH</td>
			<td>SW-CJ-2FD/VS-1300L-U</td>
			<td>A partial purification device in the form of a vertical laminar flow, which creates a local high clean air environment</td>
		</tr>
		<tr>
			<td>DH5&#945; Competent Cells</td>
			<td>TaKaRa</td>
			<td>K613</td>
			<td>Plasmid vector transformation</td>
		</tr>
		<tr>
			<td>Dual-Luciferas Reporter Assay System</td>
			<td>Promega</td>
			<td>E1910</td>
			<td>Dual-luciferas reporter assay</td>
		</tr>
		<tr>
			<td>Electric thermostatic water bath</td>
			<td>Sanfa Scientific Instruments</td>
			<td>DK-S24</td>
			<td>Heating reagent by constant temperature in water bath</td>
		</tr>
		<tr>
			<td>Electrophoresis</td>
			<td>Beijing Liuyi Biotechnology Co., Ltd.</td>
			<td>DYY-6C</td>
			<td>Control voltage, current, etc.</td>
		</tr>
		<tr>
			<td>Eppendorf Reference 2</td>
			<td>Eppendorf China Ltd.</td>
			<td>Reference 2</td>
			<td>Accurately draw and transfer traces of liquid</td>
		</tr>
		<tr>
			<td>Gel imaging analyzer</td>
			<td>Beijing Liuyi Biotechnology Co., Ltd.</td>
			<td>WD-9413B</td>
			<td>For the analysis of electrophoresis gel images</td>
		</tr>
		<tr>
			<td>GloMax 20/20 Luminometer</td>
			<td>Promega</td>
			<td>E5311</td>
			<td>Detect dual luciferase activity</td>
		</tr>
		<tr>
			<td>High speed refrigerated centrifuge</td>
			<td>BMH</td>
			<td>sigma 3K15</td>
			<td>Nucleic acid extraction and purification</td>
		</tr>
		<tr>
			<td>Intelligent biochemical incubator</td>
			<td>Sanfa Scientific Instruments</td>
			<td>SHP-160</td>
			<td>Provide a suitable temperature environment for the enzyme digestion experiment</td>
		</tr>
		<tr>
			<td>LB Broth Agar</td>
			<td>Sangon Biotech</td>
			<td>A507003-0250</td>
			<td>For the cultivation of E.coli</td>
		</tr>
		<tr>
			<td>Lipofectamine 3000 Transfection Reagent Kit</td>
			<td>Thermo Fisher</td>
			<td>L3000015</td>
			<td>DNA Transfection</td>
		</tr>
		<tr>
			<td>SalI restriction enzymes</td>
			<td>New England Biolabs</td>
			<td>R3138V</td>
			<td>Cutting target vectors</td>
		</tr>
		<tr>
			<td>SanPrep Column DNA Gel Extraction Kit</td>
			<td>Sangon Biotech</td>
			<td>B518131-0050</td>
			<td>Recycling DNA fragments</td>
		</tr>
		<tr>
			<td>SanPrep Column Plasmid Mini-Preps Kit</td>
			<td>Sangon Biotech</td>
			<td>B518191-0100</td>
			<td>Extraction of plasmid DNA</td>
		</tr>
		<tr>
			<td>T4 DNA Ligase</td>
			<td>New England Biolabs</td>
			<td>M0202V</td>
			<td>Link DNA fragment</td>
		</tr>
		<tr>
			<td>TaKaRa MiniBEST DNA Fragment Purification Kit Ver.4.0</td>
			<td>TaKaRa</td>
			<td>9761</td>
			<td>DNA purification</td>
		</tr>
		<tr>
			<td>Vertical pressure steam sterilizer</td>
			<td>JIBIMED</td>
			<td>LS-50LD</td>
			<td>High temperature and autoclave to kill bacteria, fungi and other microorganisms in laboratory equipment</td>
		</tr>
		<tr>
			<td>Water bath thermostat</td>
			<td>Changzhou Guoyu Instrument Manufacturing Co., Ltd.</td>
			<td>SHZ-82</td>
			<td>Let the bacteria keep shaking, which is good for contact with air.</td>
		</tr>
	</tbody>
</table>

construction of crispr plasmids and detection of knockout efficiency in mammalian cells through a dual luciferase reporter system

