El trabajo descrito en este protocolo fue posible gracias a la financiación del Gobierno de Victoria como parte de una alianza de colaboración con el Instituto de California para la Medicina Regenerativa (CIRM).

Todos los procedimientos se llevaron a cabo en una campana de flujo laminar estéril. Todos los medios y soluciones se equilibraron a 37 ° C a menos que se especifique lo contrario. 1. Ampliación del PSC Humanos (hESCs y hiPSCs, WA-09 utilizado en el presente Protocolo) para la transfección Nota: No es necesario ampliar hESCs en Matrigel o Geltrex. hESCs Ampliado de fibroblastos de embriones de ratón (MEFs) pueden ser utilizados para la electroporación o nucleofection después de una etapa de eliminación del MEF (ver sección 2.8). <ol><li> Preparar 1 x 100 mm plato y 1 x frasco de 75cm2 DR4 MEFs a 2,0 x 10 4 células por cm 2 en los medios de comunicación del MEF (ver Tabla 1) en los platos pre-recubierto con 0,1% w / v de gelatina. Nota: CF1, BLK6 o MF1 MEFs se puede utilizar, sin embargo, se recomienda que se utilicen líneas MEF resistentes a los antibióticos, por ejemplo, DR410. </li><li> Al día siguiente, hESCs paso en una placa de 100 mm pre-plateado con MEFs preparados en la sección 1.1. Para ello aspitasa hESC medios de culturas platos, lavar hESCs con solución salina equilibrada de Ca2 + / Mg2 + exento de Hanks (HBSS), añadir Dispasa (ver Tabla 2 en volúmenes apropiados), y meterlo en un incubador humidificado a 37 ° C / 5% de CO 2. Después de 3-5 minutos de incubación, aspirado Dispasa y suavemente lavar 1-2 veces con HBSS para eliminar MEFs. Añadir medios células madre (véase la Tabla 3) y usando un raspador de células, o 5 ml pipeta, raspar suavemente las colonias de la superficie de la placa de cultivo. </li><li> Recoger los fragmentos de colonias en la suspensión de la placa de cultivo en un tubo de centrífuga de 15 ml. Placa de cultivo Enjuague con medios de comunicación y traslado al tubo de 15 ml de células madre. Tenga cuidado de no romper los grumos en células individuales o pequeños fragmentos. </li><li> Centrifugar durante 5 minutos a 160 xg para sedimentar los fragmentos de colonias. </li><li> Aspirar el sobrenadante. Toque en el fondo del tubo de 15 ml con el dedo para aflojar colonia fragmento de pellets. Fragmentos suavemente volver a suspender las colonias en medios de células madre según la relación de división (normallya dividir relación entre 1: 4 y 1: 8 es apropiado). Tenga mucho cuidado de no hacer grumos en las células individuales o pequeños fragmentos ya que esto afectaría replating eficiencia. </li><li> Antes de resiembra fragmentos de células madre en MEFs lavan 1 vez con HBSS. Poco a poco agregue la cantidad apropiada (véase la Tabla 2) de la suspensión de células que contiene fragmentos de células madre en los medios de comunicación de células madre a los platos pre-plateados, MEFs. </li><li> Coloque placas de cultivo en la repisa en la incubadora y se mueven lentamente hacia adelante y hacia atrás y de lado a otro para distribuir uniformemente fragmentos de colonias. </li><li> Vuelva a colocar los medios de comunicación de células madre a diario. </li><li> Para preparar los medios de MEFs (MEF-CM) acondicionado lavar el 75 cm 2 frasco de pre-plateado con MEFs 1 x con HBSS. Añadir medios hESC. Después de 24 horas, recoja medio condicionado y reemplazar con los medios de comunicación hESC fresco. Repita todos los días durante un máximo de 12 días. Almacenar MEF-CM a 4 ° C hasta que se necesite. </li></ol> 2 Preparación de los CES Humanos de transfección <ol><li> Observar el crecimiento de hESCsbajo un microscopio todos los días. Cuando las colonias se convierten en un 40-50% de confluencia, la placa 3 x 100 mm platos con 2,0 x 10 5 MEFs por cm 2. </li><li> Cuando las colonias se convierten en 60 - 70% de confluencia que están listos para ser transfectadas. &#39;novio&#39; colonias mediante la eliminación de colonias diferenciadas o núcleos de colonias. Nota: Como creemos más alta eficiencia de transfección y dirigidos ocurren cuando las células