Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

Podsumowanie

Bacillus anthracis is the obligate pathogen of fatal inhalational anthrax, so studies of its genes and proteins are strictly regulated. An alternative approach is to study orthologous genes. We describe biophysicochemical studies of a B. anthracis ortholog in B. cereus, bc1531, requiring minimal experimental equipment and lacking serious safety concerns.

Streszczenie

To overcome safety restrictions and regulations when studying genes and proteins from true pathogens, their homologues can be studied. Bacillus anthracis is an obligate pathogen that causes fatal inhalational anthrax. Bacillus cereus is considered a useful model for studying B. anthracis due to its close evolutionary relationship. The gene cluster ba1554 - ba1558 of B. anthracis is highly conserved with the bc1531- bc1535 cluster in B. cereus, as well as with the bt1364-bt1368 cluster in Bacillus thuringiensis, indicating the critical role of the associated genes in the Bacillus genus. This manuscript describes methods to prepare and characterize a protein product of the first gene (ba1554) from the gene cluster in B. anthracis using a recombinant protein of its ortholog in B. cereus, bc1531.

Wprowadzenie

Recombinant protein expression is widely used to overcome problems associated with natural protein sources, such as limited protein quantities and harmful contamination. Moreover, in studies of pathogenic genes and proteins, an alternative laboratory strain that does not require additional safety precautions can be utilized. For example, Bacillus cereus is a useful model for studying Bacillus anthracis due to their close evolutionary relationship¹.

B. anthracis is an obligate pathogen that causes fatal inhalational anthrax in humans and livestock and can potentially be used as a bioweapon². Thus, laboratory studies on B. anthracis are strictly regulated by the US Centers for Disease Control, requiring biosafety level 3 (BSL-3) practices, which mandate that the laboratory area be segregated with negative room pressure. In contrast to B. anthracis, B. cereus is categorized as a BSL-1 agent and thus has minimal safety concerns. B. cereus is an opportunistic pathogen that, upon infection, causes food poisoning that can be treated without medical assistance. However, because B. cereus shares many critical genes with B. anthracis, the functions of B. anthracis proteins can be studied using the corresponding homologs of B. cereus¹.

The ba1554 - ba1558 gene cluster of B. anthracis is highly conserved with the bc1531- bc1535 cluster of B. cereus, as well as with the bt1364-bt1368 cluster of Bacillus thuringiensis, in terms of gene organization and sequence. Furthermore, the first genes (ba1554, bc1531, and bt1364) of the respective clusters are absolutely conserved (i.e., 100% nucleotide sequence identity), implying a critical role of the gene product in the Bacillus species. Due to its location in these gene clusters, ba1554 was misidentified as a putative transcription regulator³. However, amino acid sequence analysis of the ba1554 product indicates that it belongs to the MazG family, which has nucleotide pyrophosphohydrolase activity and is not associated with transcription factor activity^4,5. Although proteins belonging to the MazG family are diverse with respect to overall sequence and length, they share a common ~100-residue MazG domain characterized by an EXXE_12-28EXXD motif ("X" stands for any amino acid residue, and the number indicates the number of X residues).

The MazG domain does not always directly account for a certain catalytic activity. A MazG member from Escherichia coli (EcMazG) possesses two MazG domains, but only the C-terminal MazG domain is enzymatically active⁶. Moreover, the substrate specificity of MazG enzymes varies from non-specific nucleoside triphosphates (for EcMazG) to specific dCTP/dATP (for integrin-associated MazG) and dUTP (for dUTPases)^6,7,8,9. Therefore, biophysicochemical analyses of the BA1554 protein are necessary to confirm its NTPase activity and to decipher its substrate specificity.

Here, we provide a step-by-step protocol that most laboratories without a BSL-3 facility can follow to characterize the protein product of the B. cereus bc1531 gene, which is an ortholog of B. anthracis ba1554, at the molecular level. Briefly, recombinant BC1531 (rBC1531) was expressed in E. coli and purified using an affinity tag. For X-ray crystallographic experiments, the crystallization conditions of the rBC1531 protein were screened and optimized. To assess the enzymatic activity of rBC1531, NTPase activity was monitored colorimetrically to avoid radioactively labeled nucleotides that have been conventionally used. Finally, analyses of the obtained biophysicochemical data enabled us to determine the oligomerization state and catalytic parameters of rBC1531, as well as to obtain X-ray diffraction data from the rBC1531 crystal.

