이 프로토콜에 설명 된 작품은 재생 의료에 대한 캘리포니아 연구소 (CIRM)와 공동 제휴의 일환으로 빅토리아 정부에서 자금을 지원에 의해 가능하게되었다.

모든 과정은 무균 층류 후드에서 수행된다. 달리 지정하지 않는 한 모든 미디어 및 솔루션은 37 ° C 평형을하고 있습니다. 형질에 대한 (이 프로토콜에 사용되는 인간 배아 줄기 및 hiPSCs, WA-09) 인간의 PSC를 1. 확장 참고 : 마트 리겔 또는 Geltrex에 인간 배아 줄기을 확장 할 필요가 없습니다. 마우스 배아 섬유 아 세포 (MEFs)에 확장 된 인간 배아 줄기는 MEF 제거 단계 다음 일렉트로 또는 nucleofection 사용할 수 있습니다 (2.8 절 참조). <ol><li> 1 × 100mm 요리와 MEF 미디어 cm 2 당 2.0 × 10 4 세포에서 DR4 MEFs의 1 개 75cm2 플라스크를 준비 / V 젤라틴 w 0.1 %로 사전 코팅 요리에 (표 1 참조). 주 : CF1, BLK6 또는 MF1 MEFs를 사용할 수있다, 그러나, 예를 들면, DR410, 항생제 내성 MEF 라인을 사용하는 것이 권장된다. </li><li> 다음날, 100mm 접시 위에 통로 인간 배아 줄기 섹션 1.1에서 준비 MEFs가 미리 도금. 이 ASPI을 수행하려면문화 요리에 환율이 hESC의 미디어,의 Ca2 + /의 Mg2 + - 무료 행크스 &#39;균형 염 용액 (HBSS)와 인간 배아 줄기를 씻어, 37 ° C / 5 % CO 2에서 가습 배양기에서 디스 파제 (해당 볼륨에 대한 표 2 참조)과 장소를 추가 할 수 있습니다. MEFs를 제거하는 HBSS로 2 회 - 3 ~ 5 분 배양 후, 부드럽게 흡인 디스 파제와 한을 씻는다. 부드럽게 배양 접시의 표면에서 식민지를 다쳤고, hESC의 미디어 (표 3 참조) 셀 스크레이퍼를 사용하여, 5 ml의 피펫을 추가합니다. </li><li> 15 ㎖의 원심 분리 관에 배양 접시에서 서스펜션의 식민지 조각을 수집합니다. hESC의 미디어와 15 ML 튜브로 전송 헹구고 배양 접시. 단일 세포 또는 작은 조각으로 대단히 짧은 시간을 휴식하지 않도록주의하십시오. </li><li> 식민지 조각을 펠렛 160 XG에서 5 분 동안 원심 분리기. </li><li> 기음 뜨는. 식민지 조각 펠릿을 풀어 손가락으로 15 ML 튜브의 바닥을 누릅니다. 분할 비율에 따라 hESC의 미디어에 부드럽게 재현 탁 식민지 조각 (normall4 일 : 8 적합한) 나중에 일 사이에 비율을 분할합니다. 효율성을 replating 영향을 미칠 것이 아니라 단일 세포 또는 작은 조각으로 대단히 짧은 렌더링하지 않도록 각별히주의해야합니다. </li><li> MEFs가 HBSS로 1 배 세척에 hESC의 조각을 replating 이전. 천천히 요리 MEFs가 사전에 도금 hESC의 매체에 hESC의 단편을 함유하는 세포 현탁액의 적당량 (표 2 참조) 추가한다. </li><li> 인큐베이터에있는 선반에 배양 접시를 놓고 고르게 식민지 조각을 배포 좌우로 앞뒤로 및 측면 천천히 이동합니다. </li><li> 매일 hESC의 미디어를 교체합니다. </li><li> MEFs (MEF-CM)에서 에어컨 미디어를 준비하기 위해 씻어 75cm 2 플라스크 MEFs HBSS로 1 개에 사전 도금. hESC의 미디어를 추가합니다. 24 시간을 따라 미디어를 조절하고 신선한 hESC의 미디어로 교체 수집합니다. 십이일 최대 매일 반복합니다. 필요할 때까지 4 ° C에서 MEF-CM을 저장합니다. </li></ol> 형질에 대한 인간의 ESCS의 2 준비 <ol><li> 인간 배아 줄기의 성장을 관찰매일 현미경. 식민지 40~50% 합류, 판 cm 2 당 2.0 × 10 5 MEFs와 3 × 100mm 요리 될 때. </li><li> 식민지가 60이 될 때 - 70 %의 합류 그들은 형질 전환 할 준비가 된 것입니다. 차별화 된 식민지 또는 식민지 코어를 제거하여 &#39;신랑&#39;식민지. 참고 : 우리는 높은 형질을 믿고 세포가 로그 위상 성장에있을 때 목표로 효율성이 발생, 그것은 인간 배아 줄기는 ≥ 70 % 포화 상태에 도달하기 전에 일렉트로이 실시하는 것이 좋습니다. </li><li> HBSS와 hESC의 식민지를 씻고 Accutase를 추가합니다. 참고 : ROCK 억제제에 미리 치료 인간 배아 줄기 필요가 없습니다 Y-27632 단계 2.7시 Y-27632와 함께 배양 할 때 충분한 억제가 발생합니다 </li><li> 37 ° C / 5 현미경으로 볼 때 식민지 단일 셀을 렌더링 할 때까지 %의 CO 2시 20 분 - 10 알을 품다. 1 ML의 피펫 씹다 세포. </li><li> 40 μm의 셀 straine를 사용하여 15 ML 원뿔 튜브에 hESC의 미디어와 필터를 추가세포 덩어리를 제거하려면 r. </li><li> 5 분 동안 160 XG에 원심 분리기. 신선한 hESC의 미디어에 재현 탁 세포 펠렛 및 잔여 Accutase 솔루션을 제거하는 반복합니다. </li><li> 10 μM Y-27632 및 100mm 접시에 총 세포 현탁액을 전송이 젤라틴으로 코팅 된 사전이 포함 hESC의 미디어에 재현 탁 세포. </li><li> 30 분의 최소 37 ° C / 5 % CO 2에서 품어. </li><li> 이 시간 동안 MEFs는 젤라틴 코팅 접시에 부착됩니다. 신선한 15 ML의 원심 분리기 튜브에 1 ㎖의 피펫을 사용하여 비 부착 인간 배아 줄기를 수집하고 혈구를 사용하여 셀 밀도를 결정한다. </li></ol> 인간 배아 줄기의 3 일렉트로 <ol><li> 0.22 μm의 필터 및 추가 10 NG / ml의 재조합 인간 섬유 아세포 성장 인자 2 (rhFGF2)를 사용하여 필터 CM-MEF 매체. </li><li> 5 분 동안 160 XG에서 새로운 15 ML 원뿔 튜브와 원심 분리기 섹션 2.9에서 7.5 × 106 인간 배아 줄기을 전송합니다. </li><li> 지수 전자 업계를위한 선택 프로그램 : electroporator를 설정이 시간 동안250 V, 용량 : ctroporation는 다음과 같은 매개 변수, 전압 설정 500 μF, 그리고 저항 : ∞-. </li><li> 뜨는을 기음과 얼음처럼 차가운 0.22 μm의 여과 HBSS의 0.8 ml의 세포 펠렛을 다시 일시 중지합니다. 멸균 0.4 cm의 일렉트로 큐벳에 솔루션을 전송합니다. </li><li> TV-hPITX3 앞으로 타겟팅 구조 (30 μg DNA)를 추가하고 200 μL 피펫으로 가볍게 섞는다. 5 분 동안 얼음 위에서 배양한다. 이 시간 동안 PITX3 ZFN의 mRNA 한 나누어지는 제거하고 얼음에 해동. 전기 천공 큐벳에 DNA / 세포 혼합물에 전송에게 ZFN의 mRNA의 7.5 μl를 해동합니다. 200 μL 피펫으로 가볍게 섞는다. 주 : 타겟팅되는 궤적은 효율에 기여 타겟팅 주요 요인이다. 이러한 PITX3 같은 유전자 침묵, ESCS 표현하지 유전자가 어려운 궤적 인코딩은 종래의 상 동성 재조합 (6)을 대상으로하여. 