Work described in this protocol was made possible by funding from the Victorian Government as part of an collaborative alliance with the Californian Institute for Regenerative Medicine (CIRM).

All procedures are carried out in a sterile laminar flow hood. All media and solutions are equilibrated to 37 &#176;C unless otherwise specified.
1. Expansion of Human PSCs (hESCs and hiPSCs, WA-09 used in this Protocol) for Transfection
Note: It is not necessary to expand hESCs on Matrigel or Geltrex. hESCs expanded on mouse embryonic fibroblasts (MEFs) can be used for electroporation or nucleofection following a MEF removal step (see section 2.8).
<ol>
	<li>Prepare 1 x 100 mm dish and 1 x 75cm2 flask of DR4 MEFs at 2.0 x 104 cells per cm2 in MEF media (see Table 1) on dishes pre-coated with 0.1% w/v gelatin. 
	Note: CF1, BLK6 or MF1 MEFs can be used, however, it is recommended that antibiotic resistant MEF lines are used, e.g., DR410.</li>
	<li>The next day, passage hESCs onto a 100 mm dish pre-plated with MEFs prepared in section 1.1. To do this aspirate hESC media from cultures dishes, wash hESCs with Ca2+/Mg2+-free Hanks&#8217; balanced salt solution (HBSS), add Dispase (see Table 2 for appropriate volumes) and place in a humidified incubator at 37&#176;C/5% CO2. Following 3-5 min incubation, aspirate Dispase and gently wash 1 - 2 times with HBSS to remove MEFs. Add hESC media (see Table 3) and using a cell scraper, or 5 ml pipette, gently scrape the colonies off the surface of the culture dish.</li>
	<li>Collect the colony fragments in suspension from the culture dish into a 15 ml centrifuge tube. Rinse culture dish with hESC media and transfer to the 15 ml tube. Be careful to not break up clumps into single cells or small fragments.</li>
	<li>Centrifuge for 5 min at 160 x g to pellet colony fragments.</li>
	<li>Aspirate supernatant. Tap bottom of 15 ml tube with finger to loosen colony fragment pellet. Gently resuspend colony fragments in hESC media according to split ratio (normally a split ratio between 1:4 and 1:8 is appropriate). Be extremely careful not to render clumps into single cells or small fragments as this will affect replating efficiency.</li>
	<li>Prior to replating hESC fragments onto MEFs wash 1x with HBSS. Slowly add an appropriate amount (see Table 2) of cell suspension containing hESC fragments in hESC media to dishes pre-plated with MEFs.</li>
	<li>Place culture dishes onto shelf in incubator and move slowly back and forth and side to side to evenly distribute colony fragments.</li>
	<li>Replace hESC media daily.</li>
	<li>To prepare conditioned media from MEFs (MEF-CM) wash the 75 cm2 flask pre-plated with MEFs 1 x with HBSS. Add hESC media. Following 24 hr, collect conditioned media and replace with fresh hESC media. Repeat daily for a maximum of 12 days. Store MEF-CM at 4 &#176;C until needed.</li>
</ol>
2. Preparation of Human ESCs for Transfection
<ol>
	<li>Observe the growth of hESCs under a microscope daily. When colonies become 40-50% confluent, plate 3 x 100 mm dishes with 2.0 x 105 MEFs per cm2.</li>
	<li>When colonies become 60 - 70% confluent they are ready to be transfected. &#8216;Groom&#8217; colonies by removing differentiated colonies or colony cores. 
	Note: As we believe higher transfection and targeting efficiencies occur when cells are in log phase growth, it is suggested that electroporation be conducted before hESCs reach &#8805; 70% confluency.</li>
	<li>Wash hESC colonies with HBSS and add Accutase. 
	Note: It is not necessary to pre-treat hESCs with ROCK inhibitor Y-27632 as sufficient inhibition will occur when incubated with Y-27632 during step 2.7</li>
	<li>Incubate for 10 - 20 min at 37&#176;C/5% CO2 until colonies are rendered single cells as viewed under a microscope. Triturate cells with a 1 ml pipette.</li>
	<li>Add hESC media and filter into a 15 ml conical tube using a 40 &#956;m cell strainer to remove cell clumps.</li>
	<li>Centrifuge at 160 x g for 5 min. Resuspend cell pellet in fresh hESC media and repeat to remove any residual Accutase solution.</li>
	<li>Resuspend cells in hESC media containing 10 &#956;M Y-27632 and transfer the total cell suspension to a 100 mm dish pre-coated with gelatin.</li>
	<li>Incubate at 37 &#176;C/5% CO2 for a minimum of 30 min.</li>
	<li>During this time MEFs will adhere to the gelatin coated dish. Collect non-adherent hESCs using a 1 ml pipette into a fresh 15 ml centrifuge tube and determine cell density using a hemocytometer.</li>
</ol>
3. Electroporation of hESCs
<ol>
	<li>Filter CM-MEF media using a 0.22 &#956;m filter and add 10 ng/ml&#160;recombinant human fibroblast growth factor 2 (rhFGF2).</li>
	<li>Transfer 7.5 x 106 hESCs from section 2.9 to a new 15 ml conical tube and centrifuge at 160 x g for 5 min.</li>
	<li>During this time set up the electroporator: Select program for exponential electroporation and set the following parameters, Voltage: 250 V, Capacitance: 500 &#956;F, and Resistance: &#8734;-.</li>
	<li>Aspirate the supernatant and re-suspend cell pellet in 0.8 ml of ice-cold 0.22 &#956;m filtered HBSS. Transfer the solution to a sterile 0.4 cm electroporation cuvette.</li>
	<li>Add TV-hPITX3-forward targeting construct (30 &#956;g DNA) and mix gently with a 200 &#956;l pipette. Incubate on ice for 5 min. During this time remove one aliquot of PITX3 ZFN mRNA and defrost on ice. When defrosted transfer 7.5 &#956;l of ZFN mRNA to DNA/cell mixture in electroporation cuvette. Mix gently with a 200 &#956;l pipette. 
	Note: The locus being targeted is the main factor that contributes to targeting efficiency. Loci encoding silent genes, genes not expressed in ESCs, such as PITX3 are difficult to target using conventional homologous recombination6. Thus, this protocol utilizes custom designed ZFNs for the human PITX3 locus to induce a DNA double strand break.</li>