Although highly efficient, modification of a genomic site by the CRISPR enzyme requires the generation of a sgRNA unique to the target site(s) beforehand. This work describes the key steps leading to the construction of efficient sgRNA vectors using a strategy that allows the efficient detection of the positive colonies by PCR prior to DNA sequencing. Since efficient genome editing using the CRISPR system requires a highly efficient sgRNA, a preselection of candidate sgRNA targets is necessary to save time and effort. A dual luciferase reporter system has been developed to evaluate knockout efficiency by examining double-strand break repair via single strand annealing. Here, we use this reporter system to pick up the preferred xCas9/sgRNA target from candidate sgRNA vectors for specific gene editing. The protocol outlined will provide a preferred sgRNA/CRISPR enzyme vector in 10 days (starting with appropriately designed oligonucleotides).

The methods outlined in this protocol are for the construction of sgRNA and xCas9 expression vectors and then for the optimization screening of sgRNA oligos with relatively higher gene targeting efficiencies. Here we display a representative example of 3 sgRNA targets to sheep DKK2 exon 1. SgRNA and xCas9 expressing vectors can be built by predigesting the vector backbone (Figure 2) followed by ligating it in a series of short double-strand DNA fragments through annealing oligo pair...

Watch this Scientific Journal Video about Construction of CRISPR Plasmids and Detection of Knockout Efficiency in Mammalian Cells through a Dual Luciferase Reporter System at JoVE.com

Construction of CRISPR Plasmids and Detection of Knockout Efficiency in Mammalian Cells through a Dual Luciferase Reporter System

Here, we present a protocol describing a streamlined method for the efficient generation of plasmids expressing both the CRISPR enzyme and associated single guide RNA (sgRNAs). Co-transfection of mammalian cells with this sgRNA/CRISPR vector and a dual luciferase reporter vector that examines double-strand break repair allows evaluation of knockout efficiency.

Although highly efficient, modification of a genomic site by the CRISPR enzyme requires the generation of a sgRNA unique to the target site(s) beforehand. ...

construction-crispr-plasmids-detection-knockout-efficiency-mammalian

Research

JoVE Journal

Bioengineering

6.1K Views.  Qingdao Agricultural University, Qingdao, China. Here, we present a protocol describing a streamlined method for the efficient generation of plasmids expressing both the CRISPR enzyme and associated single guide RNA (sgRNAs). Co-transfection of mammalian cells with this sgRNA/CRISPR vector and a dual luciferase reporter vector that examines double-strand break repair allows evaluation of knockout efficiency.

Video: Construction of CRISPR Plasmids and Detection of Knockout Efficiency in Mammalian Cells through a Dual Luciferase Reporter System

Detection and Isolation of Circulating Melanoma Cells using Photoacoustic Flowmetry

Circulating tumor cells (CTCs) are those cells that have separated from a macroscopic tumor and spread through the blood and lymph systems to seed secondary tumors1,2,3. CTCs are indicators of metastatic disease and their detection in blood samples may be used to diagnose cancer and monitor a patient&prime;s response to therapy. Since CTCs are rare, comprising about one tumor cell among billions of normal blood cells in advanced cancer patients, their detection and enumeration is a difficult task. We exploit the presence of pigment in most melanoma cells to generate photoacoustic, or laser induced ultrasonic waves in a custom flow cytometer for detection of circulating melanoma cells (CMCs)4,5. This process entails separating a whole blood sample using centrifugation and obtaining the white blood cell layer. If present in whole blood, CMCs will separate with the white blood cells due to similar density. These cells are resuspended in phosphate buffered saline (PBS) and introduced into the flowmeter. Rather than a continuous flow of the blood cell suspension, we induced two phase flow in order to capture these cells for further study. In two phase flow, two immiscible liquids in a microfluidic system meet at a junction and form alternating slugs of liquid6,7. PBS suspended white blood cells and air form microliter slugs that are sequentially irradiated with laser light. The addition of a surfactant to the liquid phase allows uniform slug formation and the user can create different sized slugs by altering the flow rates of the two phases. Slugs of air and slugs of PBS with white blood cells contain no light absorbers and hence, do not produce photoacoustic waves. However, slugs of white blood cells that contain even single CMCs absorb laser light and produce high frequency acoustic waves. These slugs that generate photoacoustic waves are sequestered and collected for cytochemical staining for verification of CMCs.