따라서,이 프로토콜은 사용자 DNA 이중 가닥을 유도하기 위해 B 인간 PITX3 궤적 위해 활용한다 ZFNs 설계reak. </li><li> electroporator의 화면 지침에 따라 Electroporate. </li><li> 200 μL 피펫 10ml로 hESC의 매체를 함유하는 15 ㎖의 튜브에 전기 천공 큐벳에서 컨텐츠를 전송할 사용. hESC의 매체의 200 ㎕의 15 ML 튜브 각 시간과 전송 두 번 큐벳을 씻으십시오. 가있을 것 &quot;점액 같은&quot;파편에 부정적인 세포 생존에 영향을 미칠 용해 세포에서 DNA와 단백질로 구성. 이 파편을 제거하기 위해 5 분 동안 160 XG에 원심 분리기. </li><li> 뜨는을 대기음 부드럽게 풀어 세포 펠렛을 누릅니다. 10 μM Y-27632을 포함 MEF-CM 보충 30 ㎖에 다시 일시 중지하고 MEFs와 예비 도금 3 × 100mm 요리에 replate. </li><li> 매일 미디어를 변경합니다. 2 일에, Y-27632는 회수 될 수 있고 세포는 hESC의 미디어 만 재배. </li><li> 2-3일 후 인간 배아 줄기는 50-70% 합류해야한다. 이 시점에서 항생제 선택 (예를 들어, 0.5 μg / ㎖의 퓨로 마이신)를 시작합니다. </li><li> 셀프 유지매일 신선한 hESC의 / 퓨로 마이신 미디어를 추가하여 ection. ~ 칠일 후에 작은 콜로니를 볼 수 있어야합니다. 항생제 내성 MEFs를 사용하지 않는 경우는 MEFs cm 당 2 부가 1.0 × 104 세포를 첨가하여 보충 할 수있다. </li></ol> 4 따기 형질 전환 hESC의 클론 <ol><li> 약 14 - (식민지 ~ 1mm 직경에 도달 한) 선택 다음 21 일 확장과 심사에 대 한 번호판을 준비합니다. 5 시간의 최소 4 ° C에서 마트 리젤 또는 Geltrex의 분취 량을 해동하여 시작합니다. 제조업체의 지침에 따라 희석하고 3 × 96 - 웰 플레이트의 각 웰에 75 μl를 추가합니다. cm 2 당 2.0 × 10 4 세포에 MEFs을 도금 3 × 48 - 웰 플레이트를 준비합니다. 37 ° C / 5 % CO 2에서 두 판 O / N을 품어. </li><li> 다음날 격자를 절단하여 2 ml의 피펫의 끝에서 21 G 바늘을 사용하여 16-25 개로 콜로니 해부. </li><li> 기음 96 - 웰 플레이트에서 마트 리젤과 supplem로 교체ented CM-MEF 미디어. 48 - 웰 플레이트 한 HBSS와 x와 hESC의 미디어를 추가 씻으 MEFs. </li><li> 200 μL 피펫을 사용하여 부드럽게 확장을 위해 48 웰 플레이트에 해부 식민지의 3 분의 전송할 수 있습니다. 보충 CM-MEF 매체를 함유 대응 96 웰 플레이트로 해부 콜로니의 다른 2/3 옮긴다. </li><li> 매일 미디어를 변경하여 두 판을 유지 (MEFs를 포함하는 48 웰 플레이트에 96 웰 마트 리겔 코팅 플레이트와 hESC의 미디어를 CM-MEF 매체를 보완, 모두 0.5 μg / ml의 퓨로 마이신으로 보충). </li><li> 96 - 웰 플레이트가 100 % 합류 된 후 초기 PCR을 통해 화면까지 확대. </li></ol> (5) 검사 및 긍정적 인 클론의 확장 <ol><li> 게놈 DNA (11에 따라 방법을) 준비 반전 판에서 모든 미디어를 제거하려면 다음 종이 타월에시킨다. </li><li> RT PBS (100 μL / 웰 각 세척), 단계 5.1로 반전하고 오와 각 웰에 두 번 씻어. -80 ° C의 F에서 장소 판또는 1-2 시간이 세포 용해에 도움 (플레이트는 다음과 같이 무한정에 저장 될 수 있습니다.) </li><li> 세포가 Sarcosyl 용해 버퍼를 만들 C -80 °에있는 동안 (표 4 참조) (50 μL / 웰). 각 웰에 5 다음 실온에서 분 피펫 용해 버퍼 세포, 따뜻한 판을 용해합니다. 습도를 만들 촉촉한 종이 타월을 포함하는 밀봉 용기에 테이프, 장소, 각 판의 가장자리를 밀봉하고, 60 ° C에서 O / N을 배양한다. </li><li> 배양 후, -20 ° C 무수 에탄올 10 ㎖에 500의 NaCl 150 μl를 추가 잘 혼합하고, 각 웰에 100 μl를 추가 (참고 : NaCl을 추가 할 때 에탄올 흐린 갈 것입니다). 탭 판 부드럽게 믹스 (안 피펫을) 및 RT에서 30 분의 최소 떠나. 이 시간 동안 용액은 맑은 꺼지고 DNA가 침전된다. </li><li> 다음 각 웰에 70 % 에탄올 150 μl를 추가 단계 5.1에서와 같이 솔루션을 제거합니다. 부드럽게 접시 전환 및 이전시킨다. 이 단계 더 배를 반복합니다. 참고 : 때문에 침전 된 DNA 자연스럽게 adhE 유전자조직 배양 플라스틱에 입술은 이러한 세척 단계 동안에서 이탈하지 않습니다.) </li><li> 최종 세척 후 최고 속도로 간단히 원심 분리 판은 적어도 30 분 동안 실온에서 각 웰 후 자연 건조의 하단 (또는 37 ° C)에 DNA를 집중합니다. </li><li> 40 추가 - 50 μL의 T0.1E (pH8.0)을 1 시간 동안 65 ° C에서 각 웰과 장소 플레이트 또는 TE (pH8.0) (표 5 참조) 또는 4 ° CO / N PCR을 위해 사용하기 전에. 부드럽게 플레이트의 측면을 활용하여 DNA를 재현 탁. 다시 중단 DNA / 10 ㎕의 PCR 반응의 1-2 μl를 사용합니다. </li><li> 이 hPITX3의 L 팔 세대와 긴 템플릿 PCR 시스템을 확장 사용. F 및 hPITX3의 L 팔 GFP의 R 프라이머는 58 ° C에서 어닐링, 45 초 연장, 35 사이클에서 클론의 초기 검사를 수행합니다. </li><li> 1 % 아가 로스 젤 Hyperladder의 1킬로바이트와 Electrophorese 샘플은 45 분 동안 100 V에서 GelRed 및 UV 조명을 통해 긍정적 인 클론을 감지 함유. </li><li> expa에서 게놈 DNA를 소화하여 PCR 긍정적 인 클론의 유효성을 검사남부 오 점에 벡터 동성 팔을 HindIII 및 혼성화 프로브 5 &#39;와 3&#39;와 nded 클론 (아래 참조) (이전에 하나의 설명 참조). 프로브는 프라이머 쌍 hPITX3 5 &#39;프로브 F와 R, 및 hPITX3 3&#39;프로브 F와 R,를 EcoRI으로 절단하며, 일반적인 클로닝 벡터에 라이 게이션을 사용하여 PCR에 의해 생성됩니다. </li><li> 양성 클론의 수에 따라, MEFs (2 cm 당 2.0 × 104 세포)와 전도금하여 6 - 웰 플레이트의 웰 (2)을 준비한다. </li><li> 그 다음날은 1 시간의 최소 10 μM Y-27632와 함께 48 웰 플레이트에 긍정적 인 클론을 전처리. </li><li> HBSS에 긍정적 인 클론을 씻고 Accutase의 300 μl를 추가합니다. </li><li> 식민지 단일 셀을 렌더링 할 때, hESC의 미디어 1 ㎖를 추가하고 15 ML 튜브에 수집합니다. </li><li> 매일 미디어를 변경합니다. 일이에, Y-27632 철회 할 수 있으며, 세포는 hESC의 미디어에서 성장. </li><li> 80 % 합류, 계대하고 깔깔 나머지 동결 - 콜로니 70되면뉴욕 조각. </li></ol>