	<li>Electroporate by following the on screen instructions on the electroporator.</li>
	<li>Using a 200 &#956;l pipette transfer the contents from the electroporation cuvette to a 15 ml tube containing 10 ml hESC media. Wash the cuvette twice with 200 &#956;l of hESC media each time and transfer to a 15 ml tube. There will be &#8220;mucous-like&#8221; debris consisting of DNA and protein from the lysed cells which will negatively impact cell survival. Centrifuge at 160 x g for 5 min to remove this debris.</li>
	<li>Aspirate the supernatant and gently tap cell pellet to loosen. Re-suspend in 30 ml supplemented MEF-CM containing 10 &#956;M Y-27632 and replate onto 3 x 100 mm dishes preplated with MEFs.</li>
	<li>Change the media daily. On day 2, Y-27632 can be withdrawn and cells grown in hESC media only.</li>
	<li>After 2-3 days the hESCs should be 50-70% confluent. At this point begin antibiotic selection (e.g., 0.5 &#956;g/ml&#160;puromycin).</li>
	<li>Maintain selection by adding fresh hESC/puromycin media daily. After ~7 days small colonies should be visible. If antibiotic resistant MEFs are not used, MEFs can be supplemented by adding an additional 1.0 x 104 cells per cm2.</li>
</ol>
4. Picking Transgenic hESC Clones
<ol>
	<li>Approximately 14 - 21 days following selection (when colonies have reached ~1 mm diameter) prepare plates for expansion and screening. Begin by defrosting an aliquot of Matrigel or Geltrex at 4&#176;C for a minimum of 5 hr. Dilute as per manufacturers&#8217; instructions and add 75 &#956;l to each well of 3 x 96-well plates. Prepare 3 x 48-well plates by plating MEFs at 2.0 x 104 cells per cm2. Incubate both plates O/N at 37 &#176;C/5% CO2.</li>
	<li>The following day dissect colonies into 16-25 pieces using a 21 G needle on the end of a 2 ml pipette by cutting a grid.</li>
	<li>Aspirate Matrigel from 96-well plates and replace with supplemented CM-MEF media. Wash MEFs in 48-well plates 1 x with HBSS and add hESC media.</li>
	<li>Using a 200 &#956;l pipette gently transfer 1/3 of the dissected colony into a 48-well plate for expansion. Transfer the other 2/3 of the dissected colony into a corresponding 96-well plate containing supplemented CM-MEF media.</li>
	<li>Maintain both plates by changing the media daily (supplemented CM-MEF media for 96-well matrigel coated plates and hESC media for 48-well plates containing MEFs; both supplemented with 0.5 &#956;g/ml&#160;puromycin).</li>
	<li>Expand until 96-well plates are 100% confluent and then initially screen via PCR.</li>
</ol>
5. Screening and Expansion of Positive Clones
<ol>
	<li>To prepare genomic DNA (method based on&#160;11) remove all media from plates by inverting, then blot onto paper towels.</li>
	<li>Rinse each well twice with RT PBS (100 &#181;l/well each wash), invert and blot as for step 5.1. Place plates at -80 &#176;C for 1 - 2 hr to aid in cell lysis (plates can be stored indefinitely like this).</li>
	<li>While cells are at -80 &#176;C make Sarcosyl Lysis Buffer (see Table 4) (50 &#181;l/well). To lyse cells, warm plates for 5 min at RT then pipette lysis buffer into each well. Seal the edges of each plate with tape, place in a sealable container containing moist paper towels to create humidity, and incubate O/N at 60 &#176;C.</li>
	<li>After incubation add 150 &#181;l of 5M NaCl to 10 ml of -20 &#176;C absolute ethanol, mix well, and add 100 &#181;l to each well (Note: ethanol will go cloudy when NaCl is added). Tap plates gently to mix (do not pipette) and leave for a minimum of 30 min at RT. During this time the solution will go clear and the DNA will precipitate.</li>
	<li>Remove solution as in step 5.1 then add 150 &#181;l of 70% ethanol to each well. Invert plate gently and blot as before. Repeat this step a further 2x. 
	Note: Because the precipitated DNA naturally adheres to the tissue culture plastic it does not become dislodged during these washing steps.)</li>
	<li>After the final wash briefly centrifuge plates at top speed to concentrate the DNA to the bottom of each well then air-dry at RT (or 37 &#176;C) for at least 30 min.</li>
	<li>Add 40 - 50 &#181;l T0.1E (pH8.0) (see Table 5) or TE (pH8.0) to each well and place plates at 65 &#176;C for 1 hr or at 4 &#176;C O/N before using for PCR. Resuspend DNA by gently tapping the sides of the plate. Use 1-2 &#181;l of re-suspended DNA/10 &#181;l PCR reaction.</li>
	<li>Using the Expand Long Template PCR System with hPITX3 L arm gen. F and hPITX3 L arm GFP R primers perform initial screening of clones at 58 &#176;C annealing, 45 sec extension, 35 cycles.</li>
	<li>Electrophorese samples with Hyperladder 1kb in a 1% agarose gel containing GelRed at 100 V for 45 min and detect positive clones via UV illumination.</li>
	<li>Validate PCR positive clones by digesting genomic DNA from expanded clones (see below) with HindIII and hybridizing probes 5&#8217; and 3&#8217; of the vector homology arms to a Southern blot (as previously described in 1). Probes are generated by PCR using primer pairs hPITX3 5&#8217; probe F and R, and hPITX3 3&#8217; probe F and R, digested with EcoRI and ligated into a general cloning vector.</li>
	<li>Depending on the number of positive clones, prepare 2 wells of a 6-well plate by pre-plating with MEFs (2.0 x 104 cells per cm2).</li>
	<li>The next day pretreat positive clones in the 48-well plate with 10 &#956;M Y-27632 for a minimum of 1 hr.</li>
	<li>Wash positive clones with HBSS and add 300 &#956;l of Accutase.</li>
	<li>When colonies are rendered single cells, add 1 ml of hESC media and collect into a 15 ml tube.</li>
	<li>Change the media daily. On day 2, Y-27632 can be withdrawn and cells grown in hESC media.</li>
	<li>When colonies are 70 - 80% confluent, subculture and freeze the remainder of the colony fragments.</li>
</ol>