We have developed a flow cytometer using laser induced ultrasound to detect circulating melanoma cells as an early indicator of metastatic disease.

Circulating tumor cells (CTCs) are those cells that have separated from a macroscopic tumor and spread through the blood and lymph systems to seed ...

Bacterial Detection &amp; Identification Using Electrochemical Sensors

Electrochemical sensors are widely used for rapid and accurate measurement of blood glucose and can be adapted for detection of a wide variety of analytes. Electrochemical sensors operate by transducing a biological recognition event into a useful electrical signal. Signal transduction occurs by coupling the activity of a redox enzyme to an amperometric electrode. Sensor specificity is either an inherent characteristic of the enzyme, glucose oxidase in the case of a glucose sensor, or a product of linkage between the enzyme and an antibody or probe.
Here, we describe an electrochemical sensor assay method to directly detect and identify bacteria. In every case, the probes described here are DNA oligonucleotides. This method is based on sandwich hybridization of capture and detector probes with target ribosomal RNA (rRNA). The capture probe is anchored to the sensor surface, while the detector probe is linked to horseradish peroxidase (HRP). When a substrate such as 3,3',5,5'-tetramethylbenzidine (TMB) is added to an electrode with capture-target-detector complexes bound to its surface, the substrate is oxidized by HRP and reduced by the working electrode. This redox cycle results in shuttling of electrons by the substrate from the electrode to HRP, producing current flow in the electrode.

Bacterial Detection & Identification Using Electrochemical Sensors

We describe an electrochemical sensor assay method for rapid bacterial detection and identification. The assay involves a sensor array functionalized with DNA oligonucleotide capture probes for ribosomal RNA (rRNA) species-specific sequences. Sandwich hybridization of target rRNA with the capture probe and a horseradish peroxidase-linked DNA oligonucleotide detector probe produces a measurable amperometric current.

Electrochemical  sensors are widely used for rapid and accurate measurement of blood glucose and  can be adapted for detection of a wide variety of ...

Construction and Characterization of a Novel Vocal Fold Bioreactor

In vitro engineering of mechanically active tissues requires the presentation of physiologically relevant mechanical conditions to cultured cells. To emulate the dynamic environment of vocal folds, a novel vocal fold bioreactor capable of producing vibratory stimulations at fundamental phonation frequencies is constructed and characterized. The device is composed of a function generator, a power amplifier, a speaker selector and parallel vibration chambers. Individual vibration chambers are created by sandwiching a custom-made silicone membrane between a pair of acrylic blocks. The silicone membrane not only serves as the bottom of the chamber but also provides a mechanism for securing the cell-laden scaffold. Vibration signals, generated by a speaker mounted underneath the bottom acrylic block, are transmitted to the membrane aerodynamically by the oscillating air. Eight identical vibration modules, fixed on two stationary metal bars, are housed in an anti-humidity chamber for long-term operation in a cell culture incubator. The vibration characteristics of the vocal fold bioreactor are analyzed non-destructively using a Laser Doppler Vibrometer (LDV). The utility of the dynamic culture device is demonstrated by culturing cellular constructs in the presence of 200-Hz sinusoidal vibrations with a mid-membrane displacement of 40 &#181;m. Mesenchymal stem cells cultured in the bioreactor respond to the vibratory signals by altering the synthesis and degradation of vocal fold-relevant, extracellular matrix components. The novel bioreactor system presented herein offers an excellent in vitro platform for studying vibration-induced mechanotransduction and for the engineering of functional vocal fold tissues.

