We wish to acknowledge the labs in the C. elegans community who developed and shared the tools and whose work is cited in this manuscript. Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). This work was supported by a Canadian Institutes of Health Research (CIHR) Project grant to A.L.S. (PJT-175245). C.L. is supported by a Natural Sciences and Engineering Research Council of Canada (NSERC) postgraduate scholarship (PGS-D).

Epigenetic Inheritance and ChIP in Caenorhabditis elegans

<ol>
	<li>Alcazar, R. M., Lin, R., Fire, A. Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transmission+dynamics+of+heritable+silencing+induced+by+double-stranded+RNA+in+Caenorhabditis+elegans.">Transmission dynamics of heritable silencing induced by double-stranded RNA in Caenorhabditis elegans.</a> Genetics. 180 (3), 1275-1288 (2008).</li><li>Ashe, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=piRNAs+can+trigger+a+multigenerational+epigenetic+memory+in+the+germline+of+C.+elegans.">piRNAs can trigger a multigenerational epigenetic memory in the germline of C. elegans.</a> Cell. 150 (1), 88-99 (2012).</li><li>Buckley, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+nuclear+Argonaute+promotes+multigenerational+epigenetic+inheritance+and+germline+immortality.">A nuclear Argonaute promotes multigenerational epigenetic inheritance and germline immortality.</a> Nature. 489 (7416), 447-451 (2012).</li><li>Vastenhouw, N. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+gene+silencing+by+RNAi.">Long-term gene silencing by RNAi.</a> Nature. 442 (7105), 882 (2006).</li><li>Lee, H. -. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=C.+elegans+piRNAs+mediate+the+genome-wide+surveillance+of+germline+transcripts.">C. elegans piRNAs mediate the genome-wide surveillance of germline transcripts.</a> Cell. 150 (1), 78-87 (2012).</li><li>Luteijn, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extremely+stable+Piwi-induced+gene+silencing+in+Caenorhabditis+elegans.">Extremely stable Piwi-induced gene silencing in Caenorhabditis elegans.</a> The EMBO Journal. 31 (16), 3422-3430 (2012).</li><li>Sapetschnig, A., Sarkies, P., Lehrbach, N. J., Miska, E. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tertiary+siRNAs+mediate+paramutation+in+C.+elegans.">Tertiary siRNAs mediate paramutation in C. elegans.</a> PLoS Genetics. 11 (3), e1005078 (2015).</li><li>Shirayama, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=piRNAs+initiate+an+epigenetic+memory+of+nonself+RNA+in+the+C.+elegans+germline.">piRNAs initiate an epigenetic memory of nonself RNA in the C. elegans germline.</a> Cell. 150 (1), 65-77 (2012).</li><li>Minkina, O., Hunter, C. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable+heritable+germline+silencing+directs+somatic+silencing+at+an+endogenous+locus.">Stable heritable germline silencing directs somatic silencing at an endogenous locus.</a> Molecular Cell. 65 (4), 659-670 (2017).</li><li>Seroussi, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+of+epigenetic+regulation+by+C.+elegans+nuclear+RNA+interference+pathways.">Mechanisms of epigenetic regulation by C. elegans nuclear RNA interference pathways.</a> Seminars in Cell &amp; Developmental Biology. 127, 142-154 (2022).</li><li>Lev, I., Gingold, H., Rechavi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=H3K9me3+is+required+for+inheritance+of+small+RNAs+that+target+a+unique+subset+of+newly+evolved+genes.">H3K9me3 is required for inheritance of small RNAs that target a unique subset of newly evolved genes.</a> eLife. 8, e40448 (2019).</li><li>Woodhouse, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+modifiers+SET-25+and+SET-32+are+required+for+establishment+but+not+long-term+maintenance+of+transgenerational+epigenetic+inheritance.">Chromatin modifiers SET-25 and SET-32 are required for establishment but not long-term maintenance of transgenerational epigenetic inheritance.</a> Cell Reports. 25 (8), 2259-2272 (2018).</li><li>Houri-Zeevi, L., Teichman, G., Gingold, H., Rechavi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stress+resets+ancestral+heritable+small+RNA+responses.">Stress resets ancestral heritable small RNA responses.</a> eLife. 10, e65797 (2021).</li><li>Houri-Ze'evi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+tunable+mechanism+determines+the+duration+of+the+transgenerational+small+RNA+inheritance+in+C.+elegans.">A tunable mechanism determines the duration of the transgenerational small RNA inheritance in C. elegans.</a> Cell. 165 (1), 88-99 (2016).</li><li>Spracklin, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+RNAi+inheritance+machinery+of+Caenorhabditis+elegans.">The RNAi inheritance machinery of Caenorhabditis elegans.</a> Genetics. 206 (3), 1403-1416 (2017).</li><li>Perales, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transgenerational+epigenetic+inheritance+is+negatively+regulated+by+the+HERI-1+chromodomain+protein.">Transgenerational epigenetic inheritance is negatively regulated by the HERI-1 chromodomain protein.</a> Genetics. 210 (4), 1287-1299 (2018).</li><li>Shukla, A., Perales, R., Kennedy, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=piRNAs+coordinate+poly(UG)+tailing+to+prevent+aberrant+and+perpetual+gene+silencing.">piRNAs coordinate poly(UG) tailing to prevent aberrant and perpetual gene silencing.</a> Current Biology. 31 (20), 4473-4485 (2021).</li><li>Ahringer, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reverse+GeneticsWormBook:+the+Online+Review+of+C.+elegans+Biology.">Reverse GeneticsWormBook: the Online Review of C. elegans Biology.</a> WormBook. , (2006).</li><li>Rivera Gomez, K., Schvarzstein, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immobilization+of+nematodes+for+live+imaging+using+an+agarose+pad+produced+with+a+Vinyl+Record.">Immobilization of nematodes for live imaging using an agarose pad produced with a Vinyl Record.</a> microPublication Biology. 2018, (2018).</li><li>Stiernagle, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maintenance+of+C.+elegans.">Maintenance of C. elegans.</a> WormBook: The Online Review of C. Elegans Biology. , 1-11 (2006).</li><li>Askjaer, P., Ercan, S., Meister, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modern+techniques+for+the+analysis+of+chromatin+and+nuclear+organization+in+C.+elegans.">Modern techniques for the analysis of chromatin and nuclear organization in C. elegans.</a> WormBook: the Online Review of C. elegans Biology. , 1-35 (2014).</li><li>Gu, S. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amplification+of+siRNA+in+Caenorhabditis+elegans+generates+a+transgenerational+sequence-targeted+histone+H3+lysine+9+methylation+footprint.">Amplification of siRNA in Caenorhabditis elegans generates a transgenerational sequence-targeted histone H3 lysine 9 methylation footprint.</a> Nature Genetics. 44 (2), 157-164 (2012).</li><li>Kalinava, N., Ni, J. Z., Peterman, K., Chen, E., Gu, S. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Decoupling+the+downstream+effects+of+germline+nuclear+RNAi+reveals+that+H3K9me3+is+dispensable+for+heritable+RNAi+and+the+maintenance+of+endogenous+siRNA-mediated+transcriptional+silencing+in+Caenorhabditis+elegans.">Decoupling the downstream effects of germline nuclear RNAi reveals that H3K9me3 is dispensable for heritable RNAi and the maintenance of endogenous siRNA-mediated transcriptional silencing in Caenorhabditis elegans.</a> Epigenetics &amp; Chromatin. 10, 6 (2017).</li><li>Kalinava, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=elegans+heterochromatin+factor+SET-32+plays+an+essential+role+in+transgenerational+establishment+of+nuclear+RNAi-mediated+epigenetic+silencing.">elegans heterochromatin factor SET-32 plays an essential role in transgenerational establishment of nuclear RNAi-mediated epigenetic silencing.</a> Cell Reports. 25 (8), 2273-2284 (2018).</li><li>Lev, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MET-2-dependent+H3K9+methylation+suppresses+transgenerational+small+RNA+inheritance.">MET-2-dependent H3K9 methylation suppresses transgenerational small RNA inheritance.</a> Current Biology. 27 (8), 1138-1147 (2017).</li><li>Kamath, R. S., Martinez-Campos, M., Zipperlen, P., Fraser, A. G., Ahringer, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effectiveness+of+specific+RNA-mediated+interference+through+ingested+double-stranded+RNA+in+Caenorhabditis+elegans.">Effectiveness of specific RNA-mediated interference through ingested double-stranded RNA in Caenorhabditis elegans.</a> Genome Biology. 2 (1), (2001).</li><li>Xu, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cytoplasmic+Argonaute+protein+promotes+the+inheritance+of+RNAi.">A cytoplasmic Argonaute protein promotes the inheritance of RNAi.</a> Cell Reports. 23 (8), 2482-2494 (2018).</li><li>Grishok, A., Tabara, H., Mello, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+requirements+for+inheritance+of+RNAi+in+C.+elegans.">Genetic requirements for inheritance of RNAi in C. elegans.</a> Science. 287 (5462), 2494-2497 (2000).</li><li>Houri-Zeevi, L., Korem Kohanim, Y., Antonova, O., Rechavi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three+rules+explain+transgenerational+small+RNA+inheritance+in+C.+elegans.">Three rules explain transgenerational small RNA inheritance in C. elegans.</a> Cell. 182 (5), 1186-1197 (2020).</li><li>Burton, N. O., Burkhart, K. B., Kennedy, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nuclear+RNAi+maintains+heritable+gene+silencing+in+Caenorhabditis+elegans.">Nuclear RNAi maintains heritable gene silencing in Caenorhabditis elegans.</a> Proceedings of the National Academy of Sciences. 108 (49), 19683-19688 (2011).</li><li>Mao, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Nrde+pathway+mediates+small-RNA-directed+histone+H3+lysine+27+trimethylation+in+Caenorhabditis+elegans.">The Nrde pathway mediates small-RNA-directed histone H3 lysine 27 trimethylation in Caenorhabditis elegans.</a> Current Biology. 25 (18), 2398-2403 (2015).</li><li>Landt, S. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq+guidelines+and+practices+of+the+ENCODE+and+modENCODE+consortia.">ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia.</a> Genome Research. 22 (9), 1813-1831 (2012).</li><li>Mukhopadhyay, A., Deplancke, B., Walhout, A. J. M., Tissenbaum, H. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+immunoprecipitation+(ChIP)+coupled+to+detection+by+quantitative+real-time+PCR+to+study+transcription+factor+binding+to+DNA+in+Caenorhabditis+elegans.">Chromatin immunoprecipitation (ChIP) coupled to detection by quantitative real-time PCR to study transcription factor binding to DNA in Caenorhabditis elegans.</a> Nature Protocols. 3 (4), 698-709 (2008).</li></ol>

