Bu çalışma FPRFPR için YS, rsl Alfred P. Sloan Vakfı tarafından sağlanan hibe ve Sağlık hibe US National Institutes R01 HG003224 ve R21 CA130266 için ABD Savunma Bakanlığı İleri Araştırma Projeleri Ajansı sözleşme N66001-12-C-4039 tarafından desteklenen oldu Ayrıca İleri Araştırma Kanada Enstitüsü bir burs ile ve Kanada Mükemmellik Araştırma Sandalyeler program tarafından desteklenmektedir.

1. ProMonsters Üretimi <ol><li> Bir Teto 2-GFP işaretleyici ve dizileri ile primerler kullanılarak plazmid pYOGM012 (ampisilin direnci) dan URA3 işareti yükselterek evrensel GFP yedek kaset hazırlayın: GGATCCCCGGGTTAATTAAGGCGCGCCAGATCTGTTTAGCTTGCC CAAGCTCCTCGAGTAATTCG ve GGCGTTAGTATCGAATCGACAGCAGTATAGCGACCAGCATTCAC GTACCGGGTAATAACTGATATAAT (kalın bölgeler hedeflenen değiştirme sağlayarak KanMX4 kaset komşu bölgelere homoloji sağlamak). PCR reaksiyonu Phusion polimeraz, HF tampon, ve 0.5 ng / ml &#39;den, şablon DNA konsantrasyonu ile başlayarak% 3 dimetil sülfoksit (New England Biolabs) ile yapılmalıdır. PCR programı 98 10 sn 30 sn ve 98 ° C 35 döngüleri ° C, 49 ° 30 sn için C ve 1.5 dakika boyunca 72 ° C&#39;dir. Reaksiyon hacim, her bir deney için yeterli dönüşüm DNA sağlamak için&gt; 50 ul olmalıdır. Biz arındırmakSütun başına işlemden PCR reaksiyon ~ 50 ul ile bir QIAquick PCR saflaştırma kiti (Qiagen) kullanılarak, fakat saflaştırma adımı atlama ürün transformantlar verimini artırır. Alternatif olarak, kısıtlama enzimi EcoRI (New England Biolabs) kullanarak, plazmid pYOGM057 (ampisilin direnci) ile sindirerek, hedefleme Teto 2-GFP ve KanMX4 için homolog URA3 belirteçler, hem de bölgeler içeren bir parça serbest bırakın. Bu reaksiyon için DNA konsantrasyonu yaklaşık 30 ng / ul olması gerekir. Reaksiyon hacmi&gt; 34 ul olmalıdır. KanMX4 başka bir bölgeye GFP kaset entegre etmek için, uygun homolog dizileri yukarıdaki PCR primerleri, bir homoloji bölgesi ayarlayın. </li><li> Evrensel GFP silme kaset ile KanMX4 maya nakavt koleksiyonu 12 bir bir-haploid zorlanma Transform. Woods ve Gietz 13 .34 ul protokolü takibenDNA örneği (arıtılmış PCR ürünleri ya da non-saflaştırılmış kısıtlama digest) her bir deney için dönüşüm kullanılır. Levha bir CAA-Ura plaka üzerine dönüşüm karışımının beşincisi (% 0.67 maya azot baz,% 2 glikoz,% 0.6 casamino asit,% 0.0025 adenin hemisulfate,% 0.005 triptofan ve% 2 agar). </li><li> Izole koloniler elde etmek için taze CAA-Ura plaka transformantlar dışarı Streak. </li><li> Büyüme eksikliği teyit etmek için 200 ug / ml G418 içeren bir YPDA plaka üzerine bir koloniden hücre transfer edin. (1.9) koloni PCR işlemi gerçekleştirmek için - Başarılı GFP entegrasyonu onaylamak için, adımları (1.5) izleyin. </li><li> Bir 0.2-mL PCR tüp veya bir 96-kuyulu plakanın bir kuyu içinde lizis tamponu 2 ul (0.1 M sodyum fosfat, pH 7.4, ZymoResearch 1 birim zymolyase) içine bir koloniden alınan hücreler ekleyin. Bir pipet içinde ve dışında çözüm pipetleme karıştırın. </li><li> Bir P200 Pipetman (Gilson) kullanılarak mineral yağ, bir damla (yaklaşık 20 ul) ile Kaplama. </li><li> 37 ° karışımı inkübe95 dakika sonra 20 ° ve 10 dakika süreyle C&#39;de. </li><li> 50 ul su ile lizat seyreltin. On kez ve çözüm pipetleme karıştırın. </li><li> Yukan doğru komşu bölgeye anneals sıra CCTGAGAAAGCAACCTGACC (kaset başlangıcından itibaren 285 bp), bir astar ile eşleştirilmiş (A) bir ileri primer ile 10 ul PCR reaksiyonları kullanılarak lizat 1 ul, (B), bir ters analiz Astar, sıralı GCATTGGGTCAACAGTATAG (ucundan 375 bp), bir astar ile eşleştirilmiş aşağı bölge için anneals (C) iki dizileri CGTACTCCTGATGATGCATG ve (181 bp) ile GACGAAATACGCGATCGCTG KanMX4 için tavlama primerler, ve (D) iki primer ki hedef geni (Şekil 4) ve vahşi tip sıra ile tavlama. Silme koleksiyonlarında suşların yaklaşık% 8 anöploidi 14 içerdiği bilinmektedir, çünkü (D) çok önemlidir. Doğru bir transformant ile pozitif olması gerekir (A) ve (B), ve negatif ile (C) ve (D). </li><li> Bir tanıtmakTransformatant içine GMToolkit, bir 1.6 ml Eppendorf tüpüne dönüştürülmüş suşundan yaklaşık 250,000 hücre ve ya RY0146 (GMToolkit-a içeren) ya da RY0148 (GMToolkit-α içeren), 250.000 hücre ekleyin. Vortex. RY0146 ve RY0148 bir genotip olan MATα lyp1Δ his3Δ1 leu2Δ0 ura3Δ0 met15Δ0 can1Δ :: GMToolkit-a [CMVpr-rtTA KanMX4 STE2pr-SP-his5] ve MATα lyp1Δ his3Δ1 leu2Δ0 ura3Δ0 met15Δ0 can1Δ :: GMToolkit-α [CMVpr-rtTA NatMX4-STE3pr LEU2], sırasıyla. pr organizatörü gösterir. Hücre sayısı, yukarıdaki kültür optik yoğunluk ile tahmin edilir olmalıdır. </li><li> 2 dakika süreyle 800 xg&#39;de santrifüjleyin. </li><li> Süpernatantı. </li><li> Hava değişimi için izin vermek için,% 70 etanol ile muamele bir raptiye kullanarak kapağı üzerinde bir delik açın. </li><li> YPDA ortamı (% 1 maya özü,% 2 pepton,% 2 glikoz, ve ağırlıkça% 0.003 &#39;adenin hemisulfat 50 ul eklee). Vortex. </li><li> 5 dakika boyunca 800 xg&#39;de santrifüjleyin. </li><li> Nemli bir kutuda tüpü yerleştirin. Bu boş bir ipucu kutusu, küçük bir ipucu standı ve ıslak bir kağıt havlu ile oluşturulabilir. </li><li> 30 geceleme kutu inkübe ° C. </li><li> Ilk CAA-Ura plaka hücreleri sürerek evlendirilen diploidlerin seçin. Bir gün için, 30 ° C plaka inkübe