<ol>
	<li>Nefzger, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lmx1a+Allows+Context-Specific+Isolation+of+Progenitors+of+GABAergic+or+Dopaminergic+Neurons+During+Neural+Differentiation+of+Embryonic+Stem+Cells.">Lmx1a Allows Context-Specific Isolation of Progenitors of GABAergic or Dopaminergic Neurons During Neural Differentiation of Embryonic Stem Cells.</a> Stem Cells. 30 (7), 1349-1361 (2012).</li><li>Zeng, W. R., Fabb, S. R. A., Haynes, J. M., Pouton, C. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extended+periods+of+neural+induction+and+propagation+of+embryonic+stem+cell-derived+neural+progenitors+with+EGF+and+FGF2+enhances+Lmx1a+expression+and+neurogenic+potential.">Extended periods of neural induction and propagation of embryonic stem cell-derived neural progenitors with EGF and FGF2 enhances Lmx1a expression and neurogenic potential.</a> Neurochemistry International. 59 (3), 394-403 (2011).</li><li>Collin, J., Lako, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Concise+review:+putting+a+finger+on+stem+cell+biology:+zinc+finger+nuclease-driven+targeted+genetic+editing+in+human+embryonic+stem+cells.">Concise review: putting a finger on stem cell biology: zinc finger nuclease-driven targeted genetic editing in human embryonic stem cells.</a> Stem Cells. 29 (7), 1021-1033 (2011).</li><li>Carroll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progress+and+prospects:+zinc-finger+nucleases+as+gene+therapy+agents.">Progress and prospects: zinc-finger nucleases as gene therapy agents.</a> Gene Therapy. 15 (22), 1463-1468 (2008).</li><li>Urnov, F. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+endogenous+human+gene+correction+using+designed+zinc-finger+nucleases.">Highly efficient endogenous human gene correction using designed zinc-finger nucleases.</a> Nature. 435 (7042), 646-651 (2005).</li><li>Hockemeyer, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+targeting+of+expressed+and+silent+genes+in+human+ESCs+and+iESCs+using+zinc-finger+nucleases.">Efficient targeting of expressed and silent genes in human ESCs and iESCs using zinc-finger nucleases.</a> Nature Biotechnology. 27 (9), 851-857 (2009).</li><li>Lombardo, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+editing+in+human+stem+cells+using+zinc+finger+nucleases+and+integrase-defective+lentiviral+vector+delivery.">Gene editing in human stem cells using zinc finger nucleases and integrase-defective lentiviral vector delivery.</a> Nature Biotechnology. 25 (11), (2007).</li><li>Boch, J., Bonas, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Xanthomonas+AvrBs3+family-type+III+effectors:+discovery+and+function.">Xanthomonas AvrBs3 family-type III effectors: discovery and function.</a> Annual Review of Phytopathology. 48, 419-436 (2010).</li><li>Hockemeyer, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+engineering+of+human+embryonic+cells+using+TALE+nucleases.">Genetic engineering of human embryonic cells using TALE nucleases.</a> Nature Biotechnology. 29 (8), 731-734 (2011).</li><li>Tucker, K. L., Wang, Y., Dausman, J., Jaenisch, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transgenic+mouse+strain+expressing+four+drug-selectable+marker+genes.">A transgenic mouse strain expressing four drug-selectable marker genes.</a> Nucleic Acids Research. 25 (18), 3745-3746 (1997).</li><li>Ram&#237;rez-Solis, R., Rivera-P&#233;rez, J., Wallace, J. D., Wims, M., Zheng, H., Bradley, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+DNA+microextraction:+a+method+to+screen+numerous+samples.">Genomic DNA microextraction: a method to screen numerous samples.</a> Analytical Biochemistry. 201 (2), 331-335 (1992).</li><li>Kawasaki, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+midbrain+dopaminergic+neurons+from+ES+cells+by+stromal+cell-derived+inducing+activity.">Induction of midbrain dopaminergic neurons from ES cells by stromal cell-derived inducing activity.</a> Neuron. 28 (1), 31-40 (2000).</li><li>Denham, M., Thompson, L. H., Leung, J., P&#233;bay, A., Bj&#246;rklund, A., Dottori, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gli1+is+an+inducing+factor+in+generating+floor+plate+progenitor+cells+from+human+embryonic+stem+cells.">Gli1 is an inducing factor in generating floor plate progenitor cells from human embryonic stem cells.</a> Stem Cells. 28 (10), 1805-1815 (2010).</li><li>Smidt, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+homeodomain+gene+Ptx3+has+highly+restricted+brain+expression+in+mesencephalic+dopaminergic+neurons.">A homeodomain gene Ptx3 has highly restricted brain expression in mesencephalic dopaminergic neurons.</a> Proceedings of the National Academy of Sciences U.S.A. 94, 13305-13310 (1997).</li></ol>

