This work was supported by the US Defense Advanced Research Projects Agency contract N66001-12-C-4039 to Y.S., a grant from the Alfred P. Sloan Foundation to R.S.L., and US National Institutes of Health grants R01 HG003224 and R21 CA130266 to F.P.R. F.P.R. was also supported by a fellowship from the Canadian Institute for Advanced Research and by the Canada Excellence Research Chairs program.

1. Generation of ProMonsters
<ol>
	<li>Prepare the universal GFP replacement cassette by amplifying a tetO2-GFP marker and the URA3 marker from the plasmid pYOGM012 (ampicillin resistance) using primers with sequences: 
	GGATCCCCGGGTTAATTAAGGCGCGCCAGATCTGTTTAGCTTGCCCAAGCTCCTCGAGTAATTCG and GGCGTTAGTATCGAATCGACAGCAGTATAGCGACCAGCATTCACGTACCGGGTAATAACTGATATAAT (bolded regions provide homology to the flanking regions of the KanMX4 cassette allowing targeted replacement). The PCR reaction should be carried out with Phusion polymerase, HF buffer, and 3% dimethyl sulfoxide (New England BioLabs) starting with the template DNA concentration of 0.5 ng/&mu;l. The PCR program is 98 &deg;C for 30 sec and 35 cycles of 98 &deg;C for 10 sec, 49 &deg;C for 30 sec, and 72 &deg;C for 1.5 min. The reaction volume should be &gt; 50 &mu;l to provide enough DNA for each transformation experiment. We purify the product using a QIAquick PCR purification kit (Qiagen) with ~50 &mu;l of the PCR reaction processed per column, but skipping the purification step may increase the yield of transformants. 
	Alternatively, release a fragment containing the tetO2-GFP and URA3 markers, as well as homologous regions for KanMX4 targeting, by digesting the plasmid pYOGM057 (ampicillin resistance) using the restriction enzyme EcoRI (New England BioLabs). The DNA concentration in this reaction should be ~30 ng/&mu;l. The reaction volume should be &gt; 34 &mu;l. 
	For integrating the GFP cassette into a region other than KanMX4, adjust the homology region of the PCR primers above to the appropriate homologous sequences.</li>
	<li>Transform an a-haploid strain from the KanMX4 yeast knockout collection12 with the universal GFP deletion cassette. Following the protocol by Woods and Gietz13 .34 &mu;l of the DNA sample (purified PCR product or non-purified restriction digest) should be used for each transformation experiment. Plate one fifth of the transformation mixture onto a CAA-Ura plate (0.67% yeast nitrogen base, 2% glucose, 0.6% casamino acid, 0.0025% adenine hemisulfate, 0.005% tryptophan, and 2% agar).</li>
	<li>Streak out the transformants on a fresh CAA-Ura plate to obtain isolated colonies.</li>
	<li>Transfer cells from a colony onto a YPDA plate containing 200 &mu;g/ml G418 to confirm the lack of growth. To confirm successful GFP integration, follow the steps (1.5) - (1.9) to perform colony PCR.</li>
	<li>Add cells taken from a colony into 2 &mu;l of lysis buffer (0.1 M sodium phosphate, pH 7.4, 1 unit zymolyase from ZymoResearch) in a 0.2-ml PCR tube or a well of a 96-well plate. Mix by pipetting the solution in and out of a pipette tip.</li>
	<li>Overlay with one drop (roughly 20 &mu;l) of mineral oil using a P200 Pipetman (Gilson).</li>
	<li>Incubate the mixture at 37 &deg;C for 20 min and then at 95 &deg;C for 10 min.</li>
	<li>Dilute the lysate with 50 &mu;l water. Mix by pipetting the solution in and out ten times.</li>
	<li>Analyze 1 &mu;l of the lysate using 10-&mu;l PCR reactions with (A) a forward primer that anneals to the upstream flanking region paired with a primer of the sequence CCTGAGAAAGCAACCTGACC (285 bp from the beginning of the cassette), (B) a reverse primer that anneals to the downstream region paired with a primer of the sequence GCATTGGGTCAACAGTATAG (375 bp from the end), (C) two primers that anneal to KanMX4 with the sequences CGTACTCCTGATGATGCATG and GACGAAATACGCGATCGCTG (181 bp), and (D) two primers that anneal to the wild-type sequence of the targeted gene (Figure 4). (D) is important because about 8% of the strains in the deletion collections are known to contain aneuploidy14. A correct transformant should be positive with (A) and (B), and negative with (C) and (D).</li>
