Work in the S.H. laboratory was supported by the DFG through SFB1064 (project ID 213249687), the European Research Council (ERC Starting Grant 852798 ConflictResolution), and the Helmholtz Gesellschaft.

Locus-Specific Chromatin Isolation from Yeast Cells

<ol>
	<li>Kornberg, R. D., Lorch, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Twenty-five+years+of+the+nucleosome,+fundamental+particle+of+the+eukaryote+chromosome.">Twenty-five years of the nucleosome, fundamental particle of the eukaryote chromosome.</a> Cell. 98 (3), 285-294 (1999).</li><li>Gauchier, M., van Mierlo, G., Vermeulen, M., D&#233;jardin, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+and+enrichment+of+specific+chromatin+loci.">Purification and enrichment of specific chromatin loci.</a> Nature Methods. 17 (4), 380-389 (2020).</li><li>Korthout, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Decoding+the+chromatin+proteome+of+a+single+genomic+locus+by+DNA+sequencing.">Decoding the chromatin proteome of a single genomic locus by DNA sequencing.</a> PLoS Biology. 16 (7), e2005542 (2018).</li><li>Ant&#227;o, J. M., Mason, J. M., D&#233;jardin, J., Kingston, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+landscape+at+Drosophila+melanogaster+telomere-associated+sequence+repeats.">Protein landscape at Drosophila melanogaster telomere-associated sequence repeats.</a> Molecular and Cellular Biology. 32 (12), 2170-2182 (2012).</li><li>D&#233;jardin, J., Kingston, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+of+proteins+associated+with+specific+genomic+loci.">Purification of proteins associated with specific genomic loci.</a> Cell. 136 (1), 175-186 (2009).</li><li>Ide, S., Dejardin, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=End-targeting+proteomics+of+isolated+chromatin+segments+of+a+mammalian+ribosomal+RNA+gene+promoter.">End-targeting proteomics of isolated chromatin segments of a mammalian ribosomal RNA gene promoter.</a> Nature Communications. 6, 6674 (2015).</li><li>Unnikrishnan, A., Gafken, P. R., Tsukiyama, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamic+changes+in+histone+acetylation+regulate+origins+of+DNA+replication.">Dynamic changes in histone acetylation regulate origins of DNA replication.</a> Nature Structural &amp;amp; Molecular Biology. 17 (4), 430 (2010).</li><li>Buxton, K. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Elucidating+protein-DNA+interactions+in+human+alphoid+chromatin+via+hybridization+capture+and+mass+spectrometry.">Elucidating protein-DNA interactions in human alphoid chromatin via hybridization capture and mass spectrometry.</a> Journal of Proteome Research. 16 (9), 3433-3442 (2017).</li><li>Kennedy-Darling, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+chromatin-associated+proteins+via+sequence-specific+capture+and+mass+spectrometric+protein+identification+in+Saccharomyces+cerevisiae.">Discovery of chromatin-associated proteins via sequence-specific capture and mass spectrometric protein identification in Saccharomyces cerevisiae.</a> Journal of Proteome Research. 13 (8), 3810-3825 (2014).</li><li>Liu, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPRi-based+genome-scale+identification+of+functional+long+noncoding+RNA+loci+in+human+cells.">CRISPRi-based genome-scale identification of functional long noncoding RNA loci in human cells.</a> Science. 355, 7111 (2017).</li><li>Hamperl, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+of+specific+chromatin+domains+from+single-copy+gene+loci+in+Saccharomyces+cerevisiae.">Purification of specific chromatin domains from single-copy gene loci in Saccharomyces cerevisiae.</a> Functional Analysis of DNA and Chromatin. 1094, 329-341 (2014).</li><li>Hamperl, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Compositional+and+structural+analysis+of+selected+chromosomal+domains+from+Saccharomyces+cerevisiae.">Compositional and structural analysis of selected chromosomal domains from Saccharomyces cerevisiae.</a> Nucleic Acids Research. 42 (1), 2 (2014).</li><li>Wei&#946;, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-copy+locus+proteomics+of+early-+and+late-firing+DNA+replication+origins+identifies+a+role+of+Ask1/DASH+complex+in+replication+timing+control.">Single-copy locus proteomics of early- and late-firing DNA replication origins identifies a role of Ask1/DASH complex in replication timing control.</a> Cell Reports. 42 (2), 112045 (2023).</li><li>Gietz, R. D., Schiestl, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-efficiency+yeast+transformation+using+the+LiAc/SS+carrier+DNA/PEG+method.">High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method.</a> Nature Protocols. 2 (1), 31-34 (2007).</li><li>Laemmli, U. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cleavage+of+structural+proteins+during+the+assembly+of+the+head+of+bacteriophage+T4.">Cleavage of structural proteins during the assembly of the head of bacteriophage T4.</a> Nature. 227 (5259), 680-685 (1970).</li><li>Towbin, H., Staehelin, T., Gordon, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrophoretic+transfer+of+proteins+from+polyacrylamide+gels+to+nitrocellulose+sheets:+procedure+and+some+applications.">Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.</a> Proceedings of the National Academy of Sciences of the United States of America. 76 (9), 4350-4354 (1979).</li><li>Western blot membrane stripping for restaining protocol. Abcam Available from: <a target="_blank" href="https://www.abcam.com/protocols/western-blot-membrane-stripping-for-restaining-protocol">https://www.abcam.com/protocols/western-blot-membrane-stripping-for-restaining-protocol</a> (2023)</li><li>Vermeulen, M., D&#233;jardin, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Locus-specific+chromatin+isolation.">Locus-specific chromatin isolation.</a> Nature Reviews. Molecular Cell Biology. 21 (5), 249-250 (2020).</li></ol>

The authors have no conflicts of interest to disclose.