Protokół

1. Recombinant Protein Production and Purification of rBC1531

1. Preparation of a recombinant BC1531 protein (rBC1531)-expression plasmid
   1. Prepare genomic DNA of B. cereus¹⁰.
   2. Amplify the bc1531 gene from a template of B. cereus genomic DNA by polymerase chain reaction (PCR), using forward and reverse primers (see the Materials List) to create BamHI and SalI restriction enzyme sites, respectively¹⁰.
   3. Digest the PCR product and a modified pET49b vector (pET49bm) using BamHI and SalI, as described¹¹.
   4. Mix the digested PCR product and vector (3:1 ratio) from step 1.1.3 using T4 DNA ligase in a 10 µL reaction, as described¹¹. Incubate at 18 °C for 30 min.
   5. Pipette 3 µL of the ligation reaction into 50 µL of chemically competent E. coli DH5α cells in a tube. Mix gently by pipetting up and down and place on ice for 30 min. Heat shock for 45 s at 42 °C. Add 1 mL of Luria-Bertani (LB) medium and grow the cells while vigorously shaking (250 rpm, 37 °C, 45 min).
   6. Take 100 µL of the transformed cells from step 1.1.6 and spread them onto the LB-agar plates with 100 µg/mL kanamycin (Kan). Incubate for ~18 h at 37 °C.
   7. Pick colonies using a sterile tip and grow the cells in 3 mL of LB medium with 100 µg/mL Kan; shake vigorously (250 rpm, 37 °C, 18 h).
   8. Prepare plasmid DNA using an alkaline-SDS lysis method, as described¹⁰.
   9. Confirm the nucleotide sequence of the rBC1531-expression construct using DNA sequencing¹².
2. Overexpression of the rBC1531 protein
   1. Re-transform the E. coli BL21 (DE3) strain with rBC1531-expression plasmid, as described in steps 1.1.5-1.1.6, for overexpression.
   2. Select a colony and grow it in 10 mL of LB medium containing 50 µg/mL Kan (LB+Kan); shake vigorously for 18 h at 37 °C.
   3. Inoculate 10 mL of overnight culture in 1 L of LB+Kan medium and grow at 37 °C until the OD₆₀₀ (optical density at 600 nm) reaches ~0.7.
   4. Submerge the culture in ice-cold water for ~15 min to cool down the temperature to 18 °C and add isopropyl β-D-1-thiogalactopyranoside (IPTG) to the culture at a final concentration of 1 mM for recombinant protein expression. Grow the culture at 18 °C for an additional ~16-18 h.
3. Purification of rBC1531
   1. Harvest the cells by centrifugation (5,000 x g, 4 °C, 30 min). Discard the supernatant carefully so as to not disturb the cells. Re-suspend the cells in 50 mL of phosphate-buffered saline (PBS) solution containing 10 mM imidazole.
   2. Lyse the cells twice by sonication on ice to prevent the over-heating of the cell lysates (time: 2 min 30 s; cycle on: 5 s; cycle off: 10 s; amplitude: 38%).
   3. Clear the cell lysate by centrifugation (~25,000 x g, 4 °C, 30 min).
   4. Mix 3 mL of nickel beads and 60 mL of PBS containing 10 mM imidazole and gravity-flow the extra buffer to settle the equilibrated nickel beads in a 2.5 x 10 cm glass chromatography column.
   5. Pipette to transfer the supernatant from step 1.3.3 to the column with pre-equilibrated nickel beads and incubate at 4 °C for 2 h on a spinning wheel at a low speed (~20 rpm).
   6. Allow the supernatant to drain by gravity and wash the nickel beads in the column three times with 100 mL of PBS containing 10 mM imidazole.
   7. Elute rBC1531 protein by applying 4 x 5 mL of PBS containing 250 mM imidazole.
   8. Take 15 µL of the elution from step 1.3.7 and run it on 15% SDS-PAGE. Visualize the protein bands on the gel using Coomassie blue staining¹⁰.
4. Removal of the affinity tags of the rBC1531 protein by thrombin proteolysis
   1. Pipette the fractions into dialysis tube (molecular weight cut off: 3 kDa) and place the tube in a beaker containing 4 L of thrombin cleavage-compatible buffer (20 mM HEPES, pH 7.4, 150 mM NaCl, and 1.5 mM β-mercaptoethanol) at 4 °C overnight.
   2. Pipette the fractions and transfer them to a conical tube.
   3. Measure the absorbance at 280 nm and estimate the rBC1531 protein concentration, as described¹³.
   4. Take 50 µg of rBC1531 in a 0.5 mL tube and add various amounts of thrombin (i.e., 2, 1, 0.6, and 0.3 units). Incubate the rBC1531 and thrombin reactions at 20 °C for ~3 h to determine the least amount of thrombin required to cleave the N-terminal affinity tag.
   5. Run the rBC1531 and thrombin reactions on a 15% SDS-PAGE and determine the lowest amount of thrombin (e.g., 0.3 units of thrombin per 50 µg of rBC1531) that completely digests the N-terminal affinity tag and produce a tag-free rBC1531.
   6. Add 10 mg of rBC1531 protein and 60 units of thrombin to a 15 mL tube and incubate at 20 °C for ~3 h for the thrombin-proteolysis reaction.
   7. Apply gel-filtration standards to a size-exclusion chromatography (SEC) column to prepare a standard curve of molecular weights and elution volumes, as described¹³.
   8. Place the thrombin-digested rBC1531 protein from step 1.4.6 in a centrifugal filter tube (molecular weight cut off: 3 kDa) and centrifuge at 3,000 g at 4 °C to reduce to a volume of less than 5 mL.
   9. Apply the concentrated rBC1531 protein to the SEC column and collect 60 eluted fractions in 0.5 mL per tube¹³.
   10. Take 15 µL of each fraction, run them on a 15% SDS-PAGE, and stain the gel using Coomassie staining solution (0.15% (w/v) Coomassie brilliant blue, 40% (v/v) methanol, and 10% (v/v) glacial acetic acid) as described¹⁰.
   11. Pipette the fractions that contain rBC1531 and collect them in one tube.