están en fase logarítmica de crecimiento, se sugiere que la electroporación se llevó a cabo antes de hESCs alcanzan ≥ 70% de confluencia. </li><li> Lávese las colonias de células madre con HBSS y añadir Accutase. Nota: No es necesario hESCs el pretratamiento con el inhibidor ROCA Y-27632 de inhibición suficiente se producirá cuando se incubaron con Y-27632 durante el paso 2.7 </li><li> Incubar durante 10 - 20 min a 37 ° C / 5% de CO 2 hasta que las colonias se vuelven células individuales como se observa bajo un microscopio. Las células se tritura con una pipeta de 1 ml. </li><li> Añadir medios hESC y filtro en un tubo cónico de 15 ml utilizando un Straine 40 micras celularR para eliminar grupos de células. </li><li> Se centrifuga a 160 × g durante 5 min. Resuspender pellet de células en medios de células madre recién reconstituido y repetir para eliminar cualquier solución Accutase residual. </li><li> Resuspender las células en los medios de comunicación de células madre que contienen 10 M Y-27632 y transferir la suspensión total de células a una placa de 100 mm pre-recubierto con gelatina. </li><li> Se incuba a 37 ° C / 5% de CO2 durante un mínimo de 30 min. </li><li> Durante este tiempo MEFs se adhiere al plato de gelatina recubierta. Recoger hESCs no adherentes utilizando una pipeta de 1 ml en un tubo de centrífuga de 15 ml fresco y determinar la densidad de células usando un hemocitómetro. </li></ol> 3. electroporación de hESCs <ol><li> Los medios filtrantes-CM MEF que utilizan un filtro de 0,22 micras y añadir 10 ml de factor de crecimiento / fibroblasto humano recombinante ng 2 (rhFGF2). </li><li> Transferir 7,5 x 106 hESCs de la sección 2.9 a un nuevo tubo cónico de 15 ml y centrifugar a 160 xg durante 5 min. </li><li> Durante este tiempo configurar el electroporador: Seleccione el programa para ele exponencialctroporation y establezca los siguientes parámetros, Voltaje: 250 V, capacitancia: 500 mF, y Resistance: ∞-. </li><li> Aspirar el sobrenadante y volver a suspender pellet de células en 0,8 ml de helado de 0,22 micras HBSS filtrada. Transfiera la solución a un 0,4 cm cubeta de electroporación estéril. </li><li> Añadir construcción de la orientación TV-hPITX3-forward (30 g de ADN) y mezclar suavemente con una pipeta de 200 l. Incubar en hielo durante 5 min. Durante este tiempo, retirar una alícuota de Pitx3 ZFN ARNm y descongelar en hielo. Cuando descongelado transferencia de 7,5 l de ADN ZFN ARNm para mezcla / célula en cubeta de electroporación. Mezclar suavemente con una pipeta de 200 l. Nota: El lugar está dirigido es el principal factor que contribuye a la eficiencia de la focalización. Codificación Loci genes silenciosos, los genes no se expresan en los CES, como Pitx3 son difíciles de destino mediante recombinación homóloga convencional 6. Por lo tanto, este protocolo utiliza ZFNs diseñado a medida para el locus Pitx3 humana para inducir un ADN de doble cadena break. </li><li> Electroporar siguiendo las instrucciones que aparecen en pantalla en el electroporador. </li><li> Usando una pipeta transferir 200 l el contenido de la cubeta de electroporación de un tubo de 15 ml que contiene 10 ml de medio de células madre. Lave la cubeta dos veces con 200 l de los medios de comunicación de células madre cada vez y de transferencia a un tubo de 15 ml. Habrá &quot;-mucosa como&quot; escombros formado por ADN y proteínas de las células lisadas que repercutirán negativamente en la supervivencia celular. Se centrifuga a 160 g durante 5 minutos para eliminar estos desechos. </li><li> Aspirar el sobrenadante y golpee suavemente sedimento celular para aflojar. Vuelva a suspender en 30 ml suplementadas MEF-CM que contienen 10 M Y-27632 y replate a 3 x 100 mm platos preplated con MEFs. </li><li> Cambie los medios de comunicación todos los días. El día 2, Y-27632 puede ser retirado y las células cultivadas en los medios de prensa de células madre. </li><li> Después de 2-3 días los hESCs deben ser 50-70% de confluencia. En este punto, comenzará la selección de antibióticos (por