edin. </li><li> Diploid seçilmesi için 200 ug / ml G418 içeren YPDA plakalar üzerinde koloniler izole (% 1 maya özü,% 2 pepton,% 2 glikoz,% 0.003 &#39;adenin hemisulfate ve% 2 agar) yapmak için toplu alanı, iz bunları hücre dışı bırakılması içeren GMToolkit-a ya da 100 ug / ml nourseothricin (Nat) GMToolkit-α içeren diploid seçilmesi için 15. </li><li> 3 gün için 30 ° C &#39;de plaka inkübe edin. </li><li> Izole edilmiş bir koloniden başlayarak, agar olmaksızın GNA ortam 500 ul için en hücrelerin aktarmak (% 1 maya ekstresi,% 3 Difco besin et suyu ve% 5 glükoz; otoklav glikoz ve t geri kalanıO bileşenleri ayrı olarak kapaklı bir 5 ml kültür tüpüne karamelizasyon önlemek için 2 × çözümler) gevşetti. </li><li> 30. az beş saat için yatay olarak tüp döndürme ° C. Dönme ekseni borunun uzunlamasına eksenine paralel olması gerekir. </li><li> Kullanılan bu koloniler onaylayın (1.21) Ura olan + a CAA-Ura plaka üzerinde onları sürerek. </li><li> 2 dakika boyunca 800 xg&#39;de tüp santrifüjleyin. Süpernatantı atın. </li><li> Minimal sporlanma orta (; filtresi sterilize% 1 potasyum asetat, 0.005% çinko asetat) 500 ul ekleyin. Vortex. </li><li> 2 dakika boyunca 800 xg&#39;de tüp santrifüjleyin. Süpernatantı atın. </li><li> Tekrarlama (1.25) - (1.26) iki kez. </li><li> 7.5 ug / ml lizin, 7.5 ug / ml lösin, 5 ug / ml histidin, 5 ug / ml, metiyonin, ve 1.25 ug / ml urasil (okzotrofik soylar arasında sporlanma oranını artırmak için) ilave edilmiş asgari sporlanma orta 1 ml ekleyin . Vortex. </li><li> Bir gün için oda sıcaklığında tüp döndürün. </li><li> 2 gün boyunca 30 ° C&#39;de tüp döndürün. </li><li> 2 dakika boyunca 800 x g, 1.6 ml&#39;lik Eppendorf tüpü içinde bu karışımdan 125 ul santrifüjleyin. Süpernatantı atın. </li><li> Zymolyase çözeltisi (100 mM sodyum fosfat tamponu, pH 7.4, sorbitol 1 M, ve ZymoResearch 2 adet zymolyase) 50 ul ekle. Bir pipet içinde ve dışında çözüm pipetleme karıştırın. </li><li> 1 saat boyunca 30 ° C&#39;de inkübe edin. </li><li> % 0.02 NP-40 50 ul ekle. Bir pipet içinde ve dışında çözüm pipetleme karıştırın. </li><li> Beş dakika için oda sıcaklığında bırakın tüp. </li><li> Su 500 ul ekleyin. </li><li> Buz üzerinde tüp yerleştirin. </li><li> Sonifier 450 (Branson) ile 3.2 mm mikrotip kullanarak 15 saniye için 1 çıkış ayarı (zayıf ayar) iki kez bu karışım sonikasyon. Sonikasyon ve iki tur arasında, ~ 0 ° C&#39;ye kadar ısı geri dönmek için buz üzerinde tüp yerleştirmek </li><li> 5 dakika boyunca 800 xg&#39;de tüpler santrifüjleyin. Süpernatantı atın. </li><li> SC-Ura-His 200 ul ekleyin(A) ya da çapraz-GMToolkit bir ya da GMToolkit-α içeren için olmasına bağlı olarak SC-Ura-Leu (α) ortam. Ortam hazırlamak için, SC-Ura-His-Leu ortam (% 0.67 maya azot baz,% 2 glikoz,% 0.01 &#39;arginin, aspartik asit,% 0.01,% 0.01&#39; glütamik asit, izolösin% 0.01,% 0.01 lisin, metiyonin% 0.01 yapmak ,% 0.01 fenilalanin,% 0.08 serin,% 0.04 treonin,% 0.002 tirozin,% 0.03 valin, 0.0025% adenin,% 0.005 triptofan, 0.003% adenin ve 0.005% triptofan) ve steril histidin veya lösin ile ek Kullanmadan önce % 0.01 nihai konsantrasyonu. </li><li> % 70 etanol ile muamele bir raptiye kullanarak kapağı üzerine bir delik açın. </li><li> 2 gün için 30 ° C &#39;de yatay boru döndürün. Dönme ekseni borunun uzunlamasına eksenine paralel olması gerekir. </li><li> Bir SC-Ura-His veya SC-Ura-Leu agar (yukarıdaki gibi aynı maddeleri artı% 2 agar hücreleri Streak, treonin ve aspartik asit bir süre sonra eklenmesi gerekirutoclaving; ProMonster suşları için izole koloniler yapmak) dökülmeden önce histidin veya lösin ekleyin. </li></ol> 2. Cinsel Bisiklete binme <ol><li> 100 SC-His ul (a) ya da 30 çiftleşme tipine bağlı olarak SC-Leu (α) kurulu bir GFP silme gerginlik bir kültür döndürme ° C de bir gece, 1.6 ml&#39;lik Eppendorf tüpü kullanılarak. Hava değişimi için,% 70 etanol ile tedavi edilen bir raptiye kullanarak bir delik açın. Yatay tüp döndürün. Dönme ekseni borunun uzunlamasına eksenine paralel olması gerekir. Bu topluca çiftleşme yoluyla birden suşları geçmek mümkündür. Sıralanmış bir örnek, doğrudan 2 gün için 30 ° C &#39;de 200 ul Bu amaçla, kültür hücreleri için kullanıldığı zaman. SC-Ura-His-Leu-orta ve histidin (% 0.01) ya da lösin (0.01%): orta hazırlamak için, urasil (0.0025 ile% nihai konsantrasyon) ilave edilir. </li><li> 1.6 ml Eppe 250.000 a-haploid hücrelerin ve GFP silinmesi suşların 250,000 α-haploid hücrelerin Mixndorf tüpü. Vortex. </li><li> (1.17) - aşağıdaki adımları (1.11) tarafından bu hücrelerin çiftleşirler. </li><li> Gevşeyen bir kapak içeren bir 5 ml&#39;lik kültür tüpü içinde 200 ug / ml G418 ve 100 ug / ml Nat ihtiva eden 500 ul ortam GNA ile çiftleşme karışım 10 ul aktarın. Başlangıç ​​OD 600 kabaca 0.1. </li><li> 24 saat süre ile 30 ° C &#39;de kültür döndürün. Tek diploid hem de KanMX4 içeren, çünkü bu diploid bir seçimine olanak tanıyan GMToolkit-a GMToolkit-α ve NatMX4 G418 ve Nat varlığında (Şekil 3) büyüyebilir. </li><li> Ve G418 içeren taze Nat GNA 500 ul için bir günlük kültür 20 ul aktarın. Başlangıç ​​OD 600 kabaca 0.2. </li><li> Log faz (~ 1 OD 600) hücre getirmek için 5 saat boyunca 30 ° C&#39;de tüp döndürün. </li><li> Diploidlerin biçime girdiklerinde ve sporlar izole etmek (1.38) - adımları (1.24) izleyin. </li><li> İki 300-ul içine sporlu hücre süspansiyonu bölmekparça ve ayrı 1.5 ml Eppendorf tüp içine her koydu. </li><li> 5 dakika boyunca 800 xg&#39;de tüpler santrifüjleyin. Süpernatantı atın. </li><li> Bir tüp pelet için, bir-haploidlerin seçmek için SC-His ortam 100 ul ilave edin. Diğer tüp pelet için, α-haploidlerin seçmek için SC-Leu ortam 100 ul ilave edin. </li><li> 30 ° C&#39;da gece boyunca tüp döndürün. Nihai OD 600 0.5 &#39;den daha az olmalıdır. OD 600 çok yüksek olması durumunda, oda sıcaklığında kültüre deneyin. </li><li> GFP indüklemek için, taze SC-His (a) veya 20 ug / ml içeren doksisiklin SC-Leu (α) ortamı. 