The identification of the factors and chromatin landscape of a specific target genomic region continues to pose a major challenge in chromatin research18. This protocol describes an efficient system to specifically excise and purify distinct chromatin domains from yeast chromosomes. To our knowledge, the purity and yield of this single-step purification overcome many of the limitations of locus-specific chromatin purification methods, thus allowing for the achievement of very high enrichment of th...

The dynamic organization of eukaryotic genomes into chromatin compacts the DNA to fit within the confines of the nucleus while ensuring sufficient dynamics for gene expression and accessibility for regulatory factors. In part, this versatility is mediated by the nucleosome, the basic unit of chromatin, which comprises a core particle with 147 bp of DNA wrapped ~1.7 times around the histone octamer1. The nucleosome is a highly dynamic structure with respect to its composition, with numerous histone variants and posttranslational modifications (PTMs) on the N- and C-terminal histone tails. Furthermore, eukaryotic chromatin interacts with a multitude of other essential components, such as transcription factors, DNA and RNA processing machinery, architectural proteins, enzymes involved in chromatin remodeling and modification, and RNA molecules associated with chromatin. These crucial machineries involved in transcription, replication, and repair all require access to chromatin, which serves as the natural substrate for these processes. Consequently, comprehending the molecular mechanisms underlying these DNA transactions necessitates a precise definition of the collective alterations in chromatin structure at the specific genomic regions where these machineries converge and facilitate biological reactions.
Despite the identification of numerous chromatin factors through genetics and protein-protein interaction studies, performing direct, unbiased, and comprehensive analyses of chromatin interactions at particular genomic sites has remained a significant obstacle2,3. Initially, only highly abundant regions of the genome (i.e., repetitive loci) or multi-copy plasmids could be isolated in sufficient amounts and purity for mass spectrometric identification of the associated proteins4,5,6,7. A series of new approaches based on the direct hybridization of capture probes to chromatinized DNA, proximity biotinylation using the CRISPR-dCas9 system, or the binding of sequence-specific adapter proteins to the locus of interest have started to unravel the proteome of single-copy loci from yeast and mammalian genomes8,9,10. However, all these methods require formaldehyde crosslinking to stabilize the protein-DNA interactions and sonication to solubilize the chromatin for subsequent purification. Together, both manipulations exclude the possibility of subsequent structural and functional studies of the purified chromatin.
To overcome these limitations, we previously devised a methodology that employs site-specific recombination to extract targeted chromosomal domains from yeast11,12. In essence, the genomic region of interest is surrounded by recognition sites (RS) for the site-specific R-recombinase from Zygosaccharomyces rouxi while simultaneously incorporating a group of three DNA binding sites for the prokaryotic transcriptional repressor LexA protein (LexA) within the same region. The yeast cells contain an expression cassette for the simultaneous expression of R-recombinase and a LexA protein fused to a tandem affinity purification (TAP) tag. After the induction of R-recombinase, the enzyme efficiently excises the targeted region from the chromosome in the form of a circular chromatin domain. This domain can be purified via the LexA-TAP adapter protein, which binds to the LexA DNA binding sites, as well as to an affinity support. This method has been recently used to isolate distinct chromatin domains containing selected replication origins of yeast chromosome III13.
One major advantage of this ex vivo approach is that it allows for functional analyses of the isolated material. For example, replication origin domains purified with this method can be subjected to in vitro replication assays to assess the efficiency of origin firing in a test tube from native in vivo assembled chromatin templates. Ultimately, the biochemical and functional characterization of the isolated material may allow the reconstitution of nuclear processes using purified proteins together with the native chromatin template. In summary, this methodology opens an exciting avenue in chromatin research, as it will be possible to follow the collective compositional and structural chromatin changes of a specific genomic region undergoing a certain chromosomal transaction.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Yeast strains</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Control Strain: MATa; ura3&#916;0; leu2&#916;0; his3&#916;1; met15&#916;0; bar1::kanMX4; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR</td>
			<td></td>
			<td></td>
			<td>Section 1, see references 13 and 14</td>
		</tr>
		<tr>
			<td>Recombination Strain: MATa; ura3&#916;0; leu2&#916;0; his3&#916;1; met15&#916;0; bar1::kanMX4; RS_LEXA_NS-3_ARS316_NS+3_RS; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR</td>