All authors confirm that they do not have any conflicts to disclose.

In this protocol, dsRNA is introduced by feeding, which has become a standard method in C. elegans18. For RNAi inheritance assays, the feeding approach provides an easy method to obtain a large P0&#160;population2,11,12,22,23,24,25. However, the timing and duration of RNAi exposure affects the efficacy of transgene silencing26, and the concentration of RNAi bacteria affects the persistence of heritable RNAi silencing1. Therefore, standardized RNAi bacteria and worm growth are important to obtain a consistent level of GFP silencing and duration of inheritance. Here, embryos are plated on RNAi plates so that P0 animals are exposed to RNAi bacteria from hatching. Alternative approaches have plated synchronized L124,27 or L425 stage animals onto RNAi-NGM plates. In addition, since starvation and other stresses affect the maintenance of RNAi inheritance13, plates must be monitored to prevent overcrowding and exhaustion of the food supply. As an alternative to initiating RNAi by feeding, some of the pioneer C. elegans RNAi inheritance studies induced RNAi through gonad injection, which provides a greater control of dsRNA concentration1,28.
In this protocol, each generation is passaged as a population with alkaline hypochlorite treatment, as previously described16,22,23,24. Hypochlorite treatment ensures the F1 generation will not be contaminated with RNAi bacteria from the parental environment22 and prevents potential undesired population bottle-necking. However, bulk passaging may also be a limitation, since individual animals may have distinct inheritance patterns1,29. An alternative method to establish each generation is to select individual animals1,2,9,11,25. This approach allows for tracking phenotypes within lineages and the incorporation of genetic crosses. Lineage analysis may also be advantageous for low penetrance phenotypes12.
Fluorescent protein expression is a powerful and convenient readout of RNAi-induced silencing2,3,4,12,14,15,16,25,30. As described in this protocol, GFP expression can be manually scored as ON or OFF11,12,15,16,25. Manual scoring can be further refined by assigning qualitative intensity levels3,4,14. Alternatively, automated intensity scoring of microscopy images11,12,14,25,27 or flow cytometry fluorescence measurement of live animals2 can provide a quantitative and high-throughput readout. However, since the reporter expression is restricted to the germline, a caveat of automated approaches is that they must also differentiate between animals with silenced GFP expression versus animals with no germline, especially if the study incorporates mutants with abnormal germline development. As an alternative to GFP fluorescence, reverse transcription (RT)-qPCR can be used to quantify RNAi target pre-mRNA and mRNA levels2,16,23,24. This approach provides a more direct readout of silencing, which targets RNA, and is especially useful for other RNAi targets where silencing does not produce a visible phenotype. A limitation of using artificial GFP reporters is that exogenous and endogenous sequences are differentially regulated in transgenerational RNAi11. Studies with endogenous targets, such as the temperature-sensitive embryonic lethal allele oma-1(zu405)1,11,16,25, should therefore be considered as a complementary approach to fluorescent transgene reporters.
The analysis of ChIP in the context of RNAi inheritance assays requires comparison between treatments and replicates. First, to account for differences in starting material between samples, the ChIP signal is normalized to Input signal at the same locus as the &#39;percentage of Input&#39;. Processing a histone H3 ChIP in parallel will help to determine whether any histone modification alterations correspond with changes in nucleosome density. In addition, because ChIP is a multi-step process, the efficiency may vary between samples. The selection of appropriate positive and negative control loci is useful to evaluate and compare the signal-to-noise ratio among samples and experiments. In addition, to facilitate comparisons between samples, the ChIP DNA qPCR threshold cycle values at the RNAi target are often normalized to a control locus3,11,15,23,30,31. To evaluate the effects of the RNAi treatment, the ratio of the ChIP signal in treatment RNAi versus control or no RNAi conditions is also compared. A limitation of the current approach is that ChIP is performed with whole animals, while the response to RNAi treatment may be unique to the germline. An approach to overcome this caveat is to perform ChIP using isolated germline nuclei. Additional technical considerations for optimizing ChIP have also been discussed extensively elsewhere32,33.
Overall, this RNAi inheritance and ChIP protocol provides a detailed and easy-to-adapt foundation that can be integrated with other techniques to further explore transgenerational epigenetic regulation. For example, high throughput sequencing libraries can be constructed from the ChIP DNA (ChIP-seq) for a more detailed view of the chromatin landscape both proximal to the RNAi target and on a genome-wide scale.