	<li>To introduce a GMToolkit into the transformant, add roughly 250,000 cells from the transformed strain and 250,000 cells of either RY0146 (containing GMToolkit-a) or RY0148 (containing GMToolkit-&alpha;) into a 1.6-ml Eppendorf tube. Vortex. The genotypes of RY0146 and RY0148 are MAT&alpha; lyp1&Delta; his3&Delta;1 leu2&Delta;0 ura3&Delta;0 met15&Delta;0 can1&Delta;::GMToolkit-a [CMVpr-rtTA KanMX4 STE2pr-Sp-his5] and MAT&alpha; lyp1&Delta; his3&Delta;1 leu2&Delta;0 ura3&Delta;0 met15&Delta;0 can1&Delta;::GMToolkit-&alpha; [CMVpr-rtTA NatMX4 STE3pr-LEU2], respectively. pr denotes promoter. Cell number should be estimated from optical density of the preceding culture.</li>
	<li>Centrifuge at 800 x g for 2 min.</li>
	<li>Remove the supernatant.</li>
	<li>To allow for air exchange, make a hole on the lid using a pushpin treated with 70% ethanol.</li>
	<li>Add 50 &mu;l of YPDA medium (1% yeast extract, 2% peptone, 2% glucose, and 0.003% adenine hemisulfate). Vortex.</li>
	<li>Centrifuge at 800 x g for 5 min.</li>
	<li>Place the tube in a damp box. This can be created with an empty tip box, a small tip stand, and a wet paper towel.</li>
	<li>Incubate the box overnight at 30 &deg;C.</li>
	<li>Select mated diploids by first streaking out the cells on a CAA-Ura plate. Incubate the plate at 30 &deg;C for one day.</li>
	<li>Taking cells from the bulk area, streak them out to make isolated colonies on YPDA plates (1% yeast extract, 2% peptone, 2% glucose, 0.003% adenine hemisulfate, and 2% agar) containing 200 &mu;g/ml G418 for selecting diploids containing GMToolkit-a or 100 &mu;g/ml nourseothricin (Nat)15 for selecting diploids containing GMToolkit-&alpha;.</li>
	<li>Incubate the plate at 30 &deg;C for 3 days.</li>
	<li>Starting from an isolated colony, transfer most of the cells to 500 &mu;l of GNA medium without agar (1% yeast extract, 3% Difco nutrient broth, and 5% glucose; autoclave glucose and the rest of the components separately as 2&times; solutions to avoid caramelization) in a 5-ml culture tube with the lid loosened.</li>
	<li>Rotate the tube horizontally for five hours at 30 &deg;C. The axis of the rotation needs to be parallel to the longitudinal axis of the tube.</li>
	<li>Confirm that colonies used in (1.21) are Ura+ by streaking them out on a CAA-Ura plate.</li>
	<li>Centrifuge the tube at 800 x g for 2 min. Discard the supernatant.</li>
	<li>Add 500 &mu;l of minimal sporulation medium (1% potassium acetate, 0.005% zinc acetate; filter-sterilize). Vortex.</li>
	<li>Centrifuge the tube at 800 x g for 2 min. Discard the supernatant.</li>
	<li>Repeat (1.25) - (1.26) twice.</li>
	<li>Add 1 ml of minimal sporulation medium supplemented with 7.5 &mu;g/ml lysine, 7.5 &mu;g/ml leucine, 5 &mu;g/ml histidine, 5 &mu;g/ml methionine, and 1.25 &mu;g/ml uracil (to enhance the sporulation rate of the auxotrophic strains). Vortex.</li>
	<li>Rotate the tube at room temperature for one day.</li>
	<li>Rotate the tube at 30 &deg;C for 2 days.</li>
	<li>Centrifuge 125 &mu;l of this mixture in a 1.6-ml Eppendorf tube at 800 x g for 2 min. Discard the supernatant.</li>
	<li>Add 50 &mu;l of zymolyase solution (100 mM sodium phosphate buffer, pH 7.4, 1 M sorbitol, and 2 units zymolyase from ZymoResearch). Mix by pipetting the solution in and out of a pipette tip.</li>
	<li>Incubate at 30 &deg;C for 1 hr.</li>
	<li>Add 50 &mu;l of 0.02% NP-40. Mix by pipetting the solution in and out of a pipette tip.</li>
	<li>Leave the tube at room temperature for five minutes.</li>
	<li>Add 500 &mu;l of water.</li>
	<li>Place the tube on ice.</li>
	<li>Sonicate this mixture twice at the output setting of 1 (weakest setting) for 15 sec using a 3.2-mm microtip with Sonifier 450 (Branson). Between the two rounds of sonication, put the tube on ice to return the temperature to ~0 &deg;C.</li>