ejemplo, 0,5 mg / ml de puromicina). </li><li> Mantener selexión añadiendo fresca medios hESC / puromicina diaria. Después de ~ 7 días pequeñas colonias deben ser visibles. Si no se utilizan MEFs resistentes a los antibióticos, MEFs se puede complementar con la adición de una células adicionales 1,0 x 10 4 por cm 2. </li></ol> 4. Picking clones transgénicos de células madre <ol><li> Aproximadamente el 14 - 21 días después de la selección (cuando las colonias han alcanzado ~ 1 mm de diámetro) se preparan placas de expansión y proyección. Comience por descongelar una alícuota de Matrigel o Geltrex a 4 ° C durante un mínimo de 5 horas. Diluir según las instrucciones del fabricante y añadir 75 l a cada pocillo de placas de 3 x 96 pocillos. Preparar placas 3 x 48 pocillos en placas MEF a 2,0 x 10 4 células por cm 2. Incubar ambas placas O / N a 37 ° C / 5% de CO 2. </li><li> El día siguiente diseccionar colonias en 16-25 pedazos usando una aguja 21 en el extremo de una pipeta de 2 ml mediante la reducción de una cuadrícula. </li><li> Aspirar Matrigel de placas de 96 pocillos y reemplazar con suplemmedios entados CM-MEF. Lave MEFs en placas de 48 pocillos 1 x con HBSS y añadir medios células madre. </li><li> Usando una pipeta de 200 l transferir suavemente tercio de la colonia diseccionado en una placa de 48 pocillos para la expansión. Transferir el otro 2/3 de la colonia diseccionado en una placa de 96 pocillos correspondiente que contiene medios suplementados CM-MEF. </li><li> Mantener ambas placas cambiando los medios de comunicación al día (complementado los medios de comunicación CM-MEF para placas Matrigel de 96 pocillos recubiertos y medios de células madre para placas de 48 pocillos que contenían MEFs; tanto suplementado con 0,5 mg / ml de puromicina). </li><li> Expandir hasta placas de 96 pocillos son 100% confluentes y luego inicialmente pantalla a través de PCR. </li></ol> 5. Selección y expansión de clones positivos <ol><li> Para preparar ADN genómico (método basado en 11) eliminar todos los soportes de las placas mediante la inversión, luego seque sobre toallas de papel. </li><li> Enjuague cada pocillo dos veces con PBS RT (100 l / pocillo de cada lavado), invertido y blot como para el paso 5.1. Coloque las placas a -80 ° C fo 1 - 2 horas para ayudar en la lisis celular (placas pueden almacenarse indefinidamente como este). </li><li> Mientras que las células son a -80 ° C. hacer Sarcosilo tampón de lisis (véase la Tabla 4) (50 l / pocillo). Para lisar las células, placas calientes durante 5 min a TA, luego tampón de lisis pipeta en cada pocillo. Selle los bordes de cada placa con cinta, colocar en un recipiente hermético que contiene toallas de papel húmedas para crear la humedad, e incubar O / N a 60 ° C. </li><li> Después de la incubación añadir 150 l de NaCl 5 M a 10 ml de -20 ° C etanol absoluto, se mezcla bien y añadir 100 ml a cada pocillo (Nota: etanol irá turbia cuando se añade NaCl). Golpeadores suavemente para mezclar (no pipeta) y salen por un mínimo de 30 minutos a temperatura ambiente. Durante este tiempo la solución irá claro y el ADN se precipitará. </li><li> Retire la solución como en el paso 5.1 a continuación, añadir 150 l de etanol al 70% a cada pocillo. Invierta la placa suavemente y secar como antes. Repita este paso una mayor 2x. Nota: Debido a que el ADN precipitado natural adheres a la de plástico de cultivo de tejidos que no se desplacen durante estas etapas de lavado.) </li><li> Después del lavado final placas de centrifugar brevemente a la máxima velocidad para concentrar el ADN a la parte inferior de cada pocillo a continuación secar al aire a temperatura ambiente (o 37 ° C) durante al menos 30 min. </li><li> Añadir 40 - 50 l T0.1E (pH 8,0) (véase la Tabla 5) o TE (pH 8,0) a cada pocillo y colocar las placas a 65 ° C durante 1 hora oa 4 ° CO / N antes de usarlo por PCR. Resuspender el ADN golpeando suavemente los lados de la placa. Utilice 1-2 l de re-suspendido de ADN / 10 l de reacción de PCR. </li><li> Usando el Sistema de Alto PCR Expand Plantilla