Epigenetic inheritance allows the transmission of gene regulatory information across generations and can therefore allow the environment or experiences of parents to affect their progeny. In C. elegans, germline gene silencing initiated by exogenous double-stranded RNA (dsRNA) can be inherited for multiple generations in progeny not exposed to the original trigger1,2,3,4. This process, termed RNA interference (RNAi) inheritance, is one of several related epigenetic silencing phenomena in C. elegans, including piRNA-initiated multigenerational silencing2,5, paramutation/RNAe (RNA-induced epigenetic silencing)6,7,8, and multicopy array-initiated silencing9, which have overlapping but distinct requirements for small RNA and chromatin regulation machinery. In C. elegans exogenous RNAi, dsRNA is processed into small interfering RNAs (siRNAs) that act in a complex with primary Argonaute proteins to recognize their target mRNA. This targeting leads to the amplification of secondary siRNAs that associate with secondary Argonautes to silence target mRNA through both cytoplasmic and nuclear silencing pathways. For germline-expressed RNAi targets, the nuclear secondary Argonaute HRDE-1 and additional nuclear RNAi factors target nascent transcripts, resulting in transcriptional repression and recruitment of histone methyltransferases to deposit repressive chromatin marks, including H3K9me310. Histone H3K9me3 promotes the establishment of heritable silencing of germline-expressed green fluorescent protein (GFP) transgenes by RNAi inheritance11,12.
The goal of this protocol is to use a transgene expressing a GFP-histone fusion protein in the germline as a reporter for RNAi inheritance and to assay changes in histone modifications at the reporter transgene locus using chromatin immunoprecipitation and quantitative polymerase chain reaction (ChIP-qPCR). This protocol describes a standardized plate-based RNAi feeding approach to initiate reporter silencing. It also provides a detailed timeline for passaging animals between generations by isolating in utero embryos from gravid adults by alkaline hypochlorite treatment (&#39;bleaching&#39;). Methods and representative data for monitoring the frequency of GFP silencing in a subset of the population by fluorescence microscopy and for histone H3K9me3 ChIP-qPCR are also described. Reporter-based RNAi inheritance assays provide a highly tractable system to functionally dissect the roles of genetic and environmental factors in epigenetic regulation13,14, and genetic screens using such reporters have identified both genes that are required for2,3,15 and genes that negatively regulate16,17 the duration of transgenerational epigenetic inheritance.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Agarose</td>
			<td>Bioshop</td>
			<td>AGA002</td>
			<td></td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Bioshop</td>
			<td>AMP201</td>
			<td>Make a 100 mg/mL solution in ultrapure water. Filter-sterilize and store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Anti-H3K9me3 Rabbit Polyclonal Antibody</td>
			<td>Abcam</td>
			<td>ab8898</td>
			<td>Concentration is batch-dependent (0.9 - 1 mg/mL).</td>
		</tr>
		<tr>
			<td>Anti-Histone H3 Rabbit Polyclonal Antibody</td>
			<td>Abcam</td>
			<td>ab1791</td>
			<td>Concentration is batch-dependent (0.7 - 1 mg/mL).</td>
		</tr>
		<tr>
			<td>Bleach (6% Sodium hypochlorite)</td>
			<td>Lavo</td>
			<td>02358107</td>
			<td></td>
		</tr>
		<tr>
			<td>C. elegans strain with GFP RNAi Reporter</td>
			<td>NA</td>
			<td>SX1263</td>
			<td>Sapetschnig et al. 2015 (ref. 7). A gift from E. Miska lab, University of Cambridge.</td>
		</tr>
		<tr>
			<td>Carbenicillin</td>
			<td>BioShop</td>
			<td>CAR544</td>
			<td>Make a 25 mg/mL solution in ultrapure water. Filter-sterilize and store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Dynabeads Protein G Magnetic Beads</td>
			<td>Invitrogen</td>
			<td>10003D</td>
			<td></td>
		</tr>
		<tr>
			<td>E. coli strain HT115(DE3)</td>
			<td>Caenorhabditis Genetics Center (CGC)</td>
			<td>HT115(DE3)</td>
			<td></td>
		</tr>
		<tr>
			<td>E. coli strain OP50-1</td>
			<td>Caenorhabditis Genetics Center (CGC)</td>
			<td>OP50-1</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA (0.5 M, pH 8.0)</td>
			<td>Invitrogen</td>
			<td>15575020</td>
			<td></td>
		</tr>
		<tr>
			<td>Fluorescence Stereoscope</td>
			<td>Zeiss</td>
			<td>Axio Zoom.V16</td>
			<td></td>
		</tr>
		<tr>
			<td>Formaldehyde (37%)</td>
			<td>Sigma</td>
			<td>F8775</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycine</td>
			<td>Sigma</td>
			<td>50046</td>
			<td>Make a 1.25 M solution and store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>HEPES-KOH (1 M, pH 7.5)</td>
			<td>Teknova</td>
			<td>H1035</td>
			<td></td>
		</tr>
		<tr>
			<td>Hydrophobic Printed Slides, 10 wells</td>
			<td>VWR</td>
			<td>100488-904</td>
			<td></td>
		</tr>
		<tr>
			<td>IGEPAL CA-630 (Octylphenol ethoxylate)</td>
			<td>BioShop</td>
			<td>NON999</td>
			<td>Make a 10% (v/v) solution in ultrapure water and store at room temperature.</td>
		</tr>
		<tr>
			<td>IPTG (Isopropyl-&#946;-D-thiogalactoside)</td>
			<td>BioShop</td>
			<td>IPT001</td>
			<td>Make a 0.2 g/mL solution in ultrapure water. Filter-sterilize and store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>iTaq Universal SYBR Green Supermix</td>
			<td>Bio-Rad</td>
			<td>1725122</td>
			<td></td>
		</tr>
		<tr>
			<td>LB Agar Plates supplemented with 100 &#181;g/mL Ampicillin</td>
			<td>NA</td>
			<td>NA</td>
			<td>Standard lab recipe.</td>
		</tr>
		<tr>
			<td>Levamisole (Tetramisole hydrochloride)</td>