	<li>Centrifuge the tubes at 800 x g for 5 min. Discard the supernatant.</li>
	<li>Add 200 &mu;l of SC-Ura-His (a) or SC-Ura-Leu (&alpha;) medium, depending on whether the cross is for incorporating GMToolkit-a or GMToolkit-&alpha;. To prepare the media, make SC-Ura-His-Leu medium (0.67% yeast nitrogen base, 2% glucose, 0.01% arginine, 0.01% aspartic acid, 0.01% glutamic acid, 0.01% isoleucine, 0.01% lysine, 0.01% methionine, 0.01% phenylalanine, 0.08% serine, 0.04% threonine, 0.002% tyrosine, 0.03% valine, 0.0025% adenine, 0.005% tryptophan, 0.003% adenine, and 0.005% tryptophan) and supplement it with sterile histidine or leucine before use to the final concentration of 0.01%.</li>
	<li>Make a hole on the lid using a pushpin treated with 70% ethanol.</li>
	<li>Rotate the tube horizontally at 30 &deg;C for 2 days. The axis of the rotation needs to be parallel to the longitudinal axis of the tube.</li>
	<li>Streak out the cells on a SC-Ura-His or SC-Ura-Leu agar plate (the same ingredients as above plus 2% agar; threonine and aspartic acid must be added after autoclaving; add histidine or leucine before pouring) to make isolated colonies for the ProMonster strains.</li>
</ol>
2. Sexual Cycling
<ol>
	<li>Rotate a culture of an established GFP deletion strain in 100 &mu;l of SC-His (a) or SC-Leu (&alpha;) depending on mating type at 30 &deg;C overnight using a 1.6-ml Eppendorf tube. For air exchange, make a hole using a pushpin treated with 70% ethanol. Rotate the tube horizontally. The axis of the rotation needs to be parallel to the longitudinal axis of the tube. It is possible to cross multiple strains via en masse mating. When a sorted sample is directly used for this purpose, culture the cells in 200 &mu;l at 30 &deg;C for 2 days. To prepare the medium, add uracil (final concentration: 0.0025%) and histidine (0.01%) or leucine (0.01%) to SC-Ura-His-Leu medium.</li>
	<li>Mix 250,000 a-haploid cells and 250,000 &alpha;-haploid cells of GFP deletion strains in a 1.6-ml Eppendorf tube. Vortex.</li>
	<li>Mate these cells by following steps (1.11) - (1.17).</li>
	<li>Transfer 10 &mu;l of the mating mixture to 500 &mu;l GNA medium containing 200 &mu;g/ml G418 and 100 &mu;g/ml Nat in a 5-ml culture tube with a loosened lid. The starting OD600 is roughly 0.1.</li>
	<li>Rotate the culture at 30 &deg;C for 24 hr. This allows for the selection of diploids because only diploids containing both KanMX4 in GMToolkit-a and NatMX4 in GMToolkit-&alpha; can grow in the presence of G418 and Nat (Figure 3).</li>
	<li>Transfer 20 &mu;l of the one-day culture to 500 &mu;l of fresh GNA containing G418 and Nat. The starting OD600 is roughly 0.2.</li>
	<li>Rotate the tube at 30 &deg;C for 5 hr to bring cells to the log phase (OD600 of ~1).</li>
	<li>Follow the steps (1.24)-(1.38) to sporulate the diploids and isolate spores.</li>
	<li>Split the suspension of sporulated cells into two 300-&mu;l parts and put each into a separate 1.5-ml Eppendorf tube.</li>
	<li>Centrifuge the tubes at 800 x g for 5 min. Discard the supernatant.</li>
	<li>To the pellet of one tube, add 100 &mu;l of SC-His medium to select a-haploids. To the pellet of the other tube, add 100 &mu;l of SC-Leu medium to select &alpha;-haploids.</li>
	<li>Rotate the tubes at 30 &deg;C overnight. The final OD600 should be less than 0.5. If OD600 tends to be too high, try culturing at room temperature.</li>
	<li>To induce GFP, add 100 &mu;l of fresh SC-His (a) or SC-Leu (&alpha;) medium containing 20 &mu;g/ml doxycycline. The final concentration of doxycycline is 10 &mu;g/ml. Vortex.</li>
	<li>Rotate the tubes at 30 &deg;C for 2 days.</li>
</ol>
3. Flow Cytometry
<ol>
	<li>Add 900 &mu;l of pre-filtered TE buffer (pH 7.5) containing 10 &mu;g/ml doxycycline to a 5-ml polypropylene tube (BD Falcon #352063) with the cap swapped with a cell-strainer cap from a 5-ml polystyrene tube (BD Falcon #352235). Polypropylene tubes are suitable for flow cytometry. The strainer cap is desired for removing large particles.</li>