The authors have nothing to disclose.

The generation of reporter cell lines offers a powerful means to track, visualize and isolate cells of interest from a heterogeneous population derived from hESCs.&#160; However, gene targeting via conventional homologous recombination has proven to be extremely inefficient for human ESCs3.&#160; In this protocol we describe a relatively simple technique for introducing a RP into exon one of the PITX3 locus, in hESCs using a widely available targeting vector together with ZFNs.&#160; In our hands the ...

Current embryonic stem cell (ESC) differentiation protocols result in heterogeneous cell populations, particularly with respect to the derivation of specific neuronal phenotypes.&#160; Thus, although cultures contain the desired cellular phenotype, other neuronal, non-neuronal and un-differentiated cell types are often present1.&#160; These characteristics limit the application of ESC derived cell sources for use in cell replacement therapy and in vitro disease modeling.
Genetic reporter cell lines offer a means to visualize, track and isolate cells of interest, provided that the expression of the reporter protein (RP) reproduces endogenous expression.&#160; Use of promoters immediately upstream of a gene coding region can be used to derive crude genetic reporters but such constructs lack the precise regulatory elements that control endogenous gene expression.&#160; In contrast, homologous recombination offers the opportunity to ensure high-fidelity expression of the RP.&#160; In the past, targeting vectors designed for homologous recombination at specific loci of interest have been used to target RPs in mouse ESCs (mESCs) using electroporation as a means of DNA delivery1,2.&#160; However the generation of reporter cell lines via conventional homologous recombination is extremely inefficient for human ESCs (hESCs), and thus has only been documented in a handful of cases (reviewed in3). By using an engineered chimeric protein containing a fusion of a FokI nuclease with site-specific zinc-finger motifs, known collectively as zinc-finger nucleases (ZFNs), DNA double-strand breaks can be introduced at pre-determined genomic loci.&#160; When a DNA vector with homology to both sides of the DNA double strand break is added, the genomic site can be repaired by homologous recombination, allowing the incorporation of the DNA donor sequence. This technique has proved useful for genomic editing in both human primary cells4,5 and hESCs6,7.&#160; More recent work has utilized transcription activator-like effector nucleases (TALENs), transcription factors used by plant pathogens8, to aid in the design of site-specific nucleases9.
In the following protocol we demonstrate the generation of a hESC reporter cell line by electroporation of an EGFP containing homologous targeting vector6 together with ZFNs for the human Pituitary homeobox 3 (PITX3) locus.&#160; Following antibiotic selection for 2-3 weeks, hESCs with correctly integrated DNA can be manually picked, expanded and screened initially via PCR, and subsequently validated by Southern blotting.