			<td>Sigma</td>
			<td>L9756</td>
			<td>Make a 200 mM solution in ultrapure water. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>LiCl (8 M)</td>
			<td>Sigma</td>
			<td>L7026</td>
			<td></td>
		</tr>
		<tr>
			<td>M9 Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>22 mM KH2PO4, 42 mM Na2HPO4, 86 mM NaCl, 1 mM MgSO4.</td>
		</tr>
		<tr>
			<td>Magnetic Separator (1.5 mL tubes)</td>
			<td>Applied Biosystems</td>
			<td>A13346</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnetic Separator (0.2 mL tubes)</td>
			<td>Permagen</td>
			<td>MSR812</td>
			<td></td>
		</tr>
		<tr>
			<td>Microscope Cover Glass</td>
			<td>Fisher Scientific</td>
			<td>12541B</td>
			<td></td>
		</tr>
		<tr>
			<td>Microscope Slide</td>
			<td>Technologist Choice</td>
			<td>LAB-037</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl (5 M)</td>
			<td>Promega</td>
			<td>V4221</td>
			<td>For ChIP buffers.</td>
		</tr>
		<tr>
			<td>NaOH&#160;</td>
			<td>Sigma</td>
			<td>S5881</td>
			<td>Make a 10 M solution and store at room temperature.</td>
		</tr>
		<tr>
			<td>NGM Plates</td>
			<td>NA</td>
			<td>NA</td>
			<td>1.7% (w/v) agar, 0.3% (w/v) NaCl, 0.25% (w/v) peptone, 1 mM CaCl2, 5 &#956;g/mL cholesterol, 25 mM Potassium phosphate pH 6.0, 1 mM MgSO4, 50 &#181;g/mL streptomycin.</td>
		</tr>
		<tr>
			<td>Normal Rabbit IgG (1 mg/mL)</td>
			<td>Cell Signaling Technology</td>
			<td>2729</td>
			<td></td>
		</tr>
		<tr>
			<td>Petri Dishes (35 mm x 10 mm)</td>
			<td>Sarstedt</td>
			<td>82.1135.500</td>
			<td></td>
		</tr>
		<tr>
			<td>Phosphate Buffered Saline (10X)</td>
			<td>Fisher BioReagents</td>
			<td>BP3991</td>
			<td></td>
		</tr>
		<tr>
			<td>Plasmid - Control RNAi&#160;</td>
			<td>Addgene</td>
			<td>L4440 (Plasmid #1654)</td>
			<td></td>
		</tr>
		<tr>
			<td>Plasmid - GFP-targetting RNAi&#160;</td>
			<td>Addgene</td>
			<td>L4417 (Plasmid #1649)</td>
			<td>Note, alternative L4440-derived plasmids targeting GFP can be used.</td>
		</tr>
		<tr>
			<td>Primer pair [-3.3 kb upstream of gfp]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: AAACCAAAGGACGAGAGATTCA, R: GGCTCGATCAAGTAAAATTTCG</td>
		</tr>
		<tr>
			<td>Primer pair [+1.3 kb downstream of gfp]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: TCGACCAGTTCTAAAGTCACCG, R: ACGTGCGGGATCATTTCTTACT</td>
		</tr>
		<tr>
			<td>Primer pair [clec-18]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: TGCTCCATGACCTCAACAACA, R: AGTACAGTTCACCGATCCAGA</td>
		</tr>
		<tr>
			<td>Primer pair [gfp exon 1]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: CTGGAGTTGTCCCAATTCTTGT, R: GGGTAAGTTTTCCGTATGTTGC</td>
		</tr>
		<tr>
			<td>Primer pair [gfp exon 4]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: GATGGCCCTGTCCTTTTACCA, R: ATGCCATGTGTAATCCCAGCA</td>
		</tr>
		<tr>
			<td>Primer pair [hrp-2]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: CGTCAACAGGGAGCAGCTG, R: CCTCCGAACTTTCTCTGTCCA</td>
		</tr>
		<tr>
			<td>Protease Inhibitor Cocktail Tablet</td>
			<td>Roche</td>
			<td>11836170001</td>
			<td></td>
		</tr>
		<tr>
			<td>Proteinase K&#160;</td>
			<td>Bioline</td>
			<td>BIO-37084</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAquick PCR Purification Kit&#160;</td>
			<td>Qiagen</td>
			<td>28104</td>
			<td></td>
		</tr>
		<tr>
			<td>Real-Time PCR Detection System</td>
			<td>Bio-Rad</td>
			<td>CFX96&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAi-NGM plates</td>
			<td>NA</td>
			<td>NA</td>
			<td>1.7% (w/v) agar, 0.3% (w/v) NaCl, 0.25% (w/v) peptone, 1 mM CaCl2, 5 &#181;g/mL cholesterol, 25 mM Potassium phosphate buffer pH 6.0, 1 mM MgSO4, 25 &#181;g/mL carbenicillin and 5 mM IPTG.</td>
		</tr>
		<tr>
			<td>RNase A</td>
			<td>Sigma</td>
			<td>R4642</td>
			<td></td>
		</tr>
		<tr>
			<td>Sarkosyl (N-Lauroylsarcosine sodium salt)</td>
			<td>Sigma</td>
			<td>L5777</td>
			<td>Make a 10% (w/v) solution and store at room temperature protected from light for a maximum of 1 month.</td>
		</tr>
		<tr>
			<td>SDS</td>
			<td>Sigma</td>
			<td>74255</td>
			<td>Make a 10% (w/v) solution and store at room temperature.</td>
		</tr>
		<tr>
			<td>Sodium deoxycholate</td>
			<td>Sigma</td>
			<td>30970</td>
			<td>Make a 5% (w/v) solution and store at room temperature protected from light for a maximum of 1 month.</td>
		</tr>
		<tr>
			<td>Sonication Tube</td>
			<td>Evergreen</td>
			<td>214-3721-010</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonication Tube Cap</td>
			<td>Evergreen</td>
			<td>300-2911-020</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonicator</td>
			<td>Qsonica</td>
			<td>Q800R3-110</td>
			<td></td>
		</tr>
		<tr>
			<td>Streptomycin sulfate</td>
			<td>Bioshop</td>
			<td>STP101</td>
			<td>Make a 50 mg/mL solution in ultrapure water. Filter-sterilize and store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>TAE buffer (1X)</td>
			<td>NA</td>
			<td>NA</td>
			<td>40 mM Tris, 20 mM acetate, 1 mM EDTA</td>
		</tr>
		<tr>
			<td>Tally counter clicker</td>
			<td>Uline</td>
			<td>H-7350</td>
			<td></td>
		</tr>
		<tr>
			<td>Tetracycline</td>
			<td>Bioshop</td>
			<td>TET701</td>
			<td>Make a 5 mg/mL solution in ethanol and store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Thermomixer</td>
			<td>Eppendorf</td>
			<td>05-400-205</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris-HCl (1 M, pH 8.0)</td>
			<td>Invitrogen</td>
			<td>15568025</td>
			<td></td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma</td>
			<td>T8787</td>
			<td>Make a 10% (v/v) solution in ultrapure water and store at room temperature.</td>
		</tr>
	</tbody>
</table>