			<td></td>
			<td></td>
			<td>Section 1, see reference 13 and 14</td>
		</tr>
		<tr>
			<td>Plasmid</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>K238 plasmid</td>
			<td></td>
			<td></td>
			<td>Section 1, see reference 13 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>K071 Spike-in plasmid DNA</td>
			<td></td>
			<td></td>
			<td>Section 7.1, see reference 13 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Acetone</td>
			<td>Carl Roth</td>
			<td>5025.1</td>
			<td>Section 2 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Ammonium acetate (NH4Ac)</td>
			<td>Sigma Aldrich</td>
			<td>A7262</td>
			<td>Section 6 and 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Ammonium solution (NH4OH) 25%</td>
			<td>Merck Millipore</td>
			<td>533003</td>
			<td>Section 6 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Ammonium sulfate</td>
			<td>Santa Cruz</td>
			<td>Sc-29085</td>
			<td>Section 2 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Bacto agar</td>
			<td>BD (VWR)</td>
			<td>90000-760</td>
			<td>Section 3 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Bacto peptone</td>
			<td>BD (VWR)</td>
			<td>211820</td>
			<td>Section 3 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>&#946;-Mercaptoethanol</td>
			<td>Sigma Aldrich</td>
			<td>07604</td>
			<td>Section 7.2 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Chemiluminescent substrate kit</td>
			<td>ThermoFisher</td>
			<td>34580</td>
			<td>Section 7.2 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Di-Sodium Hydrogen phosphate dodecahydrate</td>
			<td>Merck</td>
			<td>1.06579.1000</td>
			<td>Section 2 and 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Dithiothreitol (DTT)</td>
			<td>ThermoFisher</td>
			<td>15508013</td>
			<td>Section 4 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td>Merck</td>
			<td>100983</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Ethylenediaminetetraacetic acid (EDTA)</td>
			<td>Sigma Aldrich</td>
			<td>ED</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Galactose (20% (w/v) stock)</td>
			<td>Sigma Aldrich</td>
			<td>G0625-1KG&#160; /&#160; 5KG</td>
			<td>Section 3 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Gel loading dye (6x)</td>
			<td>BioLabs</td>
			<td>B7024A</td>
			<td>Section 7.1 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Glusose</td>
			<td>Sigma-Aldrich</td>
			<td>G8270</td>
			<td>Section 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Glycine</td>
			<td>Carl Roth</td>
			<td>.0079.4</td>
			<td>Section 2 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Glycogen (5 mg/mL)</td>
			<td>Invitrogen</td>
			<td>AM9510</td>
			<td>Section 7.1 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Hydrochloric acid (HCl)</td>
			<td>PanReac AppliChem</td>
			<td>182109.1211</td>
			<td>Section 2, 4 and 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Magnesium Acetate (MgAc)</td>
			<td>Bernd Kraft</td>
			<td>15274.2600/C035</td>
			<td>Section 4 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Magnesium chloride (MgCl2)</td>
			<td>Sigma Aldrich</td>
			<td>M8266</td>
			<td>Section 6 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Nu PAGE LDS sample buffer (4x)</td>
			<td>Invitrogen</td>
			<td>2399549</td>
			<td>Section 7.2 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Phenol/Chloroform/Isoamyl alcohol (25:24:1 v/v)</td>
			<td>Invitrogen</td>
			<td>15593-031</td>
			<td>Section 7.1 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Potassium chloride (KCl)</td>
			<td>Sigma</td>
			<td>P9541</td>
			<td>Section 4 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Radioactively labeled &#945;-32P dATP (3,000 Ci/mmol, 10 mCi/mL)</td>
			<td>Hartmann Analytic</td>
			<td>SRP-203</td>
			<td>Section 7.1 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>RadPrime labeling system</td>
			<td>ThermoFisher</td>
			<td>18428-011</td>
			<td>Section 7.1 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Raffinose (20% (w/v) stock)</td>
			<td>SERVA</td>
			<td>34140.03</td>
			<td>Section 3 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Sodium chloride (NaCl)</td>
			<td>Merck</td>
			<td>K53710504142</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Sodium citrate (Na3C6H5O7)</td>
			<td>Sigma-Aldrich</td>
			<td>71402</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Sodium hydroxide (NaOH)</td>
			<td>Sigma Aldrich</td>
			<td>S5881</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Sodium n-dodecyl sulfate (SDS) (5% stock (w/v) )</td>
			<td>Alfa Aesar</td>
			<td>A11183</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Sodium phosphate monobasic</td>
			<td>Sigma-Aldrich</td>
			<td>71496</td>
			<td>Section 2 and 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Sodium&#160;azide</td>
			<td>Santa Cruz&#160;Biotechnology</td>
			<td>sc-208393</td>
			<td>Section 2 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>&#160;Triethylamine</td>
			<td>Sigma Aldrich</td>
			<td>90340</td>
			<td>Section 2 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Tris base</td>
			<td>Chem Cruz</td>
			<td>SC-3715B</td>
			<td>Section 2 and 4 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma Aldrich</td>