<table border="0" cellpadding="0" cellspacing="0" width="883">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Mouse Embryonic Fibroblasts (DR4)</td>
			<td style="width:207px;">GlobalStem</td>
			<td style="width:119px;">GSC-6004G</td>
			<td style="width:67px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gelatin</td>
			<td style="width:207px;">Sigma</td>
			<td style="width:119px;">G1393-100ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">HBSS, no Calcium, no Magnesium, no Phenol Red (HBSS)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">14175-095</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Dispase</td>
			<td style="width:207px;">StemCell Technologies</td>
			<td style="width:119px;">7923</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Cell Scraper</td>
			<td style="width:207px;">Corning</td>
			<td style="width:119px;">3008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Accutase</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">A11105-01</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Y27632</td>
			<td style="width:207px;">Axon Medchem</td>
			<td style="width:119px;">Axon 1683</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Strainer - 40um</td>
			<td>BD Biosciences</td>
			<td>352340</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">33mm - 0.22 um filter</td>
			<td style="width:207px;">Millipore</td>
			<td style="width:119px;">SLGP033RS</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">rhFGF2</td>
			<td style="width:207px;">R&#38;D Systems</td>
			<td>233-FB-025/CF</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Electroporator</td>
			<td style="width:207px;">BioRad</td>
			<td style="width:119px;">165-2661</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">0.4cm electroporation cuvette</td>
			<td style="width:207px;">BioRad</td>
			<td style="width:119px;">165-2088</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Human TV-hPITX3-forward targeting construct</td>
			<td style="width:207px;">Addgene</td>
			<td style="width:119px;">31942</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:491px;">ZFN Kit; Human PITX3</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td style="width:119px;">CKOZFN1050-1KT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Puromycin</td>
			<td style="width:207px;">Invivogen</td>
			<td style="width:119px;">ant-pr-1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Matrigel</td>
			<td style="width:207px;">BD Biosciences</td>
			<td>354277</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Geltrex</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">A1569601</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">NaCl</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td>S3014</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td style="width:207px;">Life Technologies</td>
			<td>10566-016</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Fetal Bovine Serum, Qualified, Heat Inactivated, US Origin (FBS)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">16140-071</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Pen/Strep</td>
			<td style="width:207px;">Life Technologies</td>
			<td>15070-063</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Dulbecco&#39;s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">11320-033</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">KnockOut Serum Replacement (KSR)</td>
			<td style="width:207px;">Life Technologies</td>
			<td>10828-028</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">MEM Non-Essential Amino Acids&#160; (NEAA)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">11140-050</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">GlutaMAX</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">35050-061</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">&#223;-mercaptoethanol</td>
			<td style="width:207px;">Life Technologies</td>
			<td>21985-023</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">N-Lauroylsarcosine sodium salt solution (Sarcosyl) (30%)</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td style="width:119px;">61747</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">EDTA</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td><a href="http://www.sigmaaldrich.com/catalog/product/sial/e9884?lang=en&amp;region=US">E9884</a></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Trizma Hydrochloride</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td>T3253</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Proteinase K solution (20mg/ml)</td>
			<td style="width:207px;">Bioline Australia</td>
			<td>BIO-37084</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Expand Long Template PCR System</td>
			<td style="width:207px;">Roche Australia</td>
			<td style="width:119px;">11681834001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">hPITX3 L arm gen. F (primer): 5&#8217; TGTCCTAAGGAGAATGGGTAACAGACA 3&#8217;</td>
			<td style="width:207px;">GeneWorks, Australia</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:491px;">hPITX3 L arm GFP R (primer): 5&#8217; ACACGCTGAACTTGTGGCCGTTTA 3&#8217;</td>
			<td style="width:207px;">GeneWorks, Australia</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">HyperLadder 1kb&#160;</td>
			<td style="width:207px;">Bioline Australia</td>
			<td>BIO-33025</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:491px;">GelRed</td>
			<td style="width:207px;">Jomar Bioscience, Australia</td>
			<td style="width:119px;">41003</td>
			<td></td>
		</tr>
	</tbody>
</table>

zinc-finger nuclease enhanced gene targeting in human embryonic stem cells

One major limitation with current human embryonic stem cell (ESC) differentiation protocols is the generation of heterogeneous cell populations.&#160;These cultures contain the cells of interest, but are also contaminated with undifferentiated ESCs, non-neural derivatives and other neuronal subtypes.&#160; This limits their use in in vitro and in vivo applications, such as in vitro modeling for drug discovery or cell replacement therapy. To help overcome this, reporter cell lines, which offer a means to visualize, track and isolate cells of interest, can be engineered.&#160;However, to achieve this in human embryonic stem cells via conventional homologous recombination is extremely inefficient.&#160;This protocol describes targeting of the Pituitary homeobox 3 (PITX3) locus in human embryonic stem cells using custom designed zinc-finger nucleases, which introduce site-specific double-strand DNA breaks, together with a PITX3-EGFP-specific DNA donor vector. Following the generation of the PITX3 reporter cell line, it can then be differentiated using published protocols for use in studies such as in vitro Parkinson&#8217;s disease modeling or cell replacement therapy.