analysis of transgenerational epigenetic inheritance in c. elegans using a fluorescent reporter and chromatin immunoprecipitation (chip)

Transgenerational epigenetic inheritance (TEI) allows the transmission of information through the germline without changing the genome sequence, through factors such as non-coding RNAs and chromatin modifications. The phenomenon of RNA interference (RNAi) inheritance in the nematode Caenorhabditis elegans is an effective model to investigate TEI that takes advantage of this model organism's short life cycle, self-propagation, and transparency. In RNAi inheritance, exposure of animals to RNAi leads to gene silencing and altered chromatin signatures at the target locus that persist for multiple generations in the absence of the initial trigger. This protocol describes the analysis of RNAi inheritance in C. elegans using a germline-expressed nuclear green fluorescent protein (GFP) reporter. Reporter silencing is initiated by feeding the animals bacteria expressing double-stranded RNA targeting GFP. At each generation, animals are passaged to maintain synchronized development, and reporter gene silencing is determined by microscopy. At select generations, populations are collected and processed for chromatin immunoprecipitation (ChIP)-quantitative polymerase chain reaction (qPCR) to measure histone modification enrichment at the GFP reporter locus. This protocol for studying RNAi inheritance can be easily modified and combined with other analyses to further investigate TEI factors in small RNA and chromatin pathways.