			<td>X100</td>
			<td>Section 2 and 4 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Tween-20</td>
			<td>Bernd Kraft</td>
			<td>18014332</td>
			<td>Section 4 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Yeast extract</td>
			<td>BD (VWR)</td>
			<td>212720</td>
			<td>Section 3 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Yeast mating factor alpha (1 &#181;g/mL stock )</td>
			<td>&#160;Biomol</td>
			<td>Y2016.5</td>
			<td>Section 3 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Yeast Synthetic Drop-out medium Supplements without LEUCINE</td>
			<td>Sigma Aldrich</td>
			<td>Y1376</td>
			<td>Section 1, see reference 14</td>
		</tr>
		<tr>
			<td>Enzymes</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>HpaI restriction enzyme (5,000 U/mL)</td>
			<td>NEB</td>
			<td>R0105S</td>
			<td>Section 7.1 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Protease and Phosphatase Inhibitor Cocktail (100x)</td>
			<td>ThermoFisher Scientific</td>
			<td>78446</td>
			<td>Section 4 
			Storage: Store at4 &#176;C</td>
		</tr>
		<tr>
			<td>Proteinase K (10 mg/mL)</td>
			<td>SERVA</td>
			<td>33756</td>
			<td>Section 7.1 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>RNase A (10 mg/mL)</td>
			<td>&#160;ThermoFisher</td>
			<td>EN0531</td>
			<td>Section 7.1 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>TEV protease (10000 U/&#181;L)</td>
			<td>NEB</td>
			<td>P8112S</td>
			<td>Section 5 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Materials</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>BcMag Epoxy-Activated Magnetic Beads</td>
			<td>Bioclone Inc.</td>
			<td>FC-102</td>
			<td>Section 2 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Dry ice</td>
			<td></td>
			<td></td>
			<td>Section 4</td>
		</tr>
		<tr>
			<td>Low-binding centrifuge tubes 2.0 mL</td>
			<td>Eppendorf</td>
			<td>22431102</td>
			<td>Section 4</td>
		</tr>
		<tr>
			<td>Microspin&#160;G-25 Columns</td>
			<td>Cytiva</td>
			<td>27-5325-01</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Parafilm</td>
			<td>Merck</td>
			<td>P7793</td>
			<td>Section 4</td>
		</tr>
		<tr>
			<td>Positive nylon membrane</td>
			<td>Biozol</td>
			<td>11MEMP0001</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>PVDF transfer membrane</td>
			<td>Immobilon-Merck Millipore</td>
			<td>IPVH00010</td>
			<td>Section 7.2 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>SDS-PAGE gel 4-12% bis-tris (15 well, 1.5 mm)</td>
			<td>Invitrogen</td>
			<td>&#160;NP0336BOX</td>
			<td>Section 7.2 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Syringe (25 mL) with luer fitting</td>
			<td>Henke Sass Wolf</td>
			<td>4200-000V0</td>
			<td>Section 3</td>
		</tr>
		<tr>
			<td>Whatman paper (Grade 3MM CHR Cellulose Western Blotting Paper Sheet)</td>
			<td>Cytiva</td>
			<td>3030-917</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Antibodies</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-LexA, rabbit polyclonal IgG, DNA binding region antibody</td>
			<td>Merck Millipore</td>
			<td>06-719</td>
			<td>Section 7.2 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Goat Anti-Rabbit IgG (H+L), Horseradish peroxidase conjugate</td>
			<td>Invitrogen</td>
			<td>G21234</td>
			<td>Section 7.2 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Peroxidase Anti-Peroxidase (PAP) antibody produced in rabbit for the detection of TAP-tagged proteins</td>
			<td>Sigma Aldrich</td>
			<td>P1291-500UL</td>
			<td>Section 7.2 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Rabbit IgG antibodies</td>
			<td>Sigma</td>
			<td>I5006-100MG</td>
			<td>Section 2 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Primers (10 &#181;M)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>ARS316: fwd 5&#39;- CGGCATTATCGTACACAACCT, rev 5&#39;- GTTCTTCGTTGCCTACATTTTCT</td>
			<td></td>
			<td></td>
			<td>Section 7.1</td>
		</tr>
		<tr>
			<td>K071 Spike-in plasmid DNA: fwd: 5&#39;-TTTTCGCTGCTTGTCCTTTT, rev 5&#39;- CATTTTCGTCCTCCCAACAT</td>
			<td></td>
			<td></td>
			<td>Section 7.1</td>
		</tr>
		<tr>
			<td>PCR fragment from yeast genomic DNA as a template &#160;for ARS316 amplification (for southern blot): fwd 5&#8217;- AAATTCTGCCCTTGATTCGT&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; rev 5&#8217;- TTTGTTTATCTCATCACTAAT</td>
			<td></td>
			<td></td>
			<td>Section 7.1</td>
		</tr>
		<tr>
			<td>PDC1: fwd 5&#39;- CATGATCAGATGGGGCTTCA, rev 5&#39;-ACCGGTGGTAGCGACTCTGT</td>
			<td></td>
			<td></td>
			<td>Section 7.1</td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Coffee grinder</td>
			<td>Gastroback</td>
			<td>42601</td>
			<td>Section 4</td>
		</tr>
		<tr>
			<td>Dewar flask</td>
			<td>NAL GENE</td>
			<td>4150-2000</td>
			<td>Section 3</td>
		</tr>
		<tr>
			<td>DynaMag TM-2 magnetic rack</td>
			<td>Invitrogen</td>
			<td>12321D</td>
			<td>Section 4, 5 and 6</td>
		</tr>
		<tr>
			<td>Hybridization oven</td>
			<td>Hybaid Mini10</td>
			<td>Ri418</td>
			<td>Section 2</td>
		</tr>
		<tr>
			<td>Microcentrifuge</td>
			<td>Eppendorf</td>
			<td>5424R</td>
			<td>Section 4 and 7.1</td>
		</tr>
		<tr>
			<td>UV-crosslinker</td>
			<td>Analytikjena</td>
			<td>95-0174-02</td>
			<td>Section 7.1</td>
		</tr>
	</tbody>
</table>