<ol>
	<li>Nefzger, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lmx1a+Allows+Context-Specific+Isolation+of+Progenitors+of+GABAergic+or+Dopaminergic+Neurons+During+Neural+Differentiation+of+Embryonic+Stem+Cells.">Lmx1a Allows Context-Specific Isolation of Progenitors of GABAergic or Dopaminergic Neurons During Neural Differentiation of Embryonic Stem Cells.</a> Stem Cells. 30 (7), 1349-1361 (2012).</li><li>Zeng, W. R., Fabb, S. R. A., Haynes, J. M., Pouton, C. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extended+periods+of+neural+induction+and+propagation+of+embryonic+stem+cell-derived+neural+progenitors+with+EGF+and+FGF2+enhances+Lmx1a+expression+and+neurogenic+potential.">Extended periods of neural induction and propagation of embryonic stem cell-derived neural progenitors with EGF and FGF2 enhances Lmx1a expression and neurogenic potential.</a> Neurochemistry International. 59 (3), 394-403 (2011).</li><li>Collin, J., Lako, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Concise+review:+putting+a+finger+on+stem+cell+biology:+zinc+finger+nuclease-driven+targeted+genetic+editing+in+human+embryonic+stem+cells.">Concise review: putting a finger on stem cell biology: zinc finger nuclease-driven targeted genetic editing in human embryonic stem cells.</a> Stem Cells. 29 (7), 1021-1033 (2011).</li><li>Carroll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progress+and+prospects:+zinc-finger+nucleases+as+gene+therapy+agents.">Progress and prospects: zinc-finger nucleases as gene therapy agents.</a> Gene Therapy. 15 (22), 1463-1468 (2008).</li><li>Urnov, F. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+endogenous+human+gene+correction+using+designed+zinc-finger+nucleases.">Highly efficient endogenous human gene correction using designed zinc-finger nucleases.</a> Nature. 435 (7042), 646-651 (2005).</li><li>Hockemeyer, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+targeting+of+expressed+and+silent+genes+in+human+ESCs+and+iESCs+using+zinc-finger+nucleases.">Efficient targeting of expressed and silent genes in human ESCs and iESCs using zinc-finger nucleases.</a> Nature Biotechnology. 27 (9), 851-857 (2009).</li><li>Lombardo, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+editing+in+human+stem+cells+using+zinc+finger+nucleases+and+integrase-defective+lentiviral+vector+delivery.">Gene editing in human stem cells using zinc finger nucleases and integrase-defective lentiviral vector delivery.</a> Nature Biotechnology. 25 (11), (2007).</li><li>Boch, J., Bonas, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Xanthomonas+AvrBs3+family-type+III+effectors:+discovery+and+function.">Xanthomonas AvrBs3 family-type III effectors: discovery and function.</a> Annual Review of Phytopathology. 48, 419-436 (2010).</li><li>Hockemeyer, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+engineering+of+human+embryonic+cells+using+TALE+nucleases.">Genetic engineering of human embryonic cells using TALE nucleases.</a> Nature Biotechnology. 29 (8), 731-734 (2011).</li><li>Tucker, K. L., Wang, Y., Dausman, J., Jaenisch, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transgenic+mouse+strain+expressing+four+drug-selectable+marker+genes.">A transgenic mouse strain expressing four drug-selectable marker genes.</a> Nucleic Acids Research. 25 (18), 3745-3746 (1997).</li><li>Ram&#237;rez-Solis, R., Rivera-P&#233;rez, J., Wallace, J. D., Wims, M., Zheng, H., Bradley, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+DNA+microextraction:+a+method+to+screen+numerous+samples.">Genomic DNA microextraction: a method to screen numerous samples.</a> Analytical Biochemistry. 201 (2), 331-335 (1992).</li><li>Kawasaki, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+midbrain+dopaminergic+neurons+from+ES+cells+by+stromal+cell-derived+inducing+activity.">Induction of midbrain dopaminergic neurons from ES cells by stromal cell-derived inducing activity.</a> Neuron. 28 (1), 31-40 (2000).</li><li>Denham, M., Thompson, L. H., Leung, J., P&#233;bay, A., Bj&#246;rklund, A., Dottori, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gli1+is+an+inducing+factor+in+generating+floor+plate+progenitor+cells+from+human+embryonic+stem+cells.">Gli1 is an inducing factor in generating floor plate progenitor cells from human embryonic stem cells.</a> Stem Cells. 28 (10), 1805-1815 (2010).</li><li>Smidt, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+homeodomain+gene+Ptx3+has+highly+restricted+brain+expression+in+mesencephalic+dopaminergic+neurons.">A homeodomain gene Ptx3 has highly restricted brain expression in mesencephalic dopaminergic neurons.</a> Proceedings of the National Academy of Sciences U.S.A. 94, 13305-13310 (1997).</li></ol>