con brazo hPITX3 L gen. F y cebadores GFP brazo hPITX3 R L realizan la selección inicial de los clones a 58 ° C de recocido, extensión 45 seg, 35 ciclos. </li><li> Muestras de electroforesis con 1kb Hyperladder en un gel de agarosa al 1% que contiene GelRed a 100 V durante 45 min y detectar los clones positivos a través de iluminación UV. </li><li> Validar clones positivos de PCR mediante la digestión de ADN genómico de expaclones nded (ver más abajo) con HindIII y de hibridación sondas 5 &#39;y 3&#39; de los brazos de homología del vector a una transferencia Southern (como se ha descrito anteriormente en 1). Las sondas se generaron por PCR utilizando los pares de cebadores hPITX3 5 &#39;de la sonda F y R, y hPITX3 3&#39; de la sonda F y R, se digirió con EcoRI y se ligó en un vector de clonación general. </li><li> Dependiendo del número de clones positivos, preparar 2 pocillos de una placa de 6 pocillos pre-chapado con MEFs (2,0 x 10 4 células por cm 2). </li><li> Al día siguiente pretratar clones positivos en la placa de 48 pocillos con 10 M Y-27632 durante un mínimo de 1 hr. </li><li> Lave clones positivos con HBSS y añadir 300 l de Accutase. </li><li> Cuando las colonias se vuelven células individuales, añadir 1 ml de medio de células madre y recoger en un tubo de 15 ml. </li><li> Cambie los medios de comunicación todos los días. El día 2, Y-27632 puede ser retirado y las células cultivadas en medios de células madre. </li><li> Cuando las colonias son de 70 - 80% de confluencia, subcultura y congelar el resto de la colofragmentos ny. </li></ol>

<ol>
	<li>Nefzger, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lmx1a+Allows+Context-Specific+Isolation+of+Progenitors+of+GABAergic+or+Dopaminergic+Neurons+During+Neural+Differentiation+of+Embryonic+Stem+Cells.">Lmx1a Allows Context-Specific Isolation of Progenitors of GABAergic or Dopaminergic Neurons During Neural Differentiation of Embryonic Stem Cells.</a> Stem Cells. 30 (7), 1349-1361 (2012).</li><li>Zeng, W. R., Fabb, S. R. A., Haynes, J. M., Pouton, C. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extended+periods+of+neural+induction+and+propagation+of+embryonic+stem+cell-derived+neural+progenitors+with+EGF+and+FGF2+enhances+Lmx1a+expression+and+neurogenic+potential.">Extended periods of neural induction and propagation of embryonic stem cell-derived neural progenitors with EGF and FGF2 enhances Lmx1a expression and neurogenic potential.</a> Neurochemistry International. 59 (3), 394-403 (2011).</li><li>Collin, J., Lako, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Concise+review:+putting+a+finger+on+stem+cell+biology:+zinc+finger+nuclease-driven+targeted+genetic+editing+in+human+embryonic+stem+cells.">Concise review: putting a finger on stem cell biology: zinc finger nuclease-driven targeted genetic editing in human embryonic stem cells.</a> Stem Cells. 29 (7), 1021-1033 (2011).</li><li>Carroll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progress+and+prospects:+zinc-finger+nucleases+as+gene+therapy+agents.">Progress and prospects: zinc-finger nucleases as gene therapy agents.</a> Gene Therapy. 15 (22), 1463-1468 (2008).</li><li>Urnov, F. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+endogenous+human+gene+correction+using+designed+zinc-finger+nucleases.">Highly efficient endogenous human gene correction using designed zinc-finger nucleases.</a> Nature. 435 (7042), 646-651 (2005).</li><li>Hockemeyer, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+targeting+of+expressed+and+silent+genes+in+human+ESCs+and+iESCs+using+zinc-finger+nucleases.">Efficient targeting of expressed and silent genes in human ESCs and iESCs using zinc-finger nucleases.</a> Nature Biotechnology. 27 (9), 851-857 (2009).</li><li>Lombardo, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+editing+in+human+stem+cells+using+zinc+finger+nucleases+and+integrase-defective+lentiviral+vector+delivery.">Gene editing in human stem cells using zinc finger nucleases and integrase-defective lentiviral vector delivery.</a> Nature Biotechnology. 