Animals carrying the germline-expressed GFP-histone H2B [mex-5p::gfp-h2b::tbb-2 3&#39;UTR]7 reporter (Figure 2A) were exposed to GFP RNAi or control RNAi by feeding, and passaged as described in the protocol and Figure 1. Nuclear GFP signal in the germline was manually scored using a fluorescence dissecting microscope for a sample of the population at each generation. Silencing of the transgene was fully penetrant in the scored P0 and F1 animals treated with GFP RNAi (Figure 2B). In the F2 generation, the proportion of the population exhibiting inheritance of GFP silencing was approximately 50%. By the F5 generation, the majority of the population did not show inheritance of silencing, and by the F10 generation, no inheritance was detected, as all the animals expressed GFP.
To determine the change in histone H3K9me3 enrichment corresponding to RNAi-induced silencing, ChIP-qPCR was performed on F1 generation animals following either GFP RNAi or control RNAi treatment. As expected, the GFP RNAi-treated population displayed higher histone H3K9me3 levels at the GFP target and at the 1.3 kb downstream region compared to control RNAi-treated animals (Figure 2C). The specificity of the histone H3K9me3 ChIP is supported by the enrichment at a positive control locus (clec-18) known to be enriched in this mark, but not at a nearby negative control locus (hrp-2). Histone H3 enrichment and near-background enrichment in the IgG control immunoprecipitations were also detected at all qPCR loci, as expected. When ChIP enrichment at the reporter is normalized to the clec-18 positive control locus, higher histone H3K9me3 enrichment upon GFP RNAi is shown, whereas histone H3 enrichment is similar between the control and GFP RNAi treatments (Figure 2D). Since GFP RNAi is not expected to affect histone H3K9me3 or total histone H3 occupancy at the clec-18 locus, this normalization mitigates against technical variation, such as differences in ChIP efficiency between the GFP RNAi and control RNAi samples. The fold-change of histone H3K9me3 and histone H3 levels between RNAi treatments shows GFP reporter-specific histone H3K9me3 enrichment, independent of histone occupancy, upon GFP RNAi-induced silencing (Figure 2E).
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/65285/65285fig02.jpg" /> 
Figure 2: GFP RNAi-induced silencing corresponds to elevated H3K9me3 enrichment at the RNAi target. (A) Diagram of the germline-expressed GFP RNAi reporter mjIs134[mex-5p::gfp-h2b::tbb-2 3&#39;UTR] with qPCR amplicon regions labelled. (B) GFP expression scored across generations after RNAi treatments at 21 &#176;C. Error bars represent the standard deviation from two biological replicates. (C) ChIP-qPCR of H3K9me3, histone H3, and IgG control in F1 young adults from two biological replicates. clec-18 and hrp-2 are the positive and negative control loci for H3K9me3 enrichment, respectively. (D) H3K9me3 and histone H3 enrichment at the GFP RNAi reporter normalized to the clec-18 positive control locus. (E) Change in H3K9me3 and histone H3 enrichment between GFP RNAi- and control RNAi-treated animals, with normalization to clec-18. Dotted line represents a fold-change of 1. <a href="https://www.jove.com/files/ftp_upload/65285/65285fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about RNAi Inheritance and ChIP in C. elegans at JoVE.com

Author Spotlight: RNAi Inheritance and ChIP in C. elegans 

This protocol describes an RNA interference and ChIP assay to study the epigenetic inheritance of RNAi-induced silencing and associated chromatin modifications in C. elegans.

Analysis of Transgenerational Epigenetic Inheritance in C. elegans Using a Fluorescent Reporter and Chromatin Immunoprecipitation (ChIP)

Transgenerational epigenetic inheritance (TEI) allows the transmission of information through the germline without changing the genome sequence, through ...

analysis-transgenerational-epigenetic-inheritance-c-elegans-using

Research

JoVE Journal

Genetics

3.6K Views.  University of Toronto. This protocol describes an RNA interference and ChIP assay to study the epigenetic inheritance of RNAi-induced silencing and associated chromatin modifications in C. elegans. 

Video: Author Spotlight: RNAi Inheritance and ChIP in C. elegans 

Optogenetic Random Mutagenesis Using Histone-miniSOG in C. elegans

Forward genetic screening in model organisms is the workhorse to discover functionally important genes and pathways in many biological processes. In most mutagenesis-based screens, researchers have relied on the use of toxic chemicals, carcinogens, or irradiation, which requires designated equipment, safety setup, and/or disposal of hazardous materials. We have developed a simple approach to induce heritable mutations in C. elegans using germline-expressed histone-miniSOG, a light-inducible potent generator of reactive oxygen species. This mutagenesis method is free of toxic chemicals and requires minimal laboratory safety and waste management. The induced DNA modifications include single-nucleotide changes and small deletions, and complement those caused by classical chemical mutagenesis. This methodology can also be used to induce integration of extrachromosomal transgenes. Here, we provide the details of the LED setup and protocols for standard mutagenesis and transgene integration.

Optogenetic Random Mutagenesis Using Histone-miniSOG in C. elegans

Genetically-encoded histone-miniSOG induces genome-wide heritable mutations in a blue&#160;light-dependent manner. This mutagenesis method is simple, fast, free of toxic chemicals, and well-suited for forward genetic screening and transgene integration.

Forward genetic screening in model organisms is the workhorse to discover functionally important genes and pathways in many biological processes. In most ...

Sequential Salt Extractions for the Analysis of Bulk Chromatin Binding Properties of Chromatin Modifying Complexes

Elucidation of the binding properties of chromatin-targeting proteins can be very challenging due to the complex nature of chromatin and the heterogeneous nature of most mammalian chromatin-modifying complexes. In order to overcome these hurdles, we have adapted a sequential salt extraction (SSE) assay for evaluating the relative binding affinities of chromatin-bound complexes. This easy and straightforward assay can be used by non-experts to evaluate the relative difference in binding affinity of two related complexes, the changes in affinity of a complex when a subunit is lost or an individual domain is inactivated, and the change in binding affinity after alterations to the chromatin landscape. By sequentially re-suspending bulk chromatin in increasing amounts of salt, we are able to profile the elution of a particular protein from chromatin. Using these profiles, we are able to determine how alterations in a chromatin-modifying complex or alterations to the chromatin environment affect binding interactions. Coupling SSE with other in vitro and in vivo assays, we can determine the roles of individual domains and proteins on the functionality of a complex in a variety of chromatin environments.

Sequential salt extraction of chromatin bound proteins is a useful tool for determining the binding properties of large protein complexes. This method can be employed to evaluate the role of individual subunits or domains in the overall affinity of a protein complex to bulk chromatin.

Elucidation of the binding properties of chromatin-targeting proteins can be very challenging due to the complex nature of chromatin and the heterogeneous ...