single-copy gene locus chromatin purification in saccharomyces cerevisiae

The basic organizational unit of eukaryotic chromatin is the nucleosome core particle (NCP), which comprises DNA wrapped ~1.7 times around a histone octamer. Chromatin is defined as the entity of NCPs and numerous other protein complexes, including transcription factors, chromatin remodeling and modifying enzymes. It is still unclear how these protein-DNA interactions are orchestrated at the level of specific genomic loci during different stages of the cell cycle. This is mainly due to the current technical limitations, which make it challenging to obtain precise measurements of such dynamic interactions. Here, we describe an improved method combining site-specific recombination with an efficient single-step affinity purification protocol to isolate a single-copy gene locus of interest in its native chromatin state. The method allows for the robust enrichment of the target locus over genomic chromatin, making this technique an effective strategy for identifying and quantifying protein interactions in an unbiased and systematic manner, for example by mass spectrometry. Further to such compositional analyses, native chromatin purified by this method likely reflects the in vivo situation regarding nucleosome positioning and histone modifications and is, therefore, amenable to further structural and biochemical analyses of chromatin derived from virtually any genomic locus in yeast.

The purification of the ~1.4 kb ARS316 chromatin domain was mediated by the constitutively expressed LexA-TAP adapter protein. To serve as a negative control, we conducted purifications using an isogenic strain that expresses LexA-TAP but does not contain integrated RS and LexA-binding sites. Figure 3 illustrates the DNA analysis outcome from a standard purification experiment performed on both the control and a recombination-competent strain targeting the ARS316 locus. After DNA isolation a...

Watch this Scientific Journal Video about Advancing Chromatin Research and Overcoming Limitations with a High-Enrichment Locus-Specific Chromatin Isolation Protocol at JoVE.com

Author Spotlight: Advancing Chromatin Research and Overcoming Limitations with a High-Enrichment Locus-Specific Chromatin Isolation Protocol 

This protocol presents a locus-specific chromatin isolation method based on site-specific recombination to purify a single-copy gene locus of interest in its native chromatin context from budding yeast, Saccharomyces cerevisiae.

Single-Copy Gene Locus Chromatin Purification in Saccharomyces cerevisiae

The basic organizational unit of eukaryotic chromatin is the nucleosome core particle (NCP), which comprises DNA wrapped ~1.7 times around a histone ...

single-copy-gene-locus-chromatin-purification-saccharomyces

Universidad San Sebastian

Research

JoVE Journal

Biochemistry

908 Views.  Helmholtz Zentrum München. This protocol presents a locus-specific chromatin isolation method based on site-specific recombination to purify a single-copy gene locus of interest in its native chromatin context from budding yeast, Saccharomyces cerevisiae.

Video: Author Spotlight: Advancing Chromatin Research and Overcoming Limitations with a High-Enrichment Locus-Specific Chromatin Isolation Protocol 

Thermostabilization, Expression, Purification, and Crystallization of the Human Serotonin Transporter Bound to S-citalopram

The serotonin transporter is a sodium and chloride-coupled transporter that &#34;pumps&#34; extracellular serotonin into cells. S-citalopram is a drug used to treat depression and anxiety by binding to the serotonin transporter with high-affinity, blocking serotonin reuptake. Here we report an efficient procedure and a set of tools to stabilize, express, purify, and crystallize serotonin transporter-antibody complexes bound to S-citalopram and other antidepressants. Mutations which stabilize the serotonin transporter were identified using an S-citalopram binding assay. Serotonin transporter expressed in baculovirus-transduced HEK293S GnTI- cells, was reconstituted into proteoliposomes and used to raise high-affinity antibodies. We have developed a strategy to discover antibodies that are useful for structural studies. A straightforward approach for the expression of antibody fragments in Sf9 cells has also been established. Transporter-antibody complexes purified using this procedure are well-behaved and readily crystallize, producing complexes with S-citalopram that diffract X-rays to 3-4 &#197; resolution. The strategies developed here can be utilized to determine the structure of other challenging membrane proteins.

Thermostabilization, Expression, Purification, and Crystallization of the Human Serotonin Transporter Bound to S-citalopram

This manuscript describes how to screen for thermostabilizing mutations, purify the human serotonin transporter, generate high affinity antibodies, and crystallize the serotonin transporter-antibody complex bound to the antidepressant drug S-citalopram. This protocol can be adapted to the study of other challenging membrane transporters, receptors, and channels.

The serotonin transporter is a sodium and chloride-coupled transporter that &#34;pumps&#34; extracellular serotonin into cells. S-citalopram is a drug ...