A novel vocal fold bioreactor capable of delivering physiologically relevant, vibratory stimulation to cultured cells is constructed and characterized. This dynamic culture device, when combined with a fibrous poly(&#949;-caprolactone) scaffold, creates a vocal fold-mimetic environment that modulates the behaviors of mesenchymal stem cells.

In vitro engineering of mechanically active tissues requires the presentation of physiologically relevant mechanical conditions to cultured cells. To ...

Cultivation of Mammalian Cells Using a Single-use Pneumatic Bioreactor System

Recent advances in mammalian, insect, and stem cell cultivation and scale-up have created tremendous opportunities for new therapeutics and personalized medicine innovations. However, translating these advances into therapeutic applications will require in vitro systems that allow for robust, flexible, and cost effective bioreactor systems. There are several bioreactor systems currently utilized in research and commercial settings; however, many of these systems are not optimal for establishing, expanding, and monitoring the growth of different cell types. The culture parameters most challenging to control in these systems include, minimizing hydrodynamic shear, preventing nutrient gradient formation, establishing uniform culture medium aeration, preventing microbial contamination, and monitoring and adjusting culture conditions in real-time. Using a pneumatic single-use bioreactor system, we demonstrate the assembly and operation of this novel bioreactor for mammalian cells grown on micro-carriers. This bioreactor system eliminates many of the challenges associated with currently available systems by minimizing hydrodynamic shear and nutrient gradient formation, and allowing for uniform culture medium aeration. Moreover, the bioreactor&#8217;s software allows for remote real-time monitoring and adjusting of the bioreactor run parameters. This bioreactor system also has tremendous potential for scale-up of adherent and suspension mammalian cells for production of a variety therapeutic proteins, monoclonal antibodies, stem cells, biosimilars, and vaccines.

Using a pneumatic bioreactor, we demonstrate the assembly, operation, and performance of this single-use bioreactor system for the growth of mammalian cells.

Recent advances in mammalian, insect, and stem cell cultivation and scale-up have created tremendous opportunities for new therapeutics and personalized ...

Electrotaxis Studies of Lung Cancer Cells using a Multichannel Dual-electric-field Microfluidic Chip

The behavior of directional cell migration under a direct current electric-field (dcEF) is referred to as electrotaxis. The significant role of physiological dcEF in guiding cell movement during embryo development, cell differentiation, and wound healing has been demonstrated in many studies. By applying microfluidic chips to an electrotaxis assay, the investigation process is shortened and experimental errors are minimized. In recent years, microfluidic devices made of polymeric substances (e.g., polymethylmethacrylate, PMMA, or acrylic) or polydimethylsiloxane (PDMS) have been widely used in studying the responses of cells to electrical stimulation. However, unlike the numerous steps required to fabricate a PDMS device, the simple and rapid construction of the acrylic micro&#64258;uidic chip makes it suitable for both device prototyping and production. Yet none of the reported devices facilitate the efficient study of the simultaneous chemical and dcEF effects on cells. In this report, we describe our design and fabrication of an acrylic-based multichannel dual-electric-field (MDF) chip to investigate the concurrent effect of chemical and electrical stimulation on lung cancer cells. The MDF chip provides eight combinations of electrical/chemical stimulations in a single test. The chip not only greatly shortens the required experimental time but also increases accuracy in electrotaxis studies.

Many microfluidic devices have been developed for use in the study of electrotaxis. Yet, none of these chips allows the efficient study of the simultaneous chemical and electric-field (EF) effects on cells. We developed a polymethylmethacrylate-based device that offers better-controlled coexisting EF and chemical stimulation for use in electrotaxis research.

The behavior of directional cell migration under a direct current electric-field (dcEF) is referred to as electrotaxis. The significant role of ...