저자가 공개하는 게 없다.

리포터 세포주의 생성은, 추적 시각화하고 인간 배아 줄기 유래의 이종 집단으로부터 관심 세포를 분리하기위한 강력한 수단을 제공한다. 그러나, 기존의 상동 재조합을 통해 표적 유전자는 인간의 ESCS 3 매우 비효율적 인 것으로 입증되었습니다. 이 프로토콜에서는 ZFNs 함께 널리 타겟팅 벡터를 이용하여 인간 배아 줄기에서 엑손 PITX3 궤적 중 하나에 RP를 도입하는 비교적 간단한 ?...

현재 배아 줄기 세포 (ESC) 분화 프로토콜은 특히 특정 신경 표현형의 유도와 관련하여, 이종 세포 집단에서 발생. 배양이 원하는 세포 표현형, 다른 신경 세포가 포함되지만 이에 따라, 비 - 신경 세포와 분화되지 않은 세포 유형은 종종 하나 존재한다. 이러한 특성은 ESC의 적용 세포 대체 요법에 사용하기위한 시험 관내 및 질병 모델링 셀 소스를 유도 제한한다. 유전자 리포터 세포주 시각화 추적 관심 셀을 분리하는 수단을 제공하는, 리포터 단백질 (RP)의 발현은 내인성 발현을 재현 한한다. 유전자 코딩 영역의 바로 상류 프로모터의 사용은 유전자 조 기자를 유도하는 데 사용될 수 있지만, 이러한 구조는 내인성 유전자 발현을 제어하는​​ 조절 요소 정확한 부족하다. 대조적으로, 상 동성 재조합이 구비기회는 RP의 고품질 표현을 보장합니다. 과거에, 관심있는 특정 유전자좌에 상 동성 재조합을 위해 설계된 벡터를 표적으로하는 DNA 1,2 전달하는 수단으로 전기 천공을 사용하여 마우스 ESCS (mESCs)에서의 RP를 대상으로 사용되어왔다. 그러나 종래의 상 동성 재조합을 통해 리포터 세포주의 생성 인간 ESCS (인간 배아 줄기) 매우 비효율적이다, 따라서 전용 (3에서 검토)의 경우 소수의 문서화되었다. 징크 핑거 뉴 클레아 제 (ZFNs)로 통칭 사이트 특정 징크 핑거 모티프와 FOK I 클레아의 융합을 포함하는 엔지니어링 키메라 단백질을 사용하여 DNA 이중 가닥 나누기 소정 게놈 유전자좌에 도입 될 수있다. DNA 이중 가닥 브레이크 양측 상 동성을 가진 DNA 벡터가 추가 될 때, 사이트는 게놈 DNA 공여체 서열의 혼입을 허용, 상동 재조합에 의해 복구 될 수있다. 이 기술은 유용 F를 증명했다인간 일차 전지 4,5와 인간 배아 줄기 6,7 모두에서 게놈 편집. 보다 최근의 작업들이 이용했다 전사 활성제와 같은 이펙터 클레아 (TALENs), 공장에서 사용 전사 인자는 부위 - 특이 적 뉴 클레아 제 (9)의 설계에 도움 8 병원체. 다음의 프로토콜에서는 인간 뇌하수체 메오 3 (PITX3)에 대한 궤적 ZFNs 함께 상동 타겟팅 벡터 (6)를 함유 EGFP의 일렉트로 hESC의 리포터 세포주의 생성을 보여준다. 2~3주에 대한 항생제의 선택에 따라, 제대로 통합 된 DNA를 가진 인간 배아 줄기 수동으로 집어 확장 및 PCR을 통해 처음 상영하고,이어서 남부 블로 팅에 의해 검증 될 수있다.