Improved Protocol for Chromatin Immunoprecipitation from Mouse Skeletal Muscle

We describe an efficient and reproducible protocol for the preparation of chromatin from adult mouse skeletal muscle, a physically resistant tissue with a high content of structural proteins. Dissected limb muscles from adult mice are physically disrupted by mechanical homogenisation, or a combination of mincing and douncing, in a hypotonic buffer before formaldehyde fixation of the cell lysate. The fixed nuclei are purified by further cycles of mechanical homogenisation or douncing and sequential filtrations to remove cell debris. The purified nuclei can be sonicated immediately or at a later stage after freezing. The chromatin can be efficiently sonicated and is suitable for chromatin immunoprecipitation experiments, as illustrated by the profiles obtained for transcription factors, RNA polymerase II, and covalent histone modifications. The binding events detected using chromatin prepared by this protocol are predominantly those taking place in the muscle fiber nuclei despite the presence of chromatin from other fiber-associated satellite and endothelial cells. This protocol is therefore adapted to study gene regulation in the adult mouse skeletal muscle.

A novel protocol for the preparation of chromatin from adult mouse skeletal muscle adapted to the study of gene regulation in muscle fibers by chromatin immunoprecipitation is presented.

We describe an efficient and reproducible protocol for the preparation of chromatin from adult mouse skeletal muscle, a physically resistant tissue with a ...

High Sensitivity Measurement of Transcription Factor-DNA Binding Affinities by Competitive Titration Using Fluorescence Microscopy

Accurate quantification of transcription factor (TF)-DNA interactions is essential for understanding the regulation of gene expression. Since existing approaches suffer from significant limitations, we have developed a new method for determining TF-DNA binding affinities with high sensitivity on a large scale. The assay relies on the established fluorescence anisotropy (FA) principle but introduces important technical improvements. First, we measure a full FA competitive titration curve in a single well by incorporating TF and a fluorescently labeled reference DNA in a porous agarose gel matrix. Unlabeled DNA oligomer is loaded on the top as a competitor and, through diffusion, forms a spatio-temporal gradient. The resulting FA gradient is then read out using a customized epifluorescence microscope setup. This improved setup greatly increases the sensitivity of FA signal detection, allowing both weak and strong binding to be reliably quantified, even for molecules of similar molecular weights. In this fashion, we can measure one titration curve per well of a multi-well plate, and through a fitting procedure, we can extract both the absolute dissociation constant (KD) and active protein concentration. By testing all single-point mutation variants of a given consensus binding sequence, we can survey the entire binding specificity landscape of a TF, typically on a single plate. The resulting position weight matrices (PWMs) outperform those derived from other methods in predicting in vivo TF occupancy. Here, we present a detailed guide for implementing HiP-FA on a conventional automated fluorescent microscope and the data analysis pipeline.

Here we present a novel method for determining binding affinities at equilibrium and in solution with high sensitivity on a large scale. This improves the quantitative analysis of transcription factor-DNA binding. The method is based on automated fluorescence anisotropy measurements in a controlled delivery system.

Accurate quantification of transcription factor (TF)-DNA interactions is essential for understanding the regulation of gene expression. Since existing ...

Translating Ribosome Affinity Purification (TRAP) for RNA Isolation from Endothelial Cells In Vivo

Many studies have been limited to using in vitro cellular assays and whole tissues or isolating of specific cell types from animals for in vitro analysis of transcriptome and gene expression by qPCR and RNA sequencing. Comprehensive transcriptome and gene expression analysis of specific cell types in complex tissues and organs will be critical to understand cellular and molecular mechanisms by which genes are regulated and their association with tissue homeostasis and organ functions. In this article, we demonstrate the methodology for isolation of ribosome-bound RNA directly in vivo in the vascular endothelia of animal lungs as an example. The specific materials and procedures for tissue processing and RNA purification will be described, including the assessment of RNA quality and yield as well as real time qPCR for arteriogenic gene assays. This approach, known as translating ribosome affinity purification (TRAP) technique, can be utilized for characterization of gene expression and transcriptome analysis of certain cell types directly in vivo in any specific type in complex tissues.

Translating Ribosome Affinity Purification TRAP for RNA Isolation from Endothelial Cells In Vivo

We present an approach to purify ribosome-bound mRNA from vascular endothelial cells (ECs) directly in mouse brain, lung and heart tissues via EC-specific genetic tag of enhanced green fluorescence protein (EGFP)in ribosomes in combination with RNA purification.

Many studies have been limited to using in vitro cellular assays and whole tissues or isolating of specific cell types from animals for in vitro analysis ...

Quantitative Analysis of the Cellular Lipidome of Saccharomyces Cerevisiae Using Liquid Chromatography Coupled with Tandem Mass Spectrometry

Lipids are structurally diverse amphipathic molecules that are insoluble in water. Lipids are essential contributors to the organization and function of biological membranes, energy storage and production, cellular signaling, vesicular transport of proteins, organelle biogenesis, and regulated cell death. Because the budding yeast Saccharomyces cerevisiae is a unicellular eukaryote amenable to thorough molecular analyses, its use as a model organism helped uncover mechanisms linking lipid metabolism and intracellular transport to complex biological processes within eukaryotic cells. The availability of a versatile analytical method for the robust, sensitive, and accurate quantitative assessment of major classes of lipids within a yeast cell is crucial for getting deep insights into these mechanisms. Here we present a protocol to use liquid chromatography coupled with tandem mass spectrometry (LC-MS/MS) for the quantitative analysis of major cellular lipids of S. cerevisiae. The LC-MS/MS method described is versatile and robust. It enables the identification and quantification of numerous species (including different isobaric or isomeric forms) within each of the 10 lipid classes. This method is sensitive and allows identification and quantitation of some lipid species at concentrations as low as 0.2 pmol/&#181;L. The method has been successfully applied to assessing lipidomes of whole yeast cells and their purified organelles. The use of alternative mobile phase additives for electrospray ionization mass spectrometry in this method can increase the efficiency of ionization for some lipid species and can be therefore used to improve their identification and quantitation.