Following co-electroporation of the custom designed PITX3 zinc-finger pair together with the PITX3-EGFP-specific DNA donor vector, and subsequent puromycin selection, positive hESC clones were initially detected via genomic PCR screening (Figure 1). Southern blot hybridization of these PCR positive clones with 5&#8217; and 3&#8217; specific probes confirmed correct targeting to exon 1 of the PITX3 locus (Figure 2), with an efficiency of 19%. Immunofluo...

Watch this Scientific Journal Video about Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells at JoVE.com

Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells

Reporter cell lines offer a means to visualize, track and isolate cells of interest from heterogeneous populations.&#160;However, gene-targeting using conventional homologous recombination in human embryonic stem cells is extremely inefficient. Herein, we describe targeting CNS midbrain specific transcription factor PITX3 locus with EGFP using zinc-finger nuclease enhanced homologous recombination.

One major limitation with current human embryonic stem cell (ESC) differentiation protocols is the generation of heterogeneous cell ...

zinc-finger-nuclease-enhanced-gene-targeting-human-embryonic-stem

Research

JoVE Journal

Biology

10.7K Views.  Monash University. Reporter cell lines offer a means to visualize, track and isolate cells of interest from heterogeneous populations. However, gene-targeting using conventional homologous recombination in human embryonic stem cells is extremely inefficient. Herein, we describe targeting CNS midbrain specific transcription factor PITX3 locus with EGFP using zinc-finger nuclease enhanced homologous recombination.

Video: Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells

Propagation of Human Embryonic Stem (ES) Cells

Propagation of Human Embryonic Stem ES Cells

Rozprzestrzenianie się człowieka zarodkowych komórek macierzystych (ES) Cells

Derivation of Human Embryonic Stem Cells by Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass. 


The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass.

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both ...

Probing for Mitochondrial Complex Activity in Human Embryonic Stem Cells

Mitochondria are cytoplasmic organelles that have a primary role in cellular metabolism and homeostasis, regulation of the cell signaling network, and programmed cell death. Mitochondria produce ATP, regulate the cytoplasmic redox state and Ca2+ balance, catabolize fatty acids, synthesize heme, nucleotides, steroid hormones, amino acids, and help assemble iron-sulfur clusters in proteins. Mitochondria also have an essential role in heat production. Mutations of the mitochondrial genome cause several types of human disorder. The accumulation of mtDNA mutations correlates with aging and is suspected to have an important role in the development of cancer. Due to their vitally important role in all cell types, the function of mitochondria must also be critical for stem cells. Key advances have been made in our understanding of stem cell viability, proliferation, and differentiation capacity. But the functional activity of stem cells, in particular their energy status, was not yet been studied in detail. Almost nothing is known about the mitochondrial properties of human embryonic stem cells (hESCs) and their differentiated precursor progeny. One way to understand and evaluate the role of mitochondria in hESC function and developmental potential is to directly measure the activity of mitochondrial respiratory complexes. Here, we describe high resolution clear native gel electrophoresis and subsequent in gel activity visualization as a method for analyzing the five respiratory chain complexes of hESCs.

In this video, we will show you how the mitochondrial respiratory chain complexes of human embryonic stem cells can be analyzed using in gel activity assays.

Mitochondria are cytoplasmic organelles that have a primary role in cellular metabolism and homeostasis, regulation of the cell signaling network, and ...

In vitro and in vivo Bioluminescence Reporter Gene Imaging of Human Embryonic Stem Cells

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative medicine. However, direct injection of hESCs, and cells differentiated from hESCs, into living organisms has thus far been hampered by significant cell death, teratoma formation, and host immune rejection. Understanding the in vivo hESC behavior after transplantation requires novel imaging techniques to longitudinally monitor hESC localization, proliferation, and viability. Molecular imaging has given investigators a high-throughput, inexpensive, and sensitive means for tracking in vivo cell proliferation over days, weeks, and even months. This advancement has significantly increased the understanding of the spatio-temporal kinetics of hESC engraftment, proliferation, and teratoma-formation in living subjects.

A major advance in molecular imaging has been the extension of noninvasive reporter gene assays from molecular and cellular biology into in vivo multi-modality imaging platforms. These reporter genes, under control of engineered promoters and enhancers that take advantage of the host cell s transcriptional machinery, are introduced into cells using a variety of vector and non-vector methods. Once in the cell, reporter genes can be transcribed either constitutively or only under specific biological or cellular conditions, depending on the type of promoter used. Transcription and translation of reporter genes into bioactive proteins is then detected with sensitive, noninvasive instrumentation (e.g., CCD cameras) using signal-generating probes such as D-luciferin.