100 ul ekle Doksisiklin nihai konsantrasyon 10 ug / ml &#39;dir. Vortex. </li><li> 2 gün boyunca 30 ° C&#39;de tüp döndürün. </li></ol> 3. Akış Sitometri <ol><li> Kapak ile birlikte bir 5-ml polipropilen tüp (BD Falcon # 352063) ile 10 ug / ml doksisiklin içeren ön-filtre TE tamponu, 900 ul (pH 7.5) ekleme ile değiştirilir hücre5 ml polistiren tüp süzgeç başlığı (BD Falcon # 352235). Polipropilen tüplere akış sitometrisi için uygundur. Süzgeç kapak büyük partikülleri için tercih edilir. </li><li> Yavaşça hücre-süzgeç kapağı doksisiklin TE tampon 75 ul yerleştirin. </li><li> Kapak üzerinde çözelti ile indüklenen hücre 25 ul ekle. </li><li> Örgü karşı Pipetman ucu basarken, süzgeç vasıtasıyla birleştirilmiş çözeltinin her vur. </li><li> Süzgeçli kap ve vorteks tüpü aşağı doğru bastırın. </li><li> SC-Onun veya SC-Leu 200 ul dolu toplama tüpleri (1.6 ml Eppendorf tüpleri) hazırlayın. </li><li> Hücre sıralayıcı başlatın ve üreticinin kılavuzuna göre ayarlar. </li><li> Vorteks toplama tüpü (mont orta duvara) ve hücre sıralayıcı üzerine yerleştirmeden önce hücreleri içeren tüp hem. </li><li> Örnek akım sitometri verileri edinin. GFP içermeyen A cins bir negatif kontrol edilebilir. </li><li> Sıralama için kapıları çizin. (A)Yüksek GFP yoğunluğu sergilerler ki hücre agrega, önlemek için, FSC yüksekliği arsa ve FSC kullanarak darbe genişliği ve darbe yükseklik MoFlo sıralayıcı veya orantısız küçük FSC yükseklikte bir komplo kullanarak ileri saçılım (FSC) için orantısız büyük darbe genişliği ile sapan atmak FACSAria sıralayıcı (Şekil 5, sol üst panel) alanı. (B) büyük FSC (bölge) hücre agregatları için beklendiği için, en düşük FSC ve yan saçılma (SSC) hücre artıkları sık sık bulunan değerlere sahip bölgeler kaçınarak sadece FSC, daha düşük% 20 hücreleri alır (Şekil 5, sağ üst panel). (C) SSC (bölge) ve GFP sinyali (bölge) genellikle pozitif bir korelasyon vardır. Sadece yukarıda verilen giriş kapıları parlak hücrelerin alma için de yüksek bir değer SSC olan hücreler için zenginleştirmek ki, her bir nokta en parlak hücrelerin benzer bir yüzdesi almak için GFP yoğunluk ve SSC, bir arsa kullanılarak nüfusun çevresi boyunca bir geçit çekmek SSC ekseni (Şekil 5, Bott arasında) diyagramı om-sol. (C) olarak seçilmiş nüfus (B) &#39;de seçilen nüfusun% 0.1-1 olması gerekir. </li><li> (3.10) deki kriterlere verilen toplama tüpüne 200 hücre sıralayın. Gerektiği gibi topluca süreci için veya daha karmaşık bir nüfus gerektiren diğer projeler için, daha fazla hücre sıralayabilirsiniz. </li><li> Vorteks toplama tüpü orta kriteri hücreleri kapsayacak. </li><li> Levha genotipleme için bir YPDA plaka üzerinde hücrelerinin bir alt kümesi (örneğin, 50 hücreleri). </li><li> 2 gün boyunca, 30 ° C plaka inkübe edin. </li><li> (1.8) - adımları (1.5) takip ~ 12 sömürgeler için bir lizat olun. </li><li> Nazikçe ucu ile plaka dokunarak G418 ve Nat içeren bir YPDA plaka üzerinde bir nokta için kullanılan ucu (1.5) üzerinde kalan hücreler aktarın. Seçilmiş haploidlerin Bu plaka üzerinde büyümesini değil. Diploid daha GFP kopya sahip olabilir ve bu nedenle daha parlak olabilir. Bu test haploid seçimi verimliliği gösterebilir. </li><li> Genotipleme için, 10-ul PCR r kullanarak lizat 1 ul analizdizisi CCTGAGAAAGCAACCTGACC bir astar ile eşleştirilmiş Silinen her genin memba komşu bölgeye anneals bir ileri astar ile eaction. Multiplex PCR reaksiyonları mümkünse (koşulların tek mutantlar lizatları kullanılarak tespit edilebilir). Ya da 384-kuyucuklu biçim - PCR, 96 içinde yapılabilir. Bu ikinci biçim az 5 ul&#39;lik reaksiyon hacmi için uygundur. PCR usta Arraying primerler ve bu karışımları ile hücre lizatları ayrıca bir çok kanallı bir pipet ya da bir sıvı taşıma robot ile gerçekleştirilebilir farklılaşan bir araya getirmektedir. Farklı PCR karışımları ile aynı lizat eklerken kriteri değişiklikler isteğe bağlıdır. </li><li> PCR ürünleri analiz edin. Jel XL Ultra V-2 elektroforez sistemi (Labnet) çok kanallı pipetler kullanılarak numune yükleme ile uyumludur. </li><li> Bilgi (3.16) ve (3.18) göre, genotipler istenen var olasılıkla haploidlerin tespit. </li><li> Taze bir tabak (YPDA, CAA-Ura, ya SC-Ura-His/Leu) bu suşların oluşturulması. Ayrıca, bunları dondurmak-80 Az% 25 gliserol ° C. Bu silinen genler ve pulsed-field jel elektroforezi için vahşi tip dizilerinin yokluğu onayı gibi ek testler önerilmektedir. </li><li> Kullanışlı suşları ile cinsel bisiklet (2.1) tekrarlayın. </li></ol>