A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer

CRISPR/Cas9 technology has greatly improved the feasibility and speed of loss-of-function studies that are essential in understanding gene function. In higher eukaryotes, paralogous genes can mask a potential phenotype by compensating the loss of a gene, thus limiting the information that can be obtained from genetic studies relying on single gene knockouts. We have developed a novel, rapid cloning method for guide RNA (gRNA) concatemers in order to create multi-gene knockouts following a single round of transfection in mouse small intestinal organoids. Our strategy allows for the concatemerization of up to four individual gRNAs into a single vector by performing a single Golden Gate shuffling reaction with annealed gRNA oligos and a pre-designed retroviral vector. This allows either the simultaneous knockout of up to four different genes, or increased knockout efficiency following the targeting of one gene by multiple gRNAs. In this protocol, we show in detail how to efficiently clone multiple gRNAs into the retroviral CRISPR-concatemer vector and how to achieve highly efficient electroporation in intestinal organoids. As an example, we show that simultaneous knockout of two pairs of genes encoding negative regulators of the Wnt signaling pathway (Axin1/2 and Rnf43/Znrf3) renders intestinal organoids resistant to the withdrawal of key growth factors.

This protocol describes the steps for cloning multiple single guide RNAs into one guide RNA concatemer vector, which is of particular use in creating multi-gene knockouts using CRISPR/Cas9 technology. The generation of double knockouts in intestinal organoids is shown as a possible application of this method.

CRISPR/Cas9 technology has greatly improved the feasibility and speed of loss-of-function studies that are essential in understanding gene function. In ...

Efficient Generation and Editing of Feeder-free IPSCs from Human Pancreatic Cells Using the CRISPR-Cas9 System

Embryonic and induced pluripotent stem cells can self-renew and differentiate into multiple cell types of the body. The pluripotent cells are thus coveted for research in regenerative medicine and are currently in clinical trials for eye diseases, diabetes, heart diseases, and other disorders. The potential to differentiate into specialized cell types coupled with the recent advances in genome editing technologies including the CRISPR/Cas system have provided additional opportunities for tailoring the genome of iPSC for varied applications including disease modeling, gene therapy, and biasing pathways of differentiation, to name a few. Among the available editing technologies, the CRISPR/Cas9 from Streptococcus pyogenes has emerged as a tool of choice for site-specific editing of the eukaryotic genome. The CRISPRs are easily accessible, inexpensive, and highly efficient in engineering targeted edits. The system requires a Cas9 nuclease and a guide sequence (20-mer) specific to the genomic target abutting a 3-nucleotide &#34;NGG&#34; protospacer-adjacent-motif (PAM) for targeting Cas9 to the desired genomic locus, alongside a universal Cas9 binding tracer RNA (together called single guide RNA or sgRNA). Here we present a step-by-step protocol for efficient generation of feeder-independent and footprint-free iPSC and describe methodologies for genome editing of iPSC using the Cas9 ribonucleoprotein (RNP) complexes. The genome editing protocol is effective and can be easily multiplexed by pre-complexing sgRNAs for more than one target with the Cas9 protein and simultaneously delivering into the cells. Finally, we describe a simplified approach for identification and characterization of iPSCs with desired edits. Taken together, the outlined strategies are expected to streamline generation and editing of iPSC for manifold applications.

This protocol describes in detail the generation of footprint-free induced pluripotent stem cells (iPSCs) from human pancreatic cells in feeder-free conditions, followed by editing using CRISPR/Cas9 ribonucleoproteins and characterization of the modified single-cell clones.

Embryonic and induced pluripotent stem cells can self-renew and differentiate into multiple cell types of the body. The pluripotent cells are thus coveted ...

An Orbital Shaking Culture of Mammalian Cells in O-shaped Vessels to Produce Uniform Aggregates

Suspension cultures of mammalian cell aggregates are required for various applications in medical and biotechnological fields. The disposable bag-based method is one of the simplest techniques for the mass production of cellular aggregates, but it does not protect the cultures against over-aggregation, which occurs when they gather at the bottom center of the culture vessel. To solve this problem, we developed an O-shaped dish and an O-shaped bag, neither of which contains a central region. Aggregates grown in either O-shaped culture vessel were noticeably more uniform in size than aggregates grown in conventional vessels. Histological analyses showed that aggregates in conventional culture dishes contained necrotic cores most likely caused by a poor oxygen supply. In contrast, aggregates that were grown in the O-shaped bag, even those with similar diameters to aggregates in conventional culture dishes, did not show necrotic cores. These results suggest that the O-shaped bag provides sufficient oxygen to the aggregates due to the oxygen permeability of the bag material. We, therefore, propose that this novel gas-permeable O-shaped culture bag is suitable for the mass production of uniform aggregates that are necessary in various biotechnological fields.