25 (11), (2007).</li><li>Boch, J., Bonas, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Xanthomonas+AvrBs3+family-type+III+effectors:+discovery+and+function.">Xanthomonas AvrBs3 family-type III effectors: discovery and function.</a> Annual Review of Phytopathology. 48, 419-436 (2010).</li><li>Hockemeyer, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+engineering+of+human+embryonic+cells+using+TALE+nucleases.">Genetic engineering of human embryonic cells using TALE nucleases.</a> Nature Biotechnology. 29 (8), 731-734 (2011).</li><li>Tucker, K. L., Wang, Y., Dausman, J., Jaenisch, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transgenic+mouse+strain+expressing+four+drug-selectable+marker+genes.">A transgenic mouse strain expressing four drug-selectable marker genes.</a> Nucleic Acids Research. 25 (18), 3745-3746 (1997).</li><li>Ram&#237;rez-Solis, R., Rivera-P&#233;rez, J., Wallace, J. D., Wims, M., Zheng, H., Bradley, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+DNA+microextraction:+a+method+to+screen+numerous+samples.">Genomic DNA microextraction: a method to screen numerous samples.</a> Analytical Biochemistry. 201 (2), 331-335 (1992).</li><li>Kawasaki, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+midbrain+dopaminergic+neurons+from+ES+cells+by+stromal+cell-derived+inducing+activity.">Induction of midbrain dopaminergic neurons from ES cells by stromal cell-derived inducing activity.</a> Neuron. 28 (1), 31-40 (2000).</li><li>Denham, M., Thompson, L. H., Leung, J., P&#233;bay, A., Bj&#246;rklund, A., Dottori, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gli1+is+an+inducing+factor+in+generating+floor+plate+progenitor+cells+from+human+embryonic+stem+cells.">Gli1 is an inducing factor in generating floor plate progenitor cells from human embryonic stem cells.</a> Stem Cells. 28 (10), 1805-1815 (2010).</li><li>Smidt, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+homeodomain+gene+Ptx3+has+highly+restricted+brain+expression+in+mesencephalic+dopaminergic+neurons.">A homeodomain gene Ptx3 has highly restricted brain expression in mesencephalic dopaminergic neurons.</a> Proceedings of the National Academy of Sciences U.S.A. 94, 13305-13310 (1997).</li></ol>

Los autores no tienen nada que revelar.

La generación de líneas celulares reporteras ofrece un medio poderoso para realizar un seguimiento, visualizar y aislar células de interés a partir de una población heterogénea derivadas de hESCs. Sin embargo, la orientación de genes por recombinación homóloga convencional ha demostrado ser extremadamente ineficiente para humanos CES 3. En este protocolo se describe una técnica relativamente sencilla para la introducción de un RP en el exón uno de los locus Pitx3, en hESCs usando un vecto...

Células madre embrionarias (ESC) protocolos de diferenciación actuales resultan en poblaciones de células heterogéneas, particularmente con respecto a la derivación de fenotipos neuronales específicas. Por lo tanto, aunque los cultivos contienen el fenotipo celular deseada, otra neuronal, tipos celulares disociados de la ONU no neuronal y están a menudo presentes 1. Estas características limitan la aplicación de ESC deriva fuentes de células para su uso en la terapia de reemplazo celular y en el modelado de la enfermedad vitro. Líneas celulares reporteras genéticos ofrecen un medio para visualizar, rastrear y aislar las células de interés, a condición de que la expresión de la proteína indicadora (RP) reproduce la expresión endógena. El uso de promotores inmediatamente aguas arriba de una región codificante del gen se puede utilizar para derivar reporteros genéticos crudo pero tales construcciones carecen de los elementos reguladores precisos que controlan la expresión génica endógena. En contraste, la recombinación homóloga ofrece laoportunidad de asegurar la expresión de alta fidelidad de la RP. En el pasado, apuntando vectores diseñados para la recombinación homóloga en los loci específico de interés se han utilizado para RPs en ratón CES (mESCs) apuntar