	<li>Gently place 75 &mu;l of TE buffer with doxycycline on the cell-strainer cap.</li>
	<li>Add 25 &mu;l of the induced cells to the solution on the cap.</li>
	<li>While pressing the tip of Pipetman against the mesh, shoot all of the combined solution through the strainer.</li>
	<li>Press down the strainer cap and vortex the tube.</li>
	<li>Prepare collection tubes (1.6-ml Eppendorf tubes) filled with 200 &mu;l of SC-His or SC-Leu.</li>
	<li>Start the cell sorter and adjust settings according to the manufacturer manual.</li>
	<li>Vortex both the collection tube (to coat the wall with the medium) and the tube containing cells before loading them onto the cell sorter.</li>
	<li>Acquire flow cytometry data of the sample. A strain not containing GFP can be a negative control.</li>
	<li>Draw gates for sorting. (A) To avoid cell aggregates, which could exhibit high GFP intensity, discard outliers with disproportionately large pulse width for forward scatter (FSC) using a plot of pulse width and pulse height for MoFlo sorter or disproportionately small FSC height using a plot of FSC height and FSC area for FACSAria sorter (Figure 5, top-left panel). (B) Since large FSC (area) is expected for cell aggregates, only take cells in the lower 20% in FSC, while avoiding regions with the lowest FSC and side scatter (SSC) values where cell debris is often found (Figure 5, top-right panel). (C) SSC (area) and GFP signal (area) are often positively correlated. Because simply taking the brightest cells given the gates above would also enrich for cells with a high SSC value, draw a gate along the periphery of the population using a plot of GFP intensity and SSC to take a similar percentage of the brightest cells from each point of the SSC axis (Figure 5, bottom-left diagram). The population selected in (C) should be 0.1-1% of the population selected in (B).</li>
	<li>Sort 200 cells into the collection tube given the criteria in (3.10). For an en masse process or for other projects requiring a more complex population, sort more cells as needed.</li>
	<li>Vortex the collection tube to cover the sorted cells with medium.</li>
	<li>Plate a subset of cells (for example, 50 cells) on a YPDA plate for genotyping.</li>
	<li>Incubate the plate at 30 &deg;C for 2 days.</li>
	<li>Make a lysate for ~12 colonies following the steps (1.5) - (1.8).</li>
	<li>Transfer the residual cells on the tip used in (1.5) to a spot on a YPDA plate containing G418 and Nat by gently touching the plate with the tip. Selected haploids should not grow on this plate. Diploids may have more GFP copies and may therefore be brighter. This test can show the efficiency of haploid selection.</li>
	<li>For genotyping, analyze 1 &mu;l of the lysate using a 10-&mu;l PCR reaction with a forward primer that anneals to the upstream flanking region of each deleted gene paired with a primer of the sequence CCTGAGAAAGCAACCTGACC. 
	Multiplex PCR reactions if possible (conditions can be determined using lysates of single mutants). PCR can be done in a 96- or 384-well format. The latter format is suitable for the reaction volume of as little as 5 &mu;l. Arraying of PCR master mixes differing in primers and addition of cell lysates to these mixes can be carried out using a multi-channel pipette or a liquid handling robot. Tip changes are optional when adding the same lysate to different PCR mixes.</li>
	<li>Analyze PCR products. The Gel XL Ultra V-2 electrophoresis system (Labnet) is compatible with sample loading using multi-channel pipettes.</li>
	<li>Based on information from (3.16) and (3.18), identify likely haploids that have desired genotypes.</li>
	<li>Establish these strains on a fresh plate (YPDA, CAA-Ura, or SC-Ura-His/Leu). Also, freeze them in 25% glycerol at -80 &deg;C. Additional tests such as confirmation of the absence of wild-type sequences for deleted genes and pulsed-field gel electrophoresis are recommended.</li>
	<li>Repeat sexual cycling from (2.1) with useful strains.</li>
</ol>