<table><tbody><tr><td>Mouse Embryonic Fibroblasts (DR4)</td><td>GlobalStem</td><td>GSC-6004G</td><td></td></tr><tr><td>Gelatin</td><td>Sigma</td><td>G1393-100ML</td><td></td></tr><tr><td>HBSS, no Calcium, no Magnesium, no Phenol Red (HBSS)</td><td>Life Technologies</td><td>14175-095</td><td></td></tr><tr><td>Dispase</td><td>StemCell Technologies</td><td>7923</td><td></td></tr><tr><td>Cell Scraper</td><td>Corning</td><td>3008</td><td></td></tr><tr><td>Accutase</td><td>Life Technologies</td><td>A11105-01</td><td></td></tr><tr><td>Y27632</td><td>Axon Medchem</td><td>Axon 1683</td><td></td></tr><tr><td>Cell Strainer - 40 &amp;mu;m</td><td>BD Biosciences</td><td>352340</td><td></td></tr><tr><td>33 mm - 0.22 &amp;mu;m filter</td><td>Millipore</td><td>SLGP033RS</td><td></td></tr><tr><td>rhFGF2</td><td>R&amp;amp;D Systems</td><td>233-FB-025/CF</td><td></td></tr><tr><td>Electroporator</td><td>BioRad</td><td>165-2661</td><td></td></tr><tr><td>0.4 cm electroporation cuvette</td><td>BioRad</td><td>165-2088</td><td></td></tr><tr><td>Human TV-hPITX3-forward targeting construct</td><td>Addgene</td><td>31942</td><td></td></tr><tr><td>ZFN Kit; Human PITX3</td><td>Sigma-Aldrich</td><td>CKOZFN1050-1KT</td><td></td></tr><tr><td>Puromycin</td><td>InvivoGen</td><td>ant-pr-1</td><td></td></tr><tr><td>Matrigel</td><td>BD Biosciences</td><td>354277</td><td></td></tr><tr><td>Geltrex</td><td>Life Technologies</td><td>A1569601</td><td></td></tr><tr><td>NaCl</td><td>Sigma-Aldrich</td><td>S3014</td><td></td></tr><tr><td>Dulbecco&#039;s Modified Eagle Medium (DMEM)</td><td>Life Technologies</td><td>10566-016</td><td></td></tr><tr><td>Fetal Bovine Serum, Qualified, Heat Inactivated, US Origin (FBS)</td><td>Life Technologies</td><td>16140-071</td><td></td></tr><tr><td>Pen/Strep</td><td>Life Technologies</td><td>15070-063</td><td></td></tr><tr><td>Dulbecco&#039;s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12)</td><td>Life Technologies</td><td>11320-033</td><td></td></tr><tr><td>KnockOut Serum Replacement (KSR)</td><td>Life Technologies</td><td>10828-028</td><td></td></tr><tr><td>MEM Non-Essential Amino Acids&amp;nbsp; (NEAA)</td><td>Life Technologies</td><td>11140-050</td><td></td></tr><tr><td>GlutaMAX</td><td>Life Technologies</td><td>35050-061</td><td></td></tr><tr><td>&amp;szlig;-mercaptoethanol</td><td>Life Technologies</td><td>21985-023</td><td></td></tr><tr><td>N-Lauroylsarcosine sodium salt solution (Sarcosyl) (30%)</td><td>Sigma-Aldrich</td><td>61747</td><td></td></tr><tr><td>EDTA</td><td>Sigma-Aldrich</td><td>&lt;a href=&quot;http://www.sigmaaldrich.com/catalog/product/sial/e9884?lang=en&amp;amp;region=US&quot;&gt;E9884&lt;/a&gt;</td><td></td></tr><tr><td>Trizma Hydrochloride</td><td>Sigma-Aldrich</td><td>T3253</td><td></td></tr><tr><td>Proteinase K solution (20 mg/ml)</td><td>Bioline Australia</td><td>BIO-37084</td><td></td></tr><tr><td>Expand Long Template PCR System</td><td>Roche Australia</td><td>11681834001</td><td></td></tr><tr><td>hPITX3 L arm gen. F (primer): 5&amp;rsquo; TGTCCTAAGGAGAATGGGTAACAGACA 3&amp;rsquo;</td><td>GeneWorks, Australia</td><td></td><td></td></tr><tr><td>hPITX3 L arm GFP R (primer): 5&amp;rsquo; ACACGCTGAACTTGTGGCCGTTTA 3&amp;rsquo;</td><td>GeneWorks, Australia</td><td></td><td></td></tr><tr><td>HyperLadder 1 kb&amp;nbsp;</td><td>Bioline Australia</td><td>BIO-33025</td><td></td></tr><tr><td>GelRed</td><td>Jomar Bioscience, Australia</td><td>41003</td><td></td></tr></tbody></table>

zinc-finger nuclease enhanced gene targeting in human embryonic stem cells

현재 인간 배아 줄기 세포 (ESC) 분화 프로토콜을 하나의 주요 제한은 이종 세포 집단의 생성이다. 이러한 배양 관심의 세포를 포함 할뿐만 아니라 미분화 ESCS 비 신경 유도체 및 다른 신경 세포 아형로 오염된다. 이것은 시험 관내에서 이러한 약물 발견 또는 세포 대체 요법에 대한 시험 관내 모델로서 생체 애플리케이션에서의 사용을 제한한다. 이것을 극복하기 위해, 시각화 트랙과 관심 셀을 분리하는 수단을 제공 리포터 세포주는 설계 될 수있다. 종래의 상 동성 재조합은 매우 비효율적이다 통해 그러나, 인간 배아 줄기 세포에 이것을 달성한다. 이 프로토콜과 함께 뇌하수체의 호 메오 박스 (homeobox) 인간 배아 줄기 세포에서 삼 (PITX3) 궤적 사이트 별 이중 가닥 DNA 나누기를 소개 맞춤 설계된 아연 핑거 뉴 클레아 제를 사용하는 대상에 대해 설명PITX3 - EGFP - 특정 DNA 기증자 벡터입니다. PITX3 리포터 세포주의 발생에 이어, 그 다음 그러한 체외 파킨슨 병 모델링 또는 세포 대체 요법으로 연구에 사용하기 위해 발행 프로토콜을 사용하여 구별 될 수있다.

PITX3와 함께 사용자 정의 설계 PITX3 아연 손가락 쌍의 공동 일렉트로에 따라 - EGFP - 특정 DNA 기증자 벡터, 이후 퓨로 마이신 선택, 양 hESC의 클론은 처음 게놈 PCR 검사 (그림 1)를 통해 검출되었다. 이러한 PCR 5 긍정적 인 클론 &#39;및 3&#39;특정 프로브의 남부 오 하이브리드는 19 %의 효율로, PITX3 궤적 (그림 2)의 한 엑손하는 정확한 타겟팅을 확인했다...

Watch this Scientific Journal Video about Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells at JoVE.com

Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells

리포터 세포주 시각화 추적 이종 집단의 관심의 세포를 분리 할 수​​있는 수단을 제공한다. 그러나, 유전자 - 표적 인간 배아 줄기 세포에서 종래의 상동 재조합을 사용하여 매우 비효율적이다. 여기서, 우리는 아연 핑거 클레아 향상된 상동 재조합을 사용하여 EGFP CNS 중뇌 특정 전사 인자 PITX3 궤적 타겟팅 기술한다.