Here we present a protocol for using O-shaped vessels, specialized for suspension cultures of cellular aggregates, with orbital shaking. The HEK293 cells grown in this bag form more homogeneous aggregates than those grown in conventional culture vessels.

Suspension cultures of mammalian cell aggregates are required for various applications in medical and biotechnological fields. The disposable bag-based ...

Scalable Fabrication of Stretchable, Dual Channel, Microfluidic Organ Chips

A significant number of lead compounds fail in the pharmaceutical pipeline because animal studies often fail to predict clinical responses in human patients. Human Organ-on-a-Chip (Organ Chip) microfluidic cell culture devices, which provide an experimental in vitro platform to assess efficacy, toxicity, and pharmacokinetic (PK) profiles in humans, may be better predictors of therapeutic efficacy and safety in the clinic compared to animal studies. These devices may be used to model the function of virtually any organ type and can be fluidically linked through common endothelium-lined microchannels to perform in vitro studies on human organ-level and whole body-level physiology without having to conduct experiments on people. These Organ Chips consist of two perfused microfluidic channels separated by a permeable elastomeric membrane with organ-specific parenchymal cells on one side and microvascular endothelium on the other, which can be cyclically stretched to provide organ-specific mechanical cues (e.g., breathing motions in lung). This protocol details the fabrication of flexible, dual channel, Organ Chips through casting of parts using 3D printed molds, enabling combination of multiple casting and post-processing steps. Porous poly (dimethyl siloxane) (PDMS) membranes are cast with micrometer sized through-holes using silicon pillar arrays under compression. Fabrication and assembly of Organ Chips involves equipment and steps that can be implemented outside of a traditional cleanroom. This protocol provides researchers with access to Organ Chip technology for in vitro organ- and body-level studies in drug discovery, safety and efficacy testing, as well as mechanistic studies of fundamental biological processes.

Here, we present a protocol that describes the fabrication of stretchable, dual channel, organ chip microfluidic cell culture devices for recapitulating organ-level functionality in vitro.

A significant number of lead compounds fail in the pharmaceutical pipeline because animal studies often fail to predict clinical responses in human ...

Construction of a Multilayered Mesenchymal Stem Cell Sheet with a 3D Dynamic Culture System

Stem cell therapy shows a promising future in regenerating injured organ and tissues, and the cell sheet technique has been developed to improve the low cell retention and poor survival within the target zone. However, during the in vitro construction process, a solution for maintaining stem cell bioactivity and increasing the cell amount within the cell sheet is urgently needed. Here, this protocol presents a method for constructing a multilayered cell sheet with favorable stem cell bioactivity and optimal operability. Decellularized porcine pericardium (DPP) is prepared by phospholipase A2 (PLA2) decellularization method as the cell sheet scaffold, and rat bone marrow mesenchymal stem cells (BMSCs) are isolated and expanded as the seeded cells. The temporary multilayered cell sheet structure is constructed by using RAD16-I peptide hydrogel. Finally, the cell sheet is cultured with a dynamic perfusion system to stabilize the three-dimensional (3D) structure, and the cell sheet could be obtained following a 48-hour culture in vitro. This protocol provides an efficient and feasible method for constructing a multilayered stem cell sheet, and the cell sheet could be developed as a favorable stem cell therapy product in the future.

This article provides an efficient and feasible method for constructing multilayered stem cell sheets with favorable stem cell property.

Stem cell therapy shows a promising future in regenerating injured organ and tissues, and the cell sheet technique has been developed to improve the low ...