<ol>
	<li>Tong, A. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+genetic+analysis+with+ordered+arrays+of+yeast+deletion+mutants.">Systematic genetic analysis with ordered arrays of yeast deletion mutants.</a> Science's STKE. 294, 2364-23 (2001).</li><li>Hillenmeyer, M. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+chemical+genomic+portrait+of+yeast:+uncovering+a+phenotype+for+all+genes.">The chemical genomic portrait of yeast: uncovering a phenotype for all genes.</a> Science. 320, 362-365 (2008).</li><li>Beh, C. T., Cool, L., Phillips, J., Rine, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overlapping+functions+of+the+yeast+oxysterol-binding+protein+homologues.">Overlapping functions of the yeast oxysterol-binding protein homologues.</a> Genetics. 157, 1117 (2001).</li><li>Wieczorke, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Concurrent+knock-out+of+at+least+20+transporter+genes+is+required+to+block+uptake+of+hexoses+in+Saccharomyces+cerevisiae.">Concurrent knock-out of at least 20 transporter genes is required to block uptake of hexoses in Saccharomyces cerevisiae.</a> FEBS letters. 464, 123-128 (1999).</li><li>Alani, E., Cao, L., Kleckner, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+method+for+gene+disruption+that+allows+repeated+use+of+URA3+selection+in+the+construction+of+multiply+disrupted+yeast+strains.">A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains.</a> Genetics. 116, 541-545 (1987).</li><li>Akada, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR-mediated+seamless+gene+deletion+and+marker+recycling+in+Saccharomyces+cerevisiae.">PCR-mediated seamless gene deletion and marker recycling in Saccharomyces cerevisiae.</a> Yeast. 23, 399-405 (2006).</li><li>Guldener, U., Heck, S., Fielder, T., Beinhauer, J., Hegemann, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+efficient+gene+disruption+cassette+for+repeated+use+in+budding+yeast.">A new efficient gene disruption cassette for repeated use in budding yeast.</a> Nucleic acids research. 24, 2519 (1996).</li><li>Delneri, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+redundancy+in+the+yeast+genome:+an+improved+strategy+for+use+of+the+cre-loxP+system.">Exploring redundancy in the yeast genome: an improved strategy for use of the cre-loxP system.</a> Gene. 252, 127-135 (2000).</li><li>Storici, F., Lewis, L. K., Resnick, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+site-directed+mutagenesis+using+oligonucleotides.">In vivo site-directed mutagenesis using oligonucleotides.</a> Nat. Biotech. 19, 773-776 (2001).</li><li>Noskov, V. N., Segall-Shapiro, T. H., Chuang, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tandem+repeat+coupled+with+endonuclease+cleavage+(TREC):+a+seamless+modification+tool+for+genome+engineering+in+yeast.">Tandem repeat coupled with endonuclease cleavage (TREC): a seamless modification tool for genome engineering in yeast.</a> Nucl. Acids Res. 38, 2570-2576 (2010).</li><li>Suzuki, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Knocking+out+multigene+redundancies+via+cycles+of+sexual+assortment+and+fluorescence+selection.">Knocking out multigene redundancies via cycles of sexual assortment and fluorescence selection.</a> Nat. Methods. 8, 159-164 (2011).</li><li>Winzeler, E. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+Characterization+of+the+S.+Genome+by+Gene+Deletion+and+Parallel+Analysis.">Functional Characterization of the S. Genome by Gene Deletion and Parallel Analysis.</a> Science. 285, 901-906 (1999).</li><li>Woods, R. A., Gietz, R. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-efficiency+transformation+of+plasmid+DNA+into+yeast.">High-efficiency transformation of plasmid DNA into yeast.</a> Methods Mol. Biol. 177, 85-97 (2001).</li><li>Hughes, T. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Widespread+aneuploidy+revealed+by+DNA+microarray+expression+profiling.">Widespread aneuploidy revealed by DNA microarray expression profiling.</a> Nature. 25, 333-337 (2000).</li><li>Goldstein, A. L., McCusker, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three+new+dominant+drug+resistance+cassettes+for+gene+disruption+in+Saccharomyces+cerevisiae.">Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae.</a> Yeast. 15, 1541-1553 (1999).</li><li>Newman, J. R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+proteomic+analysis+of+S.+cerevisiae+reveals+the+architecture+of+biological+noise.">Single-cell proteomic analysis of S. cerevisiae reveals the architecture of biological noise.</a> Nature. 441, 840-846 (2006).</li><li>Rosenfeld, N., Young, J. W., Alon, U., Swain, P. S., Elowitz, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+regulation+at+the+single-cell+level.">Gene regulation at the single-cell level.</a> Science. 307, 1962 (2005).</li></ol>