인간 배아 줄기 세포에 표적으로 아연 손가락 핵산 분해 효소 향상된 유전자

One major limitation with current human embryonic stem cell (ESC) differentiation protocols is the generation of heterogeneous cell ...

zinc-finger-nuclease-enhanced-gene-targeting-human-embryonic-stem

Research

JoVE Journal

Biology

10.8K 조회수.  Monash University.  리포터 세포주 시각화 추적 이종 집단의 관심의 세포를 분리 할 수​​있는 수단을 제공한다. 그러나, 유전자 - 표적 인간 배아 줄기 세포에서 종래의 상동 재조합을 사용하여 매우 비효율적이다. 여기서, 우리는 아연 핑거 클레아 향상된 상동 재조합을 사용하여 EGFP CNS 중뇌 특정 전사 인자 PITX3 궤적 타겟팅 기술한다. 

비디오: Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells

Transfection, Selection, and Colony-picking of Human Induced Pluripotent Stem Cells TALEN-targeted with a GFP Gene into the AAVS1 Safe Harbor

Targeted transgene addition can provide persistent gene expression while circumventing the gene silencing and insertional mutagenesis caused by viral vector mediated random integration. This protocol describes a universal and efficient transgene targeted addition platform in human iPSCs based on utilization of validated open-source TALENs and a gene-trap-like donor to deliver transgenes into a safe harbor locus. Importantly, effective gene editing is rate-limited by the delivery efficiency of gene editing vectors. Therefore, this protocol first focuses on preparation of iPSCs for transfection to achieve high nuclear delivery efficiency. When iPSCs are dissociated into single cells using a gentle-cell dissociation reagent and transfected using an optimized program, >50% cells can be induced to take up the large gene editing vectors. Because the AAVS1 locus is located in the intron of an active gene (PPP1R12C), a splicing acceptor (SA)-linked puromycin resistant gene (PAC) was used to select targeted iPSCs while excluding random integration-only and untransfected cells. This strategy greatly increases the chance of obtaining targeted clones, and can be used in other active gene targeting experiments as well. Two weeks after puromycin selection at the dose adjusted for the specific iPSC line, clones are ready to be picked by manual dissection of large, isolated colonies into smaller pieces that are transferred to fresh medium in a smaller well for further expansion and genetic and functional screening. One can follow this protocol to readily obtain multiple GFP reporter iPSC lines that are useful for in vivo and in vitro imaging and cell isolation.

TALEN-mediated gene editing at the safe harbor AAVS1 locus enables high-efficiency transgene addition in human iPSCs. This protocol describes the procedures for preparing iPSCs for TALEN and donor vector delivery, transfecting iPSCs, and selecting and isolating iPSC clones to achieve targeted integration of a GFP gene to generate reporter lines.

형질, 선택 및 인간 유도 만능 줄기 세포의 콜로니 따기는 AAVS1 세이프 하버 (Safe Harbor)에 GFP 유전자 TALEN는 타겟팅

Targeted transgene addition can provide persistent gene expression while circumventing the gene silencing and insertional mutagenesis caused by viral ...

연구

발생학

Establishment of Genome-edited Human Pluripotent Stem Cell Lines: From Targeting to Isolation

Genome-editing of human pluripotent stem cells (hPSCs) provides a genetically controlled and clinically relevant platform from which to understand human development and investigate the pathophysiology of disease. By employing site-specific nucleases (SSNs) for genome editing, the rapid derivation of new hPSC lines harboring specific genetic alterations in an otherwise isogenic setting becomes possible. Zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 are the most commonly used SSNs. All of these nucleases function by introducing a double stranded DNA break at a specified site, thereby promoting precise gene editing at a genomic locus. SSN-meditated genome editing exploits two of the cell&#39;s endogenous DNA repair mechanisms, non-homologous end joining (NHEJ) and homology directed repair (HDR), to either introduce insertion/deletion mutations or alter the genome using a homologous repair template at the site of the double stranded break. Electroporation of hPSCs is an efficient means of transfecting SSNs and repair templates that incorporate transgenes such as fluorescent reporters and antibiotic resistance cassettes. After electroporation, it is possible to isolate only those hPSCs that incorporated the repair construct by selecting for antibiotic resistance. Mechanically separating hPSC colonies and confirming proper integration at the target site through genotyping allows for the isolation of correctly targeted and genetically homogeneous cell lines. The validity of this protocol is demonstrated here by using all three SSN platforms to incorporate EGFP and a puromycin resistance construct into the AAVS1 safe harbor locus in human pluripotent&#160;stem cells.

Genome editing of human pluripotent stem cells (hPSCs) can be done quickly and efficiently. Presented here is a robust experimental procedure to genetically engineer hPSCs as exemplified by editing the AAVS1 safe harbor locus to express EGFP and introduce antibiotic resistance.

게놈 편집 인간 다 능성 줄기 세포의 설립 : 분리에 타겟팅에서

Genome-editing of human pluripotent stem cells (hPSCs) provides a genetically controlled and clinically relevant platform from which to understand human ...

Introducing Point Mutations into Human Pluripotent Stem Cells Using Seamless Genome Editing

Custom designed endonucleases, such as RNA-guided Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9, enable efficient genome editing in mammalian cells. Here we describe detailed procedures to seamlessly genome edit the hepatocyte nuclear factor 4 alpha (HNF4&#945;) locus as an example in human pluripotent stem cells. Combining a piggyBac-based donor plasmid and the CRISPR-Cas9 nickase mutant in a two-step genetic selection, we demonstrate correct and efficient targeting of the HNF4&#945; locus.

Here, we describe a detailed method for seamless gene editing in human pluripotent stem cells using a piggyBac-based donor plasmid and the Cas9 nickase mutant. Two point mutations were introduced into exon 8 of the hepatocyte nuclear factor 4 alpha (HNF4&#945;) locus in human embryonic stem cells (hESCs).

원활한 게놈 편집을 사용하여 인간 만능 줄기 세포에 점 돌연변이 도입

Custom designed endonucleases, such as RNA-guided Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9, enable efficient genome editing ...

유전학

CRISPR/Cas9-Mediated Highly Efficient Gene Targeting in Embryonic Stem Cells for Developing Gene-Manipulated Mouse Models

The CRISPR/Cas9 system has made it possible to develop genetically modified mice by direct genome editing using fertilized zygotes. However, although the efficiency in developing gene-knockout mice by inducing small indel mutation would be sufficient enough, the efficiency of embryo genome editing for making large-size DNA knock-in (KI) is still low. Therefore, in contrast to the direct KI method in embryos, gene targeting using embryonic stem cells (ESCs) followed by embryo injection to develop chimera mice still has several advantages (e.g., high throughput targeting in vitro, multi-allele manipulation, and Cre and flox gene manipulation can be carried out in a short period). In addition, strains with difficult-to-handle embryos in vitro, such as BALB/c, can also be used for ESC targeting. This protocol describes the optimized method for large-size DNA (several kb) KI in ESCs by applying CRISPR/Cas9-mediated genome editing followed by chimera mice production to develop gene-manipulated mouse models.