<ol>
	<li>Tong, A. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+genetic+analysis+with+ordered+arrays+of+yeast+deletion+mutants.">Systematic genetic analysis with ordered arrays of yeast deletion mutants.</a> Science's STKE. 294, 2364-23 (2001).</li><li>Hillenmeyer, M. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+chemical+genomic+portrait+of+yeast:+uncovering+a+phenotype+for+all+genes.">The chemical genomic portrait of yeast: uncovering a phenotype for all genes.</a> Science. 320, 362-365 (2008).</li><li>Beh, C. T., Cool, L., Phillips, J., Rine, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overlapping+functions+of+the+yeast+oxysterol-binding+protein+homologues.">Overlapping functions of the yeast oxysterol-binding protein homologues.</a> Genetics. 157, 1117 (2001).</li><li>Wieczorke, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Concurrent+knock-out+of+at+least+20+transporter+genes+is+required+to+block+uptake+of+hexoses+in+Saccharomyces+cerevisiae.">Concurrent knock-out of at least 20 transporter genes is required to block uptake of hexoses in Saccharomyces cerevisiae.</a> FEBS letters. 464, 123-128 (1999).</li><li>Alani, E., Cao, L., Kleckner, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+method+for+gene+disruption+that+allows+repeated+use+of+URA3+selection+in+the+construction+of+multiply+disrupted+yeast+strains.">A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains.</a> Genetics. 116, 541-545 (1987).</li><li>Akada, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR-mediated+seamless+gene+deletion+and+marker+recycling+in+Saccharomyces+cerevisiae.">PCR-mediated seamless gene deletion and marker recycling in Saccharomyces cerevisiae.</a> Yeast. 23, 399-405 (2006).</li><li>Guldener, U., Heck, S., Fielder, T., Beinhauer, J., Hegemann, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+efficient+gene+disruption+cassette+for+repeated+use+in+budding+yeast.">A new efficient gene disruption cassette for repeated use in budding yeast.</a> Nucleic acids research. 24, 2519 (1996).</li><li>Delneri, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+redundancy+in+the+yeast+genome:+an+improved+strategy+for+use+of+the+cre-loxP+system.">Exploring redundancy in the yeast genome: an improved strategy for use of the cre-loxP system.</a> Gene. 252, 127-135 (2000).</li><li>Storici, F., Lewis, L. K., Resnick, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+site-directed+mutagenesis+using+oligonucleotides.">In vivo site-directed mutagenesis using oligonucleotides.</a> Nat. Biotech. 19, 773-776 (2001).</li><li>Noskov, V. N., Segall-Shapiro, T. H., Chuang, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tandem+repeat+coupled+with+endonuclease+cleavage+(TREC):+a+seamless+modification+tool+for+genome+engineering+in+yeast.">Tandem repeat coupled with endonuclease cleavage (TREC): a seamless modification tool for genome engineering in yeast.</a> Nucl. Acids Res. 38, 2570-2576 (2010).</li><li>Suzuki, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Knocking+out+multigene+redundancies+via+cycles+of+sexual+assortment+and+fluorescence+selection.">Knocking out multigene redundancies via cycles of sexual assortment and fluorescence selection.</a> Nat. Methods. 8, 159-164 (2011).</li><li>Winzeler, E. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+Characterization+of+the+S.+Genome+by+Gene+Deletion+and+Parallel+Analysis.">Functional Characterization of the S. Genome by Gene Deletion and Parallel Analysis.</a> Science. 285, 901-906 (1999).</li><li>Woods, R. A., Gietz, R. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-efficiency+transformation+of+plasmid+DNA+into+yeast.">High-efficiency transformation of plasmid DNA into yeast.</a> Methods Mol. Biol. 177, 85-97 (2001).</li><li>Hughes, T. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Widespread+aneuploidy+revealed+by+DNA+microarray+expression+profiling.">Widespread aneuploidy revealed by DNA microarray expression profiling.</a> Nature. 25, 333-337 (2000).</li><li>Goldstein, A. L., McCusker, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three+new+dominant+drug+resistance+cassettes+for+gene+disruption+in+Saccharomyces+cerevisiae.">Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae.</a> Yeast. 15, 1541-1553 (1999).</li><li>Newman, J. R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+proteomic+analysis+of+S.+cerevisiae+reveals+the+architecture+of+biological+noise.">Single-cell proteomic analysis of S. cerevisiae reveals the architecture of biological noise.</a> Nature. 441, 840-846 (2006).</li><li>Rosenfeld, N., Young, J. W., Alon, U., Swain, P. S., Elowitz, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+regulation+at+the+single-cell+level.">Gene regulation at the single-cell level.</a> Science. 307, 1962 (2005).</li></ol>

Çıkar çatışması ilan etti.

Biz Yeşil Canavar yaklaşım geliştirdi olarak, genom düzenlenmesi giden, farklı GFP yedek kasetler arasındaki rekombinasyon olasılığı ile ilgiliydi. Bu olasılığa karşı Azaltıcı başarıyla çiftleşme ve mayoz çok sayıda mermi geçirmiş hücreleri için bizim seçimdir. Düzenlenmeyecek genomları taşıyan hücreler özdeş düzenlenmesi olmadan hücrelerine çiftleşme sonrası daha az uyumlu olması beklenmektedir. Nitekim, biz GFP kasetler 11 arasındaki rekombinasyon kaynaklanan herha...

<table border="1"><tbody><tr><td> Reaktif ya da cihazın adı </td><td> Şirket </td><td> Katalog numarası </td><td> Yorumlar (isteğe bağlı) </td></tr><tr><td> G418 </td><td> Sigma-Aldrich </td><td> A1720 </td><td> (0.2 mikron filtre) suda çözülür ve filtre sterilize. Stok konsantrasyon: 200 mg / ml idi. 4 ° C&#39;de depolayın </td></tr><tr><td> ClonNAT (nourseothricin) </td><td> WERNER BioAgents </td><td> 5001000 </td><td> (0.2 mikron filtre) suda çözülür ve filtre sterilize. Stok konsantrasyon: 100 mg / ml idi. 4 ° C&#39;de depolayın </td></tr><tr><td> Doksisiklin </td><td> Sigma-Aldrich </td><td> D9891 </td><td> (0.2 mikron filtre)% 50 etanol içinde çözülür ve filtre sterilize. Stok konsantrasyon: 10 mg / ml idi. Dört haftada taze olun. 4 de alüminyum folyo ve mağaza kullanarak ışıktan Kalkanı ° C. </td></tr><tr><td> Zymolyase </td><td> ZymoResearch </td><td> E1005 </td><td></td></tr><tr><td> Difco maya azot baz w / o amino asitler </td><td> BD </td><td> 291940 </td><td></td></tr><tr><td> Revolver (tüpler için döndürücü) </td><td> Labnet </td><td> H5600 </td><td></td></tr><tr><td> Enduro Jel XL elektroforez ünitesi </td><td> Labnet </td><td> E0160 </td><td></td></tr><tr><td> Sonifier 450 </td><td> Branson </td><td> 101-063-198 </td><td></td></tr><tr><td> Sonifier 450 Microtip </td><td> Branson </td><td> 101-148-062 </td><td></td></tr><tr><td> FACSAria hücre sıralayıcı </td><td> BD </td><td></td><td></td></tr><tr><td> MoFlo hücre sıralayıcı </td><td> Beckman-Coulter </td><td></td><td></td></tr><tr><td> Biomek FX veya eşdeğeri robot </td><td> Beckman Coulter </td><td></td><td> İsteğe bağlı. Genotipleme PCRlar kurmak için. </td></tr></tbody> &lt;/ Table&gt;

the green monster process for the generation of yeast strains carrying multiple gene deletions

Bir gen delesyonu için fenotipleri sık mutasyon belirli bir genetik arka plan veya çevre koşulu 1,2 test olduğunda ortaya çıkar. Birçok gen gizli gen fonksiyonlarının 3,4 maskesini düşürmeye silinmesi gerekir örnekleri vardır. Önemli buluşlar için potansiyeline rağmen, üç veya daha fazla geni içeren genetik etkileşimler büyük oranda araştırılmamıştır. Multi-mutant etkileşimleri kapsayan taramalar delesyonlar olası kombinasyonların çokluğu nedeniyle pratik olmaz. Bununla birlikte, böyle bir ortak işlev şekilde daha büyük bir önsel şans ile paraloglarına setleri gibi genler, seçilmiş kümelerinin çalışmalar bilgilendirici olacaktır. Mayası Saccharomyces cerevisiae, gen nakavt homolog rekombinasyon yoluyla, seçilebilir bir işaretleyici gen ile değiştirilmesi ile gerçekleştirilir. Belirteçlerinin sayısı sınırlı olduğundan, yöntemler sam kaldırılması ve yeniden kullanmak için geliştirilmiştir<html> e işaretleyici 5,6,7,8,9,10. Zaman elde edilmesi için silme sayısı ile doğrusal ölçekler gereken Bununla birlikte, bu yöntemler kullanılarak ardışık olarak çoklu mutasyonlarla mühendislik zaman alıcıdır. Burada rutin maya 11 birden silme mühendisliği için Yeşil Canavar yöntem açıklanmaktadır. Bu yöntemde, silmeler içine entegre bir yeşil flöresanlı protein (GFP) raportör her bir suş içinde yer silme sayısı (Şekil 1) &#39;e göre kantitatif etiket suşları için kullanılır. Maya çiftleşme ve mayoz ile GFP işaretlenmiş delesyonlar ürün yelpazesine Tekrarlanan mermi suşlarında delesyonlar birikimi (Şekil 2) neden bu delesyonlar fazla taşıyan suşlarının akış sitometrik zenginleştirme ile birleştiğinde. , Tur başına bir veya daha fazla silme içeren her işlem ile paralel olarak çoklu süreçleri Sahne suşu yapımı için gereken süreyi azaltır. content &quot;&gt; İlk adım haploit tek mutantlar adlandırdığı hazırlamaktır &#39;ProMonsters,&#39; bir GFP silinmiş bir odağı muhabiri ve &#39;araç birini taşıyan her biri lokus-Ya Yeşil Canavar GMToolkit-Bir ya GMToolkit-α .. can1Δ yerinin (Şekil 3) maya silme toplama 12 den suşu kullanılarak, GFP-işaretli silmeler uygun bir evrensel GFP ile bu suşların içinde mevcut ortak KanMX4 kaset değiştirerek elde edilebilir - URA3 fragmanı her GMToolkit içerir: bir ya da - ya da α-çiftleşme-tipi-spesifik haploid seçim işaretleyici her ikisi de 1 ve tam olarak GMToolkits mevcut olduğunda, toplu olarak diploid seçimine izin veren, bu iki belirteçlerinden biri. İkinci adım, silme loci rasgele yelpazesine ve / veya mayotik recomb ile tek bir hücre içinde kombine edilebilir yoluyla cinsel bisiklet gerçekleştirmek için olançiftleşme ve sporlanma her döngüsünde eşlik asÙ.

Dört GFP işaretli delesyonlar (ycl033cΔ yer042wΔ ykl069wΔ yol118cΔ) taşıyan bir-haploid zorlanma dört delesyonlar taşıyan bir α-haploid zorlanma ile geçti edildiğinde (ycl033cΔ ydl242wΔ ydl227cΔ yer042wΔ), iki silme ile (ycl033cΔ yer042wΔ) iki suş, bir temsilcisi tarafından paylaşılan sonucu elde edilmiştir. Çiftleşme karışımı diploidlerin seçmek için G418 ve Nat içeren YPDA ortamda kültüre edildi. Elde edilen diploid sporlanma ortam içinde...

Watch this Scientific Journal Video about The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions at JoVE.com

The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions

Yeşil Canavar yöntemi bir muhabir gen kodlaması yeşil flüoresan protein ile işaretlenmiş birden silme hızlı montaj sağlar. Bu yöntem, tekrarlanan delesyonlar cinsel çeşit döngüleri ve daha fazla silme taşıyan hücrelerin floresan merkezli zenginleştirme yoluyla maya suşu sürüş dayanmaktadır.

Çoklu Gen Delesyonlar Taşıma Maya Suşlarında Nesil için Yeşil Canavar Süreci

Phenotypes  for a gene deletion are often revealed only when the mutation is tested in a  particular genetic background or environmental condition1,2. ...

the-green-monster-process-for-generation-yeast-strains-carrying

Research

JoVE Journal

Biology

14.2K Görüntüleme.  J. Craig Venter Institute. Yeşil Canavar yöntemi bir muhabir gen kodlaması yeşil flüoresan protein ile işaretlenmiş birden silme hızlı montaj sağlar. Bu yöntem, tekrarlanan delesyonlar cinsel çeşit döngüleri ve daha fazla silme taşıyan hücrelerin floresan merkezli zenginleştirme yoluyla maya suşu sürüş dayanmaktadır.

Video: The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions

A Rapid Technique for the Visualization of Live Immobilized Yeast Cells

We present here a simple, rapid, and extremely flexible technique for the immobilization and visualization of growing yeast cells by epifluorescence microscopy. The technique is equally suited for visualization of static yeast populations, or time courses experiments up to ten hours in length. My microscopy investigates epigenetic inheritance at the silent mating loci in S. cerevisiae. There are two silent mating loci, HML and HMR, which are normally not expressed as they are packaged in heterochromatin. In the sir1 mutant background silencing is weakened such that each locus can either be in the expressed or silenced epigenetic state, so in the population as a whole there is a mix of cells of different epigenetic states for both HML and HMR. My microscopy demonstrated that there is no relationship between the epigenetic state of HML and HMR in an individual cell. sir1 cells stochastically switch epigenetic states, establishing silencing at a previously expressed locus or expressing a previously silenced locus. My time course microscopy tracked individual sir1 cells and their offspring to score the frequency of each of the four possible epigenetic switches, and thus the stability of each of the epigenetic states in sir1 cells. See also  Xu et al., Mol. Cell 2006.

A rapid technique for the visualization of growing immobilized yeast cells, here applied to fluorescent reporters at the silent mating loci HML and HMR

Canlı İmmobilize Maya Hücreleri Görselleştirme Hızlı Tekniği

We present here a simple, rapid, and extremely flexible technique for the immobilization and visualization of growing yeast cells by epifluorescence ...

Biyoloji

The Preparation of Primary Hematopoietic Cell Cultures From Murine Bone Marrow for Electroporation

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser MXcell  electroporation system and Gene Pulser  electroporation buffer were specifically developed to transfect nucleic acids into mammalian cells and difficult-to-transfect cells, such as primary and stem cells.This video demonstrates how to establish primary hematopoietic cell cultures from murine bone marrow, and then prepare them for electroporation in the MXcell system. We begin by isolating femur and tibia. Bone marrow from both femur and tibia are then harvested and cultures are established. Cultured bone marrow cells are then transfected and analyzed.

This procedure describes how to establish primary hematopoietic cell cultures from murine bone marrow and is followed by transfection using the Gene Pulser MXCell electroporation system.

Hazırlık Elektroporasyon murin Kemik İliği itibaren İlköğretim Hematopoetik Hücre Kültürleri

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser ...

Single-Molecule Imaging of Nuclear Transport

The utility of single molecule fluorescence microscopy approaches has been proven to be of a great avail in understanding biological reactions over the last decade. The investigation of molecular interactions with high temporal and spatial resolutions deep within cells has remained challenging due to the inherently weak signals arising from individual molecules. Recent works by Yang et al. demonstrated that narrow-field epifluorescence microscopy allows visualization of nucleocytoplasmic transport at the single molecule level. By the single molecule approach, important kinetics, such as nuclear transport time and efficiency, for signal-dependent and independent cargo molecules have been obtained. Here we described a protocol for the methodological approach with an improved spatiotemporal resolution of 0.4 ms and 12 nm. The improved resolution enabled us to capture transient active transport and passive diffusion events through the nuclear pore complexes (NPC) in semi-intact cells. We expect this method to be used in elucidating other binding and trafficking events within cells.

Single molecule microscopy approch provided novel insights into nuclear transport.

Tek Molekül Görüntüleme Nükleer Ulaştırma

The utility of single molecule fluorescence microscopy approaches has been proven to be of a great avail in understanding biological reactions over the ...

In vitro Reconstitution of the Active T. castaneum Telomerase

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more than a decade. Here, we present methods for the isolation of the recombinant Tribolium castaneum TERT (TcTERT) and the reconstitution of the active T. castaneum telomerase ribonucleoprotein (RNP) complex in vitro.
Telomerase is a specialized reverse transcriptase1 that adds short DNA repeats, called telomeres, to the 3' end of linear chromosomes2 that serve to protect them from end-to-end fusion and degradation. Following DNA replication, a short segment is lost at the end of the chromosome3 and without telomerase, cells continue dividing until eventually reaching their Hayflick Limit4. Additionally, telomerase is dormant in most somatic cells5 in adults, but is active in cancer cells6 where it promotes cell immortality7.
The minimal telomerase enzyme consists of two core components: the protein subunit (TERT), which comprises the catalytic subunit of the enzyme and an integral RNA component (TER), which contains the template TERT uses to synthesize telomeres8,9. Prior to 2008, only structures for individual telomerase domains had been solved10,11. A major breakthrough in this field came from the determination of the crystal structure of the active12, catalytic subunit of T. castaneum telomerase, TcTERT1.
Here, we present methods for producing large quantities of the active, soluble TcTERT for structural and biochemical studies, and the reconstitution of the telomerase RNP complex in vitro for telomerase activity assays. An overview of the experimental methods used is shown in Figure 1.

In vitro Reconstitution of the Active T. castaneum Telomerase

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more than a decade. Here, we present methods for the isolation of the recombinant Tribolium castaneum TERT (TcTERT) and the reconstitution of the active T. castaneum telomerase ribonucleoprotein (RNP) complex in vitro.

Active T. in vitro Sulandırma castaneum Telomeraz

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more ...

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Transposon mutagenesis and single-gene deletion are two methods applied in genome-wide gene knockout in bacteria 1,2. Although transposon mutagenesis is less time consuming, less costly, and does not require completed genome information, there are two weaknesses in this method: (1) the possibility of a disparate mutants in the mixed mutant library that counter-selects mutants with decreased competition; and (2) the possibility of partial gene inactivation whereby genes do not entirely lose their function following the insertion of a transposon. Single-gene deletion analysis may compensate for the drawbacks associated with transposon mutagenesis. To improve the efficiency of genome-wide single gene deletion, we attempt to establish a high-throughput technique for genome-wide single gene deletion using Streptococcus sanguinis as a model organism. Each gene deletion construct in S. sanguinis genome is designed to comprise 1-kb upstream of the targeted gene, the aphA-3 gene, encoding kanamycin resistance protein, and 1-kb downstream of the targeted gene. Three sets of primers F1/R1, F2/R2, and F3/R3, respectively, are designed and synthesized in a 96-well plate format for PCR-amplifications of those three components of each deletion construct. Primers R1 and F3 contain 25-bp sequences that are complementary to regions of the aphA-3 gene at their 5' end. A large scale PCR amplification of the aphA-3 gene is performed once for creating all single-gene deletion constructs. The promoter of aphA-3 gene is initially excluded to minimize the potential polar effect of kanamycin cassette. To create the gene deletion constructs, high-throughput PCR amplification and purification are performed in a 96-well plate format. A linear recombinant PCR amplicon for each gene deletion will be made up through four PCR reactions using high-fidelity DNA polymerase. The initial exponential growth phase of S. sanguinis cultured in Todd Hewitt broth supplemented with 2.5% inactivated horse serum is used to increase competence for the transformation of PCR-recombinant constructs. Under this condition, up to 20% of S. sanguinis cells can be transformed using ~50 ng of DNA. Based on this approach, 2,048 mutants with single-gene deletion were ultimately obtained from the 2,270 genes in S. sanguinis excluding four gene ORFs contained entirely within other ORFs in S. sanguinis SK36 and 218 potential essential genes. The technique on creating gene deletion constructs is high throughput and could be easy to use in genome-wide single gene deletions for any transformable bacteria.

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

An efficient genome-wide single gene mutation method has been established using Streptococcus sanguinis as a model organism. This method has achieved via high throughput recombinant PCRs and transformations.

Genom çapında Gen Delesyonlar içinde<em&gt; Streptococcus sanguinis</em&gt; Yüksek Verimli PCR ile

Transposon  mutagenesis and single-gene deletion are two methods applied in genome-wide  gene knockout in bacteria 1,2. Although transposon mutagenesis is ...

Budding Yeast Protein Extraction and Purification for the Study of Function, Interactions, and Post-translational Modifications

Homogenization by bead beating is a fast and efficient way to release DNA, RNA, proteins, and metabolites from budding yeast cells, which are notoriously hard to disrupt. Here we describe the use of a bead mill homogenizer for the extraction of proteins into buffers optimized to maintain the functions, interactions and post-translational modifications of proteins. Logarithmically growing cells expressing the protein of interest are grown in a liquid growth media of choice. The growth media may be supplemented with reagents to induce protein expression from inducible promoters (e.g. galactose), synchronize cell cycle stage (e.g. nocodazole), or inhibit proteasome function (e.g. MG132). Cells are then pelleted and resuspended in a suitable buffer containing protease and/or phosphatase inhibitors and are either processed immediately or frozen in liquid nitrogen for later use. Homogenization is accomplished by six cycles of 20 sec&#160;bead-beating (5.5 m/sec), each followed by one minute incubation on ice. The resulting homogenate is cleared by centrifugation and small particulates can be removed by filtration. The resulting cleared whole cell extract (WCE) is precipitated using 20% TCA for direct analysis of total proteins by SDS-PAGE followed by Western blotting. Extracts are also suitable for affinity purification of specific proteins, the detection of post-translational modifications, or the analysis of co-purifying proteins. As is the case for most protein purification protocols, some enzymes and proteins may require unique conditions or buffer compositions for their purification and others may be unstable or insoluble under the conditions stated. In the latter case, the protocol presented may provide a useful starting point to empirically determine the best bead-beating strategy for protein extraction and purification. We show the extraction and purification of an epitope-tagged SUMO E3 ligase, Siz1, a cell cycle regulated protein that becomes both sumoylated and phosphorylated, as well as a SUMO-targeted ubiquitin ligase subunit, Slx5.

The preparation of high quality yeast cell extracts is a necessary first step in the analysis of individual proteins or entire proteomes. Here we describe a fast, efficient, and reliable homogenization protocol for budding yeast cells that has been optimized to preserve protein functions, interactions, and post-translational modifications.

Fonksiyon Çalışma, Etkileşimler, ve Post-translasyonel değişiklikler için tomurcuklanan Maya Protein Ekstraksiyonu ve Saflaştırılması

Homogenization by bead beating is a fast and efficient way to release DNA, RNA, proteins, and metabolites from budding yeast cells, which are notoriously ...

Nanogold Labeling of the Yeast Endosomal System for Ultrastructural Analyses

Endosomes are one of the major membrane sorting checkpoints in eukaryotic cells and they regulate recycling or destruction of proteins mostly from the plasma membrane and the Golgi. As a result the endosomal system plays a central role in maintaining cell homeostasis, and mutations in genes belonging to this network of organelles interconnected by vesicular transport, cause severe pathologies including cancer and neurobiological disorders. It is therefore of prime relevance to understand the mechanisms underlying the biogenesis and organization of the endosomal system. The yeast Saccharomyces cerevisiae has been pivotal in this task. To specifically label and analyze at the ultrastructural level the endosomal system of this model organism, we present here a detailed protocol for the positively charged nanogold uptake by spheroplasts followed by the visualization of these particles through a silver enhancement reaction. This method is also a valuable tool for the morphological examination of mutants with defects in endosomal trafficking. Moreover, it is not only applicable for ultrastructural examinations but it can also be combined with immunogold labelings for protein localization investigations.

Yeast, Saccharomyces cerevisiae, has been a key model organism to identify and study genes regulating the biogenesis and functions of the endosomal system. Here we present a detailed protocol for the specific labeling of the endosomal compartments for ultrastructural studies.

Ultrastrüktürel Analizler için Maya endozomal Sisteminin Nanogold Etiketleme

Endosomes are one of the major membrane sorting checkpoints in eukaryotic cells and they regulate recycling or destruction of proteins mostly from the ...

Isolating Potentiated Hsp104 Variants Using Yeast Proteinopathy Models

Many protein-misfolding disorders can be modeled in the budding yeast Saccharomyces cerevisiae. Proteins such as TDP-43 and FUS, implicated in amyotrophic lateral sclerosis, and &#945;-synuclein, implicated in Parkinson&#8217;s disease, are toxic and form cytoplasmic aggregates in yeast. These features recapitulate protein pathologies observed in patients with these disorders. Thus, yeast are an ideal platform for isolating toxicity suppressors from libraries of protein variants. We are interested in applying protein disaggregases to eliminate misfolded toxic protein conformers. Specifically, we are engineering Hsp104, a hexameric AAA+ protein from yeast that is uniquely capable of solubilizing both disordered aggregates and amyloid and returning the proteins to their native conformations. While Hsp104 is highly conserved in eukaryotes and eubacteria, it has no known metazoan homologue. Hsp104 has only limited ability to eliminate disordered aggregates and amyloid fibers implicated in human disease. Thus, we aim to engineer Hsp104 variants to reverse the protein misfolding implicated in neurodegenerative disorders. We have developed methods to screen large libraries of Hsp104 variants for suppression of proteotoxicity in yeast. As yeast are prone to spontaneous nonspecific suppression of toxicity, a two-step screening process has been developed to eliminate false positives. Using these methods, we have identified a series of potentiated Hsp104 variants that potently suppress the toxicity and aggregation of TDP-43, FUS, and &#945;-synuclein. Here, we describe this optimized protocol, which could be adapted to screen libraries constructed using any protein backbone for suppression of toxicity of any protein that is toxic in yeast.

Yeast proteinopathy models are valuable tools to assess the toxicity and aggregation of proteins implicated in disease. Here, we present methods for screening Hsp104 variant libraries for toxicity suppressors. This protocol could be adapted to screen any protein library for toxicity suppressors of any protein that is toxic in yeast.

Kuvvetlendiği Hsp104 Varyantlar kullanarak Maya Proteinopathy Modelleri Ayırma

Many protein-misfolding disorders can be modeled in the budding yeast Saccharomyces cerevisiae. Proteins such as TDP-43 and FUS, implicated in amyotrophic ...

Generation of Genomic Deletions in Mammalian Cell Lines via CRISPR/Cas9

The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system may be re-purposed for site-specific eukaryotic genome engineering. CRISPR/Cas9 is an inexpensive, facile, and efficient genome editing tool that allows genetic perturbation of genes and genetic elements. Here we present a simple methodology for CRISPR design, cloning, and delivery for the production of genomic deletions. In addition, we describe techniques for deletion, identification, and characterization. This strategy relies on cellular delivery of a pair of chimeric single guide RNAs (sgRNAs) to create two double strand breaks (DSBs) at a locus in order to delete the intervening DNA segment by non-homologous end joining (NHEJ) repair. Deletions have potential advantages as compared to single-site small indels given the efficiency of biallelic modification, ease of rapid identification by PCR, predictability of loss-of-function, and utility for the study of non-coding elements. This approach can be used for efficient loss-of-function studies of genes and genetic elements in mammalian cell lines.

CRISPR/Cas9 is a robust system to produce disruption of genes and genetic elements. Here we describe a protocol for the efficient creation of genomic deletions in mammalian cell lines using CRISPR/Cas9.

CRISPR / Cas9 üzerinden Memeli Hücre Hatlarında Genomik Delesyonlar Üretimi

The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system may be re-purposed for site-specific ...

Applications of pHluorin for Quantitative, Kinetic and High-throughput Analysis of Endocytosis in Budding Yeast

Green fluorescent protein (GFP) and its variants are widely used tools for studying protein localization and dynamics of events such as cytoskeletal remodeling and vesicular trafficking in living cells. Quantitative methodologies using chimeric GFP fusions have been developed for many applications; however, GFP is somewhat resistant to proteolysis, thus its fluorescence persists in the lysosome/vacuole, which can impede quantification of cargo trafficking in the endocytic pathway. An alternative method for quantifying endocytosis and post-endocytic trafficking events makes use of superecliptic pHluorin, a pH-sensitive variant of GFP that is quenched in acidic environments. Chimeric fusion of pHluorin to the cytoplasmic tail of transmembrane cargo proteins results in a dampening of fluorescence upon incorporation of the cargo into multivesicular bodies (MVBs) and delivery to the lysosome/vacuole lumen. Thus, quenching of vacuolar fluorescence facilitates quantification of endocytosis and early events in the endocytic pathway. This paper describes methods using pHluorin-tagged cargos for quantification of endocytosis via fluorescence microscopy, as well as population-based assays using flow cytometry.

Accurate quantification of vesicular trafficking events often provides key insights into roles for specific proteins and the effects of mutations. This paper presents methods for using superecliptic pHluorin, a pH-sensitive GFP variant, as a tool for quantification of endocytic events in living cells using quantitative fluorescence microscopy and flow cytometry.

Budding Maya endositozun kantitatif, kinetik ve Yüksek verim Analizi pHluorin Uygulamaları

Green fluorescent protein (GFP) and its variants are widely used tools for studying protein localization and dynamics of events such as cytoskeletal ...