Quantitative Analysis of the Cellular Lipidome of Saccharomyces Cerevisiae Using Liquid Chromatography Coupled with Tandem Mass Spectrometry

We present a protocol using liquid chromatography coupled with tandem mass spectrometry to identify and quantify major cellular lipids in Saccharomyces cerevisiae. The described method for a quantitative assessment of major lipid classes within a yeast cell is versatile, robust, and sensitive.

Lipids are structurally diverse amphipathic molecules that are insoluble in water. Lipids are essential contributors to the organization and function of ...

MS2-Affinity Purification Coupled with RNA Sequencing in Gram-Positive Bacteria

Although small regulatory RNAs (sRNAs) are widespread among the bacterial domain of life, the functions of many of them remain poorly characterized notably due to the difficulty of identifying their mRNA targets. Here, we described a modified protocol of the MS2-Affinity Purification coupled with RNA Sequencing (MAPS) technology, aiming to reveal all RNA partners of a specific sRNA in vivo. Broadly, the MS2 aptamer is fused to the 5&#8217; extremity of the sRNA of interest. This construct is then expressed in vivo, allowing the MS2-sRNA to interact with its cellular partners. After bacterial harvesting, cells are mechanically lysed. The crude extract is loaded into an amylose-based chromatography column previously coated with the MS2 protein fused to the maltose binding protein. This enables the specific capture of MS2-sRNA and interacting RNAs. After elution, co-purified RNAs are identified by high-throughput RNA sequencing and subsequent bioinformatic analysis. The following protocol has been implemented in the Gram-positive human pathogen Staphylococcus aureus and is, in principle, transposable to any Gram-positive bacteria. To sum up, MAPS technology constitutes an efficient method to deeply explore the regulatory network of a particular sRNA, offering a snapshot of its whole targetome. However, it is important to keep in mind that putative targets identified by MAPS still need to be validated by complementary experimental approaches.

MAPS technology has been developed to scrutinize the targetome of a specific regulatory RNA in vivo. The sRNA of interest is tagged with a MS2 aptamer enabling the co-purification of its RNA partners and their identification by RNA sequencing. This modified protocol is particularly suited for Gram-positive bacteria.&#160;

Although small regulatory RNAs (sRNAs) are widespread among the bacterial domain of life, the functions of many of them remain poorly characterized ...

Utilization of Grafix for the Detection of Transient Interactors of Saccharomyces cerevisiae Spliceosome Subcomplexes

Pre-mRNA splicing is a very dynamic process that involves many molecular rearrangements of the spliceosome subcomplexes during assembly, RNA processing, and release of the complex components. Glycerol gradient centrifugation has been used for the separation of protein or RNP (RiboNucleoProtein) complexes for functional and structural studies. Here, we describe the utilization of Grafix (Gradient Fixation), which was first developed to purify and stabilize macromolecular complexes for single particle cryo-electron microscopy, to identify interactions between splicing factors that bind transiently to the spliceosome complex. This method is based on the centrifugation of samples into an increasing concentration of a fixation reagent to stabilize complexes. After centrifugation of yeast total extracts loaded on glycerol gradients, recovered fractions are analyzed by dot blot for the identification of the spliceosome sub-complexes and determination of the presence of individual splicing factors.

Utilization of Grafix for the Detection of Transient Interactors of Saccharomyces cerevisiae Spliceosome Subcomplexes

Here, we describe the utilization of Grafix (Gradient Fixation), a glycerol gradient centrifugation in the presence of a crosslinker, to identify interactions between splicing factors that bind transiently to the spliceosome complex.

Pre-mRNA splicing is a very dynamic process that involves many molecular rearrangements of the spliceosome subcomplexes during assembly, RNA processing, ...

Labelling and Visualization of Mitochondrial Genome Expression Products in Baker's Yeast Saccharomyces cerevisiae

Mitochondria are essential organelles of eukaryotic cells capable of aerobic respiration. They contain circular genome and gene expression apparatus. A mitochondrial genome of baker&#8217;s yeast encodes eight proteins: three subunits of the cytochrome c oxidase (Cox1p, Cox2p, and Cox3p), three subunits of the ATP synthase (Atp6p, Atp8p, and Atp9p), a subunit of the ubiquinol-cytochrome c oxidoreductase enzyme, cytochrome b (Cytb), and mitochondrial ribosomal protein Var1p. The purpose of the method described here is to specifically label these proteins with 35S methionine, separate them by electrophoresis and visualize the signals as discrete bands on the screen. The procedure involves several steps. First, yeast cells are cultured in a galactose-containing medium until they reach the late logarithmic growth stage. Next, cycloheximide treatment blocks cytoplasmic translation and allows 35S methionine incorporation only in mitochondrial translation products. Then, all proteins are extracted from yeast cells and separated by polyacrylamide gel electrophoresis. Finally, the gel is dried and incubated with the storage phosphor screen. The screen is scanned on a phosphorimager revealing the bands. The method can be applied to compare the biosynthesis rate of a single polypeptide in the mitochondria of a mutant yeast strain versus the wild type, which is useful for studying mitochondrial gene expression defects. This protocol gives valuable information about the translation rate of all yeast mitochondrial mRNAs. However, it requires several controls and additional experiments to make proper conclusions.