Here we present a protocol for developing genetically modified mouse models using embryonic stem cells, especially for large DNA knock-in (KI). This protocol is tuned up using CRISPR/Cas9 genome editing, resulting in significantly improved KI efficiency compared with the conventional homologous recombination-mediated linearized DNA targeting method.

유전자 조작 마우스 모델 개발을 위한 배아 줄기 세포에서 CRISPR/Cas9 매개 고효율 유전자 표적화

The CRISPR/Cas9 system has made it possible to develop genetically modified mice by direct genome editing using fertilized zygotes. However, although the ...

Transfecting and Nucleofecting Human Induced Pluripotent Stem Cells

Genetic modification is continuing to be an essential tool in studying stem cell biology and in setting forth potential clinical applications of human embryonic stem cells (HESCs)1. While improvements in several gene delivery methods have been described2-9, transfection remains a capricious process for HESCs, and has not yet been reported in human induced pluripotent stem cells (iPSCs). In this video, we demonstrate how our lab routinely transfects and nucleofects human iPSCs using plasmid with an enhanced green fluorescence protein (eGFP) reporter. Human iPSCs are adapted and maintained as feeder-free cultures to eliminate the possibility of feeder cell transfection and to allow efficient selection of stable transgenic iPSC clones following transfection. For nucleofection, human iPSCs are pre-treated with ROCK inhibitor11, trypsinized into small clumps of cells, nucleofected and replated on feeders in feeder cell-conditioned medium to enhance cell recovery. Transgene-expressing human iPSCs can be obtained after 6 hours. Antibiotic selection is applied after 24 hours and stable transgenic lines appear within 1 week. Our protocol is robust and reproducible for human iPSC lines without altering pluripotency of these cells.

Despite recent advancements in genetic modification, transfection of human embryonic stem cells (HESCs) remains a capricious process. To our knowledge, systematic and efficient methods to transfect human induced pluripotent stem cells (iPSCs) have not been reported. Here, we describe robust protocols to efficiently transfect and nucleofect human iPSCs.

인간 유도 만능의 줄기 세포를 Transfecting 및 Nucleofecting

Genetic modification is continuing to be an essential tool in studying stem cell biology and in setting forth potential clinical applications of human ...

생물학

Genome Editing with CompoZr Custom Zinc Finger Nucleases (ZFNs)

Genome editing is a powerful technique that can be used to elucidate gene function and the genetic basis of disease. Traditional gene editing methods such as chemical-based mutagenesis or random integration of DNA sequences confer indiscriminate genetic changes in an overall inefficient manner and require incorporation of undesirable synthetic sequences or use of aberrant culture conditions, potentially confusing biological study. By contrast, transient ZFN expression in a cell can facilitate precise, heritable gene editing in a highly efficient manner without the need for administration of chemicals or integration of synthetic transgenes.
Zinc finger nucleases (ZFNs) are enzymes which bind and cut distinct sequences of double-stranded DNA (dsDNA). A functional CompoZr ZFN unit consists of two individual monomeric proteins that bind a DNA "half-site" of approximately 15-18 nucleotides (see Figure 1). When two ZFN monomers "home" to their adjacent target sites the DNA-cleavage domains dimerize and create a double-strand break (DSB) in the DNA.1 Introduction of ZFN-mediated DSBs in the genome lays a foundation for highly efficient genome editing. Imperfect repair of DSBs in a cell via the non-homologous end-joining (NHEJ) DNA repair pathway can result in small insertions and deletions (indels). Creation of indels within the gene coding sequence of a cell can result in frameshift and subsequent functional knockout of a gene locus at high efficiency.2 While this protocol describes the use of ZFNs to create a gene knockout, integration of transgenes may also be conducted via homology-directed repair at the ZFN cut site.
The CompoZr Custom ZFN Service represents a systematic, comprehensive, and well-characterized approach to targeted gene editing for the scientific community with ZFN technology. Sigma scientists work closely with investigators to 1) perform due diligence analysis including analysis of relevant gene structure, biology, and model system pursuant to the project goals, 2) apply this knowledge to develop a sound targeting strategy, 3) then design, build, and functionally validate ZFNs for activity in a relevant cell line. The investigator receives positive control genomic DNA and primers, and ready-to-use ZFN reagents supplied in both plasmid DNA and in-vitro transcribed mRNA format. These reagents may then be delivered for transient expression in the investigator&#x2019;s cell line or cell type of choice. Samples are then tested for gene editing at the locus of interest by standard molecular biology techniques including PCR amplification, enzymatic digest, and electrophoresis. After positive signal for gene editing is detected in the initial population, cells are single-cell cloned and genotyped for identification of mutant clones/alleles.

Genome Editing with CompoZr Custom Zinc Finger Nucleases ZFNs

The CompoZr Custom Zinc-Finger Nuclease (ZFN) Service enables precise genome editing in any organism or cell line at any locus defined by the user. This article describes the process for the design, manufacture, validation and implementation of the CompoZr Custom ZFN Service.

CompoZr 맞춤 아연 손가락 Nucleases와 게놈 편집 (ZFNs)

Genome editing is a powerful technique that can be used to elucidate gene function and the genetic basis of disease. Traditional gene editing methods such ...

Rapid and Efficient Generation of Recombinant Human Pluripotent Stem Cells by Recombinase-mediated Cassette Exchange in the AAVS1 Locus

Even with the revolution of gene-targeting technologies led by CRISPR-Cas9, genetic modification of human pluripotent stem cells&#160;(hPSCs)&#160;is still time consuming. Comparative studies that use recombinant lines with transgenes integrated into safe harbor loci could benefit from approaches that use site-specific targeted recombinases, like Cre or FLPe, which are more rapid and less prone to off-target effects. Such methods have been described, although they do not significantly outperform gene targeting in most aspects. Using Zinc-finger nucleases, we previously created a master cell line in the AAVS1 locus of hPSCs&#160;that contains a GFP-Hygromycin-tk expressing cassette, flanked by heterotypic FRT sequences. Here, we describe the procedures to perform FLPe recombinase-mediated cassette exchange (RMCE) using this line. The master cell line is transfected with a RMCE donor vector, which contains a promoterless Puromycin resistance, and with FLPe recombinase. Application of both a positive (Puromycin) and negative (FIAU) selection program leads to the selection of RMCE without random integrations. RMCE generates fully characterized pluripotent polyclonal transgenic lines in 15 d&#160;with 100% efficiency. Despite the recently described limitations of the AAVS1 locus, the ease of the system paves the way for hPSC transgenesis in isogenic settings, is necessary for comparative studies, and enables semi-high-throughput genetic screens for gain/loss of function analysis that would otherwise be highly time consuming.