Analysis of the c-KIT Ligand Promoter Using Chromatin Immunoprecipitation

Multiple cellular processes, including DNA replication and repair, DNA recombination, and gene expression, require interactions between proteins and DNA. Therefore, DNA-protein interactions regulate multiple physiological, pathophysiological, and biological functions, such as cell differentiation, cell proliferation, cell cycle control, chromosome stability, epigenetic gene regulation, and cell transformation. In eukaryotic cells, the DNA interacts with histone and nonhistone proteins and is condensed into chromatin. Several technical tools can be used to analyze DNA-protein interactions, such as the Electrophoresis (gel) Mobility Shift Assay (EMSA) and DNase I footprinting. However, these techniques analyze the protein-DNA interaction in vitro, not within the cellular context. Chromatin immunoprecipitation (ChIP) is a technique that captures proteins at their specific DNA binding sites, thereby allowing for the identification of DNA-protein interactions within their chromatin context. It is done by fixation&#160;of the DNA-protein interaction, followed by&#160;immunoprecipitation of the protein of interest. Subsequently, the genomic site that the protein was bound to is characterized. Here, we describe and discuss ChIP and demonstrate its analytical value for the identification of the Transforming Growth Factor-&#946; (TGF-&#946;)-induced binding of the transcription factor SMAD2 to SMAD Binding Elements (SBE) within the promoter region of the tyrosine-protein kinase Kit (c-KIT) receptor ligand Stem Cell Factor (SCF).

DNA-protein interactions are essential for multiple biological processes. During the evaluation of cellular functions, the analysis of DNA-protein interactions is indispensable for understanding gene regulation. Chromatin immunoprecipitation (ChIP) is a powerful tool to analyze such interactions in vivo.

Multiple cellular processes, including DNA replication and repair, DNA recombination, and gene expression, require interactions between proteins and DNA. ...

Chromatin Immunoprecipitation (ChIP) in Mouse T-cell Lines

Signaling pathways regulate gene expression programs via the modulation of the chromatin structure at different levels, such as by post-translational modifications (PTMs) of histone tails, the exchange of canonical histones with histone variants, and nucleosome eviction. Such regulation requires the binding of signal-sensitive transcription factors (TFs) that recruit chromatin-modifying enzymes at regulatory elements defined as enhancers. Understanding how signaling cascades regulate enhancer activity requires a comprehensive analysis of the binding of TFs, chromatin modifying enzymes, and the occupancy of specific histone marks and histone variants. Chromatin immunoprecipitation (ChIP) assays utilize highly specific antibodies to immunoprecipitate specific protein/DNA complexes. The subsequent analysis of the purified DNA allows for the identification the region occupied by the protein recognized by the antibody. This work describes a protocol to efficiently perform ChIP of histone proteins in a mature mouse T-cell line. The presented protocol allows for the performance of ChIP assays in a reasonable timeframe and with high reproducibility.

Chromatin Immunoprecipitation ChIP in Mouse T-cell Lines

This work describes a protocol for chromatin immunoprecipitation (ChIP) using a mature mouse T-cell line. This protocol is suitable to investigate the distribution of specific histone marks at specific promoter sites or genome-wide.

Signaling pathways regulate gene expression programs via the modulation of the chromatin structure at different levels, such as by post-translational ...

Generation of Native Chromatin Immunoprecipitation Sequencing Libraries for Nucleosome Density Analysis

We present a modified native chromatin immunoprecipitation sequencing (ChIP-seq) experimental protocol compatible with a Gaussian mixture distribution based analysis methodology (nucleosome density ChIP-seq; ndChIP-seq) that enables the generation of combined measurements of micrococcal nuclease (MNase) accessibility with histone modification genome-wide. Nucleosome position and local density, and the posttranslational modification of their histone subunits, act in concert to regulate local transcription states. Combinatorial measurements of nucleosome accessibility with histone modification generated by ndChIP-seq allows for the simultaneous interrogation of these features. The ndChIP-seq methodology is applicable to small numbers of primary cells inaccessible to cross-linking based ChIP-seq protocols. Taken together, ndChIP-seq enables the measurement of histone modification in combination with local nucleosome density to obtain new insights into shared mechanisms that regulate RNA transcription within rare primary cell populations.

We present a modified native chromatin immunoprecipitation sequencing (ChIP-seq) methodology for the generation of sequence datasets suitable for a nucleosome density ChIP-seq analytical framework integrating micrococcal nuclease (MNase) accessibility with histone modification measurements.

We present a modified native chromatin immunoprecipitation sequencing (ChIP-seq) experimental protocol compatible with a Gaussian mixture distribution ...

Chromatin Immunoprecipitation (ChIP) Protocol for Low-abundance Embryonic Samples

Chromatin immunoprecipitation (ChIP) is a widely-used technique for mapping the localization of post-translationally modified histones, histone variants, transcription factors, or chromatin-modifying enzymes at a given locus or on a genome-wide scale. The combination of ChIP assays with next-generation sequencing (i.e., ChIP-Seq) is a powerful approach to globally uncover gene regulatory networks and to improve the functional annotation of genomes, especially of non-coding regulatory sequences. ChIP protocols normally require large amounts of cellular material, thus precluding the applicability of this method to investigating rare cell types or small tissue biopsies. In order to make the ChIP assay compatible with the amount of biological material that can typically be obtained in vivo during early vertebrate embryogenesis, we describe here a simplified ChIP protocol in which the number of steps required to complete the assay were reduced to minimize sample loss. This ChIP protocol has been successfully used to investigate different histone modifications in various embryonic chicken and adult mouse tissues using low to medium cell numbers (5 x 104 - 5 x 105 cells). Importantly, this protocol is compatible with ChIP-seq technology using standard library preparation methods, thus providing global epigenomic maps in highly relevant embryonic tissues.

Chromatin Immunoprecipitation ChIP Protocol for Low-abundance Embryonic Samples

Here, we describe a chromatin immunoprecipitation (ChIP) and ChIP-seq library preparation protocol to generate global epigenomic profiles from low-abundance chicken embryonic samples.

Chromatin immunoprecipitation (ChIP) is a widely-used technique for mapping the localization of post-translationally modified histones, histone variants, ...