2. Crystallization Screening and Optimization of rBC1531

1. Screening conditions for rBC1531 protein crystallization
   1. Concentrate the rBC1531 from step 1.4.11 up to ~18.5 mg/mL using a centrifugal filter tube, as described in step 1.4.8.
   2. Add 50 µL of each crystallization screening solution (see section 2.2)¹⁴ to the wells of 96-well sitting-drop crystallization plates. Place 0.5 µL of the 18.5 mg/mL rBC1531 protein solution on a sitting bed. Mix the protein solution with 0.5 µL of the well solution, repeating the process for the entire plate.
   3. Cover the plate with clear adhesive film. Place the 96-well plates at 18 °C and allow for vapor diffusion.
   4. Scan the drops at 20-40X magnification using a light microscope to monitor crystal formation daily for 2-3 weeks.
   5. Collect X-ray diffraction data¹² using the obtained rBC1531 protein crystals.
2. Optimization of rBC1531 crystallization conditions
   1. Prepare 500 µL of the selected initial crystallization condition solution (e.g., 0.1 M sodium cacodylate, pH 6.5 and 1.0 M sodium citrate) and fill a 24-well crystallization plate for the sitting drop.
   2. Add 0.5 µL of the 18.5 mg/mL rBC1531 protein solution to a sitting bed, mix with 0.5 µL of the well solution, and cover the plate immediately with clear adhesive film. Place the plate at 18 °C.
   3. Observe crystal growth under a light microscope for a week.
   4. Optimize various crystallization conditions by varying the pH (i.e., pH 5.5-6.8) of 0.1 M cacodylate and by altering the salt concentration (i.e., 0.9-1.2 M) of sodium citrate to obtain singular crystals. Monitor crystal growth for ~1 week and collect X-ray diffraction data¹².

3. Characterization of the Nucleoside Triphosphatase (NTPase) Activity of rBC1531

1. Validation of the inorganic phosphate-dependent colorimetric study
   1. Prepare a stock of pyrophosphate (100 mM) and dilute it to final concentrations of 0.1, 0.25, 0.5, 1.0, 5.0, 10, 50, 100, and 250 µM in 200 µL of reaction buffer (20 mM HEPES, pH 7.4; 150 mM NaCl; and 2 mM MgCl₂) in duplicate 96-well plates. Use the first plate as a control (this does not contain pyrophosphatase). Ensure that the second plate contains pyrophosphatase as a working plate, as directed in step 3.1.2.
   2. Add 0.01 unit of Saccharomyces cerevisiae inorganic pyrophosphatase (1 µL) to the wells of the working plate and incubate at 20 °C for 30-60 min.
   3. Prepare molybdate acid solution by mixing ammonium molybdate (0.86% v/v) and ascorbic acid (14% v/v) solutions in a 7:3 ratio. Add 16 µL of molybdate acid solution to both the working and control wells and wait for 15 min.
   4. Read the optical density at 690 nm (OD_690nm).
2. Colorimetric NTPase assay
   1. Prepare a stock of 100 mM nucleoside triphosphate (NTP) substrate and dilute to the desired concentration (e.g., 0, 0.2, 4.4, 11, 22, 44, 88, or 132 µM) in 180 µL of assay buffer (20 mM HEPES, pH 7.4; 150 mM NaCl; and 2 mM MgCl₂).
   2. Add 20 µg of rBC1531 (1.5 mM) and the NTP substrates from step 3.2.1 up to 200 µL per reaction in a 96-well plate and pipette up and down to mix well. Cover the plate with its lid and place it in a 37 °C incubator for 30 min to perform the substrate hydrolysis reaction.
   3. Transfer the plate to a 70 °C water bath and allow to stand for 15 min to stop rBC1531-mediated catalytic reactions.
   4. Add 0.01 unit of S. cerevisiae inorganic pyrophosphatase (1 µL) to each well of the reaction plate (from step 3.2.3) and incubate at 20 °C for 30 min. Add 16 µL of molybdate acid solution to the reaction plate to develop the color (~15 min). Read at OD_690nm.
   5. Analyze using the Michaelis-Menten equation, as described¹².