Rapid and Efficient Generation of Recombinant Human Pluripotent Stem Cells by Recombinase-mediated Cassette Exchange in the AAVS1 Locus

Here we report a rapid and efficient gene editing method based on RMCE in the AAVS1 locus of human Pluripotent Stem Cells (hPSCs) that improves upon previously described systems. Using this technique, isogenic lines can be rapidly and reliably generated for proper comparative studies, facilitating transgenesis-mediated research with hPSCs.

에서 재조합 효소 중재 카세트 교환에 의해 재조합 인간 다 능성 줄기 세포의 신속하고 효율적인 생성<em&gt; AAVS1</em&gt; 로커스

Even with the revolution of gene-targeting technologies led by CRISPR-Cas9, genetic modification of human pluripotent stem cells&#160;(hPSCs)&#160;is ...

의학

Mouse Genome Engineering Using Designer Nucleases

Transgenic mice carrying site-specific genome modifications (knockout, knock-in) are of vital importance for dissecting complex biological systems as well as for modeling human diseases and testing therapeutic strategies. Recent advances in the use of designer nucleases such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system for site-specific genome engineering open the possibility to perform rapid targeted genome modification in virtually any laboratory species without the need to rely on embryonic stem (ES) cell technology. A genome editing experiment typically starts with identification of designer nuclease target sites within a gene of interest followed by construction of custom DNA-binding domains to direct nuclease activity to the investigator-defined genomic locus. Designer nuclease plasmids are in vitro transcribed to generate mRNA for microinjection of fertilized mouse oocytes. Here, we provide a protocol for achieving targeted genome modification by direct injection of TALEN mRNA into fertilized mouse oocytes.

Designer nucleases such as zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) can be used to modify the genome of mouse preimplantation embryos by triggering both the nonhomologous end joining (NHEJ) and homologous recombination (HR) pathways. These advances enable the rapid generation of mice with precise genetic modifications.

디자이너 클레아 제를 사용하여 마우스 게놈 엔지니어링

Transgenic mice carrying site-specific genome modifications (knockout, knock-in) are of vital importance for dissecting complex biological systems as well ...

CRISPR-Cas9 Mediated Gene Deletion in Human Pluripotent Stem Cells Cultured Under Feeder-Free Conditions

The CRISPR-Cas9 system for genome editing has revolutionized gene function studies in mammalian cells, including stem cells. However, the practical application of this technique, particularly in pluripotent stem cells, presents certain challenges, such as being time- and labor-intensive and having low editing efficiency. Here, we describe the generation of a CRISPR-mediated gene knockout in a human embryonic stem cell (hESC) line stably expressing sgRNAs for the L2HGDH gene, using a highly efficient and stable lentiviral-mediated gene delivery system. The sgRNAs targeting exon 1 of the L2HGDH gene were chemically synthesized and cloned into the lentiCRISPR v2-puro vector, which combines the constitutive expression of sgRNAs with Cas9 in a highly efficient single-vector system to achieve higher lentiviral titers for hESC infection and stable selection using puromycin. Puromycin-selected cells were further expanded, and single-cell clones were obtained using the limited dilution method. The single clones were expanded, and several homozygous knockout clones for the L2HGDH gene were obtained, as confirmed by a 100% reduction in L2HGDH expression using Western blot analysis. Furthermore, using MSBSP-PCR, the CRISPR mutation site was mapped upstream of the PAM recognition sequence of Cas9 in the selected homozygous clones. Sanger sequencing was performed to analyze the exact insertions/deletions, and functional characterization of the clones was conducted. This method produced a significantly higher percentage of homozygous deletions compared to previously reported non-viral gene delivery methods. Although this report focuses on the L2HGDH gene, this robust and cost-effective approach can be used to create homozygous knockouts for other genes in pluripotent stem cells for gene function studies.

<meta charset="utf8"></head><body>CRISPR-Cas9 매개 유전자 결실은 feeder-free 조건에서 배양된 인간 만능 줄기 세포에서 발생합니다.

The presented method describes the generation of a CRISPR-mediated gene knockout in the human embryonic stem cell (hESC) line H9, which stably expresses sgRNAs targeting the L2HGDH gene using a highly efficient lentiviral-mediated gene delivery system.

CRISPR-Cas9 매개 유전자 결실은 feeder-free 조건에서 배양된 인간 만능 줄기 세포에서 발생합니다.

The CRISPR-Cas9 system for genome editing has revolutionized gene function studies in mammalian cells, including stem cells. However, the practical ...

인간 배아 줄기 세포에 표적으로 아연 손가락 핵산 분해 효소 향상된 유전자

요약

더 많은 비디오 탐색

이 비디오의 챕터

형질, 선택 및 인간 유도 만능 줄기 세포의 콜로니 따기는 AAVS1 세이프 하버 (Safe Harbor)에 GFP 유전자 TALEN는 타겟팅

게놈 편집 인간 다 능성 줄기 세포의 설립 : 분리에 타겟팅에서

원활한 게놈 편집을 사용하여 인간 만능 줄기 세포에 점 돌연변이 도입

유전자 조작 마우스 모델 개발을 위한 배아 줄기 세포에서 CRISPR/Cas9 매개 고효율 유전자 표적화

인간 유도 만능의 줄기 세포를 Transfecting 및 Nucleofecting

CompoZr 맞춤 아연 손가락 Nucleases와 게놈 편집 (ZFNs)

에서 재조합 효소 중재 카세트 교환에 의해 재조합 인간 다 능성 줄기 세포의 신속하고 효율적인 생성

디자이너 클레아 제를 사용하여 마우스 게놈 엔지니어링

CRISPR-Cas9 매개 유전자 결실은 feeder-free 조건에서 배양된 인간 만능 줄기 세포에서 발생합니다.

CRISPR-Cas9 매개 유전자 결실은 feeder-free 조건에서 배양된 인간 만능 줄기 세포에서 발생합니다.