Chromatin Immunoprecipitation (ChIP) of Histone Modifications from Saccharomyces cerevisiae

Histone post-translational modifications (PTMs), such as acetylation, methylation and phosphorylation, are dynamically regulated by a series of enzymes that add or remove these marks in response to signals received by the cell. These PTMS are key contributors to the regulation of processes such as gene expression control and DNA repair. Chromatin immunoprecipitation (chIP) has been an instrumental approach for dissecting the abundance and localization of many histone PTMs throughout the genome in response to diverse perturbations to the cell. Here, a versatile method for performing chIP of post-translationally modified histones from the budding yeast Saccharomyces cerevisiae (S. cerevisiae) is described. This method relies on crosslinking of proteins and DNA using formaldehyde treatment of yeast cultures, generation of yeast lysates by bead beating, solubilization of chromatin fragments by micrococcal nuclease, and immunoprecipitation of histone-DNA complexes. DNA associated with the histone mark of interest is purified and subjected to quantitative PCR analysis to evaluate its enrichment at multiple loci throughout the genome. Representative experiments probing the localization of the histone marks H3K4me2 and H4K16ac in wildtype and mutant yeast are discussed to demonstrate data analysis and interpretation. This method is suitable for a variety of histone PTMs and can be performed with different mutant strains or in the presence of diverse environmental stresses, making it an excellent tool for investigating changes in chromatin dynamics under different conditions.

Chromatin Immunoprecipitation ChIP of Histone Modifications from Saccharomyces cerevisiae

Here, we describe a protocol for chromatin immunoprecipitation of modified histones from the budding yeast Saccharomyces cerevisiae. Immunoprecipitated DNA is subsequently used for quantitative PCR to interrogate the abundance and localization of histone post-translational modifications throughout the genome.

Histone post-translational modifications (PTMs), such as acetylation, methylation and phosphorylation, are dynamically regulated by a series of enzymes ...

A Rapid and Facile Pipeline for Generating Genomic Point Mutants in C. elegans Using CRISPR/Cas9 Ribonucleoproteins

The clustered regularly interspersed palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) prokaryotic adaptive immune defense system has been co-opted as a powerful tool for precise eukaryotic genome engineering. Here, we present a rapid and simple method using chimeric single guide RNAs (sgRNA) and CRISPR-Cas9 Ribonucleoproteins (RNPs) for the efficient and precise generation of genomic point mutations in C. elegans. We describe a pipeline for sgRNA target selection, homology-directed repair (HDR) template design, CRISPR-Cas9-RNP complexing and delivery, and a genotyping strategy that enables the robust and rapid identification of correctly edited animals. Our approach not only permits the facile generation and identification of desired genomic point mutant animals, but also facilitates the detection of other complex indel alleles in approximately 4 - 5 days with high efficiency and a reduced screening workload.

A Rapid and Facile Pipeline for Generating Genomic Point Mutants in C. elegans Using CRISPR/Cas9 Ribonucleoproteins

Here, we present a method to engineer the genome of C. elegans using CRISPR-Cas9 ribonucleoproteins and homology dependent repair templates.

The clustered regularly interspersed palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) prokaryotic adaptive immune defense system has been ...

Chromatin Immunoprecipitation of Murine Brown Adipose Tissue

Most cellular processes are regulated by transcriptional modulation of specific gene programs. Such modulation is achieved through the combined actions of a wide range of transcription factors (TFs) and cofactors mediating transcriptional activation or repression via changes in chromatin structure. Chromatin immunoprecipitation (ChIP) is a useful molecular biology approach for mapping histone modifications and profiling transcription factors/cofactors binding to DNA, thus providing a snapshot of the dynamic nuclear changes occurring during different biological processes.
To study transcriptional regulation in adipose tissue, samples derived from in vitro cell cultures of immortalized or primary cell lines are often favored in ChIP assays because of the abundance of starting material and reduced biological variability. However, these models represent a limited snapshot of the actual chromatin state in living organisms. Thus, there is a critical need for optimized protocols to perform ChIP on adipose tissue samples derived from animal models.
Here we describe a protocol for efficient ChIP-seq of both histone modifications and non-histone proteins in brown adipose tissue (BAT) isolated from a mouse. The protocol is optimized for investigating genome-wide localization of proteins of interest and epigenetic markers in the BAT, which is a morphologically and physiologically distinct tissue amongst fat depots.

Here we describe a protocol for efficient chromatin immunoprecipitation (ChIP) followed by high-throughput DNA sequencing (ChIP-seq) of brown adipose tissue (BAT) isolated from a mouse. This protocol is suitable for both mapping histone modifications and investigating genome-wide localization of non-histone proteins of interest in vivo.

Most cellular processes are regulated by transcriptional modulation of specific gene programs. Such modulation is achieved through the combined actions of ...

Chromatin Immunoprecipitation Assay Using Micrococcal Nucleases in Mammalian Cells

To express cellular phenotypes in organisms, living cells execute gene expression accordingly, and transcriptional programs play a central role in gene expression. The cellular transcriptional machinery and its chromatin modification proteins coordinate to regulate transcription. To analyze transcriptional regulation at the molecular level, several experimental methods such as electrophoretic mobility shift, transient reporter and chromatin immunoprecipitation (ChIP) assays are available. We describe a modified ChIP assay in detail in this article because of its advantages in directly showing histone modifications and the interactions between proteins and DNA in cells. One of the key steps in a successful ChIP assay is chromatin shearing. Although sonication is commonly used for shearing chromatin, it is difficult to identify reproducible conditions. Instead of shearing chromatin by sonication, we utilized enzymatic digestion with micrococcal nuclease (MNase) to obtain more reproducible results. In this article, we provide a straightforward ChIP assay protocol using MNase.

Chromatin immunoprecipitation (ChIP) is a powerful tool for understanding the molecular mechanisms of gene regulation. However, the method involves difficulties in obtaining reproducible chromatin fragmentation by mechanical shearing. Here, we provide an improved protocol for a ChIP assay using enzymatic digestion.

To express cellular phenotypes in organisms, living cells execute gene expression accordingly, and transcriptional programs play a central role in gene ...