No conflicts of interest declared.

As we developed the Green Monster approach, we were concerned with the possibility of recombination between different GFP replacement cassettes, leading to genome rearrangement. Mitigating against this possibility is our selection for cells that have successfully undergone multiple rounds of mating and meiosis. Cells bearing rearranged genomes are expected to be less fit after mating to cells without an identical rearrangement. Indeed, we did not observe any genome instability resulting from recombination betwe...

<table border="1">
 <tbody>
 <tr>
 <td>Name of the reagent or instrument</td>
 <td>Company</td>
 <td>Catalogue number</td>
 <td>Comments (optional)</td>
 </tr>
 <tr>
 <td>G418</td>
 <td>Sigma-Aldrich</td>
 <td>A1720</td>
 <td>Dissolve in water and filter-sterilize (0.2-&mu;m filter). Stock concentration: 200 mg/ml. Store at 4 &deg;C.</td>
 </tr>
 <tr>
 <td>ClonNAT (nourseothricin)</td>
 <td>WERNER BioAgents</td>
 <td>5001000</td>
 <td>Dissolve in water and filter-sterilize (0.2-&mu;m filter). Stock concentration: 100 mg/ml. Store at 4 &deg;C.</td>
 </tr>
 <tr>
 <td>Doxycycline</td>
 <td>Sigma-Aldrich</td>
 <td>D9891</td>
 <td>Dissolve in 50% ethanol and filter-sterilize (0.2-&mu;m filter). Stock concentration: 10 mg/ml. Make fresh every four weeks. Shield from light using aluminum foil and store at 4 &deg;C. </td>
 </tr>
 <tr>
 <td>Zymolyase</td>
 <td>ZymoResearch</td>
 <td>E1005</td>
 <td></td>
 </tr>
 <tr>
 <td>Difco yeast nitrogen base w/o amino acids</td>
 <td>BD</td>
 <td>291940</td>
 <td></td>
 </tr>
 <tr>
 <td>Revolver (rotator for tubes)</td>
 <td>Labnet</td>
 <td>H5600</td>
 <td></td>
 </tr>
 <tr>
 <td>Enduro Gel XL electrophoresis unit</td>
 <td>Labnet</td>
 <td>E0160</td>
 <td></td>
 </tr>
 <tr>
 <td>Sonifier 450 </td>
 <td>Branson</td>
 <td>101-063-198</td>
 <td></td>
 </tr>
 <tr>
 <td>Microtip for Sonifier 450</td>
 <td>Branson</td>
 <td>101-148-062</td>
 <td></td>
 </tr>
 <tr>
 <td>FACSAria cell sorter</td>
 <td>BD</td>
 <td></td>
 <td></td>
 </tr>
 <tr>
 <td>MoFlo cell sorter</td>
 <td>Beckman-Coulter</td>
 <td></td>
 <td></td>
 </tr>
 <tr>
 <td>Biomek FX or equivalent robot </td>
 <td>Beckman Coulter</td>
 <td></td>
 <td>Optional. For setting up genotyping PCRs.</td>
 </tr>
 </tbody>
</table>