Wyniki

Characterization of the protein of interest in this study began by preparing a sufficient quantity of recombinant B. cereus bc1531 (rBC1531) protein, preferably more than several milligrams. The DNA fragment encoding the BC1531 protein was prepared by PCR using the genomic DNA of B. cereus as a template, as it contains orthologous genes identical to ba1554. rBC1531 was overexpressed as a soluble protein in E. coli cells. The rBC1531 protein was expresse...

Dyskusje

Studies of true pathogens are limited due to safety restrictions and regulations. Alternatively, pathogens can be studied using evolutionarily related non-pathogens or less pathogenic species. The ba1554 gene is considered a critical gene in B. anthracis. Fortunately, an identical gene is present in nonclinical B. cereus. Thus, without serious safety concerns, recombinant BC1531 protein can be used for biophysical and enzymatic characterization. Here, we described detailed procedures, moving fr...

Materiały

Name	Company	Catalog Number	Comments
Bacillus cereus ATCC14579	Korean Collection for Tissue Culture	3624
Genomic DNA prep kit	GeneAll	106-101	Genomic DNA preparation
Forward primer	Macrogen	GAAGGATCCGGAAGCAAAAA CGATGAAAGATATGCA	BamHI site is underlined
Reverse primer	Macrogen	CTTGTCGACTTATTCTTTCTCT CCCTCATCAATACGTG	SalI site is underlined
nPfu-Forte	Enzynomics	P410	PCR polymerase
BamHI	Enzynomics	R003S
SalI	Enzynomics	R009S
pET49b expression vector	Novagen	71463	Expression vector was modified to add affinity tags and BamHI/SalI sites10
T4 DNA ligase	Enzynomics	M001S
Dialysis memebrane	Thermofisher	18265017
Dry block heater	JSR	JSBL-02T
LB broth (Luria-Bertani)	LPS solution	LB-05
LB Agar, Miller (Luria-Bertani)	Becton, Dickinson and Company
Kanamycin	LPS solution	KAN025
Mini-prep kit	Favorgen	FAPDE300	Plasmid DNA preparation
BL21(DE3) Competent cell	Novagen	69450-3CN
Isopropyl β-D-1-thiogalactopyranoside (IPTG)	Fisher BioReagents	50-213-378
Sodium chloride	Daejung	7548-4100	PBS material
Potassium chloride	Daejung	6566-4405	PBS material
Potassium phosphate	Bio Basic Inc	PB0445	PBS material
Sodium phosphate	Bio Basic Inc	S0404	PBS material
Imidazole	Bio Basic Inc	IB0277
Sonicator	Sonics	VCX 130
Ni-NTA agaros	Qiagen	30210	Nickel bead
Rotator	Finepcr	AG
Precision Plus Protein Dual Color Standards	Bio-rad	1610374	SDS-PAGE protein standard
Coonmassie Brilliant Blue R-250	Fisher BioReagents	BP101-25	Coomassie staining solution
Methyl alcohol	Samchun chemical	M0585	Coomassie staining solution
Acetic acid	Daejung	1002-4105	Coomassie staining solution
Dialysis memebrane	Thermofisher	68035
2-Mercaptoethanol	Sigma-aldrich	M6250
Thrombin	Merckmillipore	605157-1KUCN	Prepare aliquots of 20 μl (1 Unit per μl) and store at 70 °C and thaw before use
Superdex 200 16/600	General Electric	28989335	Size exclusion chromatography
Gel filtration standard	Bio-rad	151-1901
Centrifugal filter	Amicon	UFC800396
Crystralization plates	Hampton research	HR3-083	96-well sitting drop plate
The JCSG core suite I-IV	Qiagen	130924-130927	Crystallization secreening solution
Microscope	Nikon	SMZ745T
Cryschem plates	Hampton research	HR3-158	24-well sitting drop plate
Inorganic pyrophosphatase	Sigma	10108987001
Ammonium molybdate solution	Sigma	13106-76-8
L-ascorbic acid	Sigma	50-81-7
NTP substrate	Startagene	200415-51
Spectrophotometer	Biotek	SynergyH1	microplate reader
GraphPad Prism 5	GraphPad	Prism 5 for Window