Labelling and Visualization of Mitochondrial Genome Expression Products in Baker's Yeast Saccharomyces cerevisiae

Baker&#8217;s yeast mitochondrial genome encodes eight polypeptides. The goal of the current protocol is to label all of them and subsequently visualize them as separate bands.

Mitochondria are essential organelles of eukaryotic cells capable of aerobic respiration. They contain circular genome and gene expression apparatus. A ...

Quantitative Metabolomics of Saccharomyces Cerevisiae Using Liquid Chromatography Coupled with Tandem Mass Spectrometry

Metabolomics is a methodology used for the identification and quantification of many low-molecular-weight intermediates and products of metabolism within a cell, tissue, organ, biological fluid, or organism. Metabolomics traditionally focuses on water-soluble metabolites. The water-soluble metabolome is the final product of a complex cellular network that integrates various genomic, epigenomic, transcriptomic, proteomic, and environmental factors. Hence, the metabolomic analysis directly assesses the outcome of the action for all these factors in a plethora of biological processes within various organisms. One of these organisms is the budding yeast Saccharomyces cerevisiae, a unicellular eukaryote with the fully sequenced genome. Because S. cerevisiae is amenable to comprehensive molecular analyses, it is used as a model for dissecting mechanisms underlying many biological processes within the eukaryotic cell. A versatile analytical method for the robust, sensitive, and accurate quantitative assessment of the water-soluble metabolome would provide the essential methodology for dissecting these mechanisms. Here we present a protocol for the optimized conditions of metabolic activity quenching in and water-soluble metabolite extraction from S. cerevisiae cells. The protocol also describes the use of liquid chromatography coupled with tandem mass spectrometry (LC-MS/MS) for the quantitative analysis of the extracted water-soluble metabolites. The LC-MS/MS method of non-targeted metabolomics described here is versatile and robust. It enables the identification and quantification of more than 370 water-soluble metabolites with diverse structural, physical, and chemical properties, including different structural isomers and stereoisomeric forms of these metabolites. These metabolites include various energy carrier molecules, nucleotides, amino acids, monosaccharides, intermediates of glycolysis, and tricarboxylic cycle intermediates. The LC-MS/MS method of non-targeted metabolomics is sensitive and allows the identification and quantitation of some water-soluble metabolites at concentrations as low as 0.05 pmol/&#181;L. The method has been successfully used for assessing water-soluble metabolomes of wild-type and mutant yeast cells cultured under different conditions.

Quantitative Metabolomics of Saccharomyces Cerevisiae Using Liquid Chromatography Coupled with Tandem Mass Spectrometry

We present a protocol for the identification and quantitation of major classes of water-soluble metabolites in the yeast Saccharomyces cerevisiae. The described method is versatile, robust, and sensitive. It allows the separation of structural isomers and stereoisomeric forms of water-soluble metabolites from each other.

Metabolomics is a methodology used for the identification and quantification of many low-molecular-weight intermediates and products of metabolism within ...

Analysis of Neutral Lipid Synthesis in Saccharomyces cerevisiae by Metabolic Labeling and Thin Layer Chromatography

Neutral lipids (NLs) are a class of hydrophobic, chargeless biomolecules that play key roles in energy and lipid homeostasis. NLs are synthesized de novo&#160;from acetyl-CoA and are primarily present in eukaryotes in the form of triglycerides (TGs) and sterol-esters (SEs). The enzymes responsible for the synthesis of NLs are highly conserved from Saccharomyces cerevisiae (yeast) to humans, making yeast a useful model organism to dissect the function and regulation of NL metabolism enzymes. While much is known about how acetyl-CoA is converted into a diverse set of NL species, mechanisms for regulating NL metabolism enzymes, and how mis-regulation can contribute to cellular pathologies, are still being discovered. Numerous methods for the isolation and characterization of NL species have been developed and used over decades of research; however, a quantitative and simple protocol for the comprehensive characterization of major NL species has not been discussed. Here, a simple and adaptable method to quantify the de novo&#160;synthesis of major NL species in yeast is presented. We apply 14C-acetic acid metabolic labeling coupled with thin layer chromatography to separate and quantify a diverse range of physiologically important NLs. Additionally, this method can be easily applied to study in vivo reaction rates of NL enzymes or degradation of NL species over time.

Analysis of Neutral Lipid Synthesis in Saccharomyces cerevisiae by Metabolic Labeling and Thin Layer Chromatography

Here, a protocol is presented for the metabolic labeling of yeast with 14C-acetic acid, which is coupled with thin layer chromatography for the separation of neutral lipids.

Neutral lipids (NLs) are a class of hydrophobic, chargeless biomolecules that play key roles in energy and lipid homeostasis. NLs are synthesized de ...