the green monster process for the generation of yeast strains carrying multiple gene deletions

Phenotypes for a gene deletion are often revealed only when the mutation is tested in a particular genetic background or environmental condition1,2. There are examples where many genes need to be deleted to unmask hidden gene functions3,4. Despite the potential for important discoveries, genetic interactions involving three or more genes are largely unexplored. Exhaustive searches of multi-mutant interactions would be impractical due to the sheer number of possible combinations of deletions. However, studies of selected sets of genes, such as sets of paralogs with a greater a priori chance of sharing a common function, would be informative.
In the yeast Saccharomyces cerevisiae, gene knockout is accomplished by replacing a gene with a selectable marker via homologous recombination. Because the number of markers is limited, methods have been developed for removing and reusing the same marker5,6,7,8,9,10. However, sequentially engineering multiple mutations using these methods is time-consuming because the time required scales linearly with the number of deletions to be generated.
Here we describe the Green Monster method for routinely engineering multiple deletions in yeast11. In this method, a green fluorescent protein (GFP) reporter integrated into deletions is used to quantitatively label strains according to the number of deletions contained in each strain (Figure 1). Repeated rounds of assortment of GFP-marked deletions via yeast mating and meiosis coupled with flow-cytometric enrichment of strains carrying more of these deletions lead to the accumulation of deletions in strains (Figure 2). Performing multiple processes in parallel, with each process incorporating one or more deletions per round, reduces the time required for strain construction.
The first step is to prepare haploid single-mutants termed 'ProMonsters,' each of which carries a GFP reporter in a deleted locus and one of the 'toolkit' loci&#x2014;either Green Monster GMToolkit-a or GMToolkit-&alpha; at the can1&Delta; locus (Figure 3). Using strains from the yeast deletion collection12, GFP-marked deletions can be conveniently generated by replacing the common KanMX4 cassette existing in these strains with a universal GFP-URA3 fragment. Each GMToolkit contains: either the a- or &alpha;-mating-type-specific haploid selection marker1 and exactly one of the two markers that, when both GMToolkits are present, collectively allow for selection of diploids.
The second step is to carry out the sexual cycling through which deletion loci can be combined within a single cell by the random assortment and/or meiotic recombination that accompanies each cycle of mating and sporulation.

When an a-haploid strain carrying four GFP-marked deletions (ycl033c&Delta; yer042w&Delta; ykl069w&Delta; yol118c&Delta;) was crossed with an &alpha;-haploid strain carrying four deletions (ycl033c&Delta; ydl242w&Delta; ydl227c&Delta; yer042w&Delta;), with two deletions (ycl033c&Delta; yer042w&Delta;) shared by two strains, a representative result was obtained. The mating mixture was cultured in YPDA medium containing G418 and Nat to select diploids. The resulting diploids were...

Watch this Scientific Journal Video about The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions at JoVE.com

The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions

The Green Monster method enables the rapid assembly of multiple deletions marked with a reporter gene encoding green fluorescent protein. This method is based on driving yeast strains through repeated cycles of sexual assortment of deletions and fluorescence-based enrichment of cells carrying more deletions.

Phenotypes  for a gene deletion are often revealed only when the mutation is tested in a  particular genetic background or environmental condition1,2. ...

the-green-monster-process-for-generation-yeast-strains-carrying

Research

JoVE Journal

Biology

14.2K Views.  J. Craig Venter Institute. The Green Monster method enables the rapid assembly of multiple deletions marked with a reporter gene encoding green fluorescent protein. This method is based on driving yeast strains through repeated cycles of sexual assortment of deletions and fluorescence-based enrichment of cells carrying more deletions.