To avoid the need for excitatory light to track stem cells in vivo as is required for fluorescence imaging, bioluminescence reporter gene imaging systems require only an exogenously administered probe to induce light emission. Firefly luciferase, derived from the firefly Photinus pyralis, encodes an enzyme that catalyzes D-luciferin to the optically active metabolite, oxyluciferin. Optical activity can then be monitored with an external CCD camera. Stably transduced cells that carry the reporter construct within their chromosomal DNA will pass the reporter construct DNA to daughter cells, allowing for longitudinal monitoring of hESC survival and proliferation in vivo. Furthermore, because expression of the reporter gene product is required for signal generation, only viable parent and daughter cells will create bioluminescence signal; apoptotic or dead cells will not. 

In this video, the specific materials and methods needed for tracking stem cell proliferation and teratoma formation with bioluminescence imaging will be described.

With the growing interest in stem cell therapies, molecular imaging techniques are ideal for monitoring stem cell behavior after transplantation. Luciferase reporter genes have enabled non-invasive, repetitive assessment of cell survival, location, and proliferation in vivo. This video will demonstrate how to track hESC proliferation in a living mouse.

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative ...

Chromatin Immunoprecipitation from Human Embryonic Stem Cells

The functional and structural complexity of the myriad of cells in metazoan organisms arises from a small number of stem cells. Stem cells are characterized by two fundamental properties: self-renewal and multipotency that allows a stem cell to differentiate into virtually any cell type 1. The progression stem cell to differentiated cell is characterized by loss of multipotency, structural and morphological changes and the hierarchic activity of transcription factors and signaling molecules, whose activities establish and maintain cell-type specific gene expression patterns. At the molecular level, cell differentiation involves dynamic changes of the structure and composition of chromatin and the detection of those dynamic changes can provide valuable insights into the functional features of stem cells and the cell differentiation process 2,3. Chromatin is a highly compacted DNA-protein complex that forms when cells package chromosomal DNA with proteins, mainly histones 4. Stemcellness and cell differentiation has been correlated with the presence of specific arrays of regulatory proteins such as epigenetic factors, histone variants, and transcription factors 2,3,5.
 Chromatin immunoprecipitation (ChIP) provides a valuable method to monitor the presence of RNA, proteins, and protein modifications in chromatin 6,7. The comparison of chromatin from different cell types can elucidate dynamic changes in protein-chromatin associations that occur during cell differentiation.
Chromatin immunoprecipitation involves the purification of in vivo cross-linked chromatin. The isolated chromatin is reduced to smaller fragments by enzymatic digestion or mechanical force. Chromatin fragments are precipitated using specific antibodies to target proteins or protein and DNA modifications. The precipitated DNA or RNA is purified and used as a template for PCR or DNA microarray based assays. Prerequisites for a successful ChIP are high quality antibodies to the desired antigen and the availability of chromatin from control cells that do not express the target molecule. ChIP can correlate the presence of proteins, protein and RNA modifications, and RNA with specific target DNA, and depending on the choice of outread tool, detects the association of target molecules at specific target genes or in the context of an entire genome. The comparison of the distribution of proteins in the chromatin of differentiating cells can elucidate the dynamic changes of chromatin composition that coincide with the progression of cells along a cell lineage.

The differentiation of ESC coincides with cell-type specific changes in the structure and composition of chromatin. The detection of those changes provides valuable insights into the mechanisms that define stemcellness and cell differentiation. Chromatin immunoprecipitation (ChIP) represents a valuable method to dissect the molecular mechanisms underlying stem cell differentiation.

The functional and structural complexity of the myriad of cells in metazoan organisms arises from a small number of stem cells. Stem cells are ...

In vitro Labeling of Human Embryonic Stem Cells for Magnetic Resonance Imaging

Human embryonic stem cells (hESC) have demonstrated the ability to restore the injured myocardium. Magnetic resonance imaging (MRI) has emerged as one of the predominant imaging modalities to assess the restoration of the injured myocardium. Furthermore, ex-vivo labeling agents, such as iron-oxide nanoparticles, have been employed to track and localize the transplanted stem cells. However, this method does not monitor a fundamental cellular biology property regarding the viability of transplanted cells. It has been known that manganese chloride (MnCl2) enters the cells via voltage-gated calcium (Ca2+) channels when the cells are biologically active, and accumulates intracellularly to generate T1 shortening effect. Therefore, we suggest that manganese-guided MRI can be useful to monitor cell viability after the transplantation of hESC into the myocardium.
In this video, we will show how to label hESC with MnCl2 and how those cells can be clearly seen by using MRI in vitro. At the same time, biological activity of Ca2+-channels will be modulated utilizing both Ca2+-channel agonist and antagonist to evaluate concomitant signal changes.

In this video, we are showing how to label human embryonic stem cells (hESC) with manganese chloride (MnCl2) which can enter cells via voltage-gated calcium channels when the cells are biologically active. Additionally, we show the use of MnCl2 as cellular MRI contrast agent to determine the in vitro viability of hESC.

Human embryonic stem cells (hESC) have demonstrated the ability to restore the injured myocardium. Magnetic resonance imaging (MRI) has emerged as one of ...

Culture and Maintenance of Human Embryonic Stem Cells  

Human embryonic stem (hES) cells must be monitored and cared for in order to maintain healthy, undifferentiated cultures. At minimum, the cultures must be  fed  every day by performing a complete medium change to replenish lost nutrients and to keep the cultures free of unwanted differentiation factors. Although a small amount of differentiation is normal and expected in stem cell cultures, the culture should be routinely cleaned up by manually removing, or "picking" differentiated areas. Identifying and removing excess differentiation from hES cell cultures are essential techniques in the maintenance of a healthy population of cells.

Culture and Maintenance of Human Embryonic Stem Cells

This protocol demonstrates how to maintain healthy, undifferentiated human embryonic stem (ES) cells.

Human embryonic stem (hES) cells must be monitored and cared for in order to maintain healthy, undifferentiated cultures. At minimum, the cultures must be ...

Freezing and Thawing Human Embryonic Stem Cells

Since James Thomson et al developed a technique in 1998 to isolate and grow hES in culture, freezing cells for later use and thawing and expanding cells from a frozen stock have become important procedures performed in routine hES cell culture. Since hES cells are very sensitive to the stresses of freezing and thawing, special care must taken. Here we demonstrate the proper technique for rapidly thawing hES cells from liquid nitrogen stocks, plating them on mouse embryonic feeder cells, and slowly freezing them for long-term storage.

Since James Thomson et al developed a technique in 1998 to isolate and grow hES in culture, freezing cells for later use and thawing and expanding cells from a frozen stock have become important procedures performed in routine hES cell culture. Since hES cells are very sensitive to the stresses of freezing and thawing, special care must taken. Here we demonstrate the proper technique for rapidly thawing hES cells from liquid nitrogen stocks, plating them on mouse embryonic feeder cells, and slowly freezing them for long-term storage.

Since James Thomson et al developed a technique in 1998 to isolate and grow hES in culture, freezing cells for later use and thawing and expanding cells ...

Differentiation of Embryonic Stem Cells into Oligodendrocyte Precursors

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant interest in deriving a pure population of lineage-committed oligodendrocyte precursor cells (OPCs) for transplantation. OPCs are characterized by the activity of the transcription factor Olig2 and surface expression of a proteoglycan NG2. Using the GFP-Olig2 (G-Olig2) mouse embryonic stem cell (mESC) reporter line, we optimized conditions for the differentiation of mESCs into GFP+Olig2+NG2+ OPCs. In our protocol, we first describe the generation of embryoid bodies (EBs) from mESCs. Second, we describe treatment of mESC-derived EBs with small molecules: (1) retinoic acid (RA) and (2) a sonic hedgehog (Shh) agonist purmorphamine (Pur) under defined culture conditions to direct EB differentiation into the oligodendroglial lineage. By this approach, OPCs can be obtained with high efficiency (&gt;80%) in a time period of 30 days. Cells derived from mESCs in this protocol are phenotypically similar to OPCs derived from primary tissue culture. The mESC-derived OPCs do not show the spiking property described for a subpopulation of brain OPCs in situ. To study this electrophysiological property, we describe the generation of spiking mESC-derived OPCs by ectopically expressing NaV1.2 subunit. The spiking and nonspiking cells obtained from this protocol will help advance functional studies on the two subpopulations of OPCs.

We describe a small molecule-based protocol for differentiation of mouse embryonic stem cells into oligodendrocyte precursor cells (OPCs). This protocol generates Olig2+NG2+ OPCs with high efficiency by 30 days of differentiation. We also describe a method to generate "spiking" OPCs that can fire action potentials.

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant ...

Fate Mapping of Human Embryonic Stem Cells by Teratoma Formation

Human embryonic stem cells (hESCs) have an unlimited capacity for self-renewal, and the ability to differentiate into cells derived from all three embryonic germ layers (1). Directed differentiation of hESCs into specific cell types has generated much interest in the field of regenerative medicine (e.g., (2-5)), and methods for determining the in vivo fate of selected or manipulated hESCs are essential to this endeavor. We have adapted a highly efficient teratoma formation assay for this purpose. A small number of specifically selected hESCs is mixed with undifferentiated wild type hESCs and Phaseolus vulgaris lectin to form a cell pellet. This is grafted beneath the kidney capsule in an immunodeficient mouse. As few as 2.5 x 105 hESCs are needed to form a 16 cm3 teratoma within 8-12 weeks. The fate of the originally selected hESCs can then be determined by immunohistochemistry. This method provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.

Directed differentiation of hESCs into specific cells has generated much interest in regenerative medicine. We provide a concise, step-by-step protocol for determining the in vivo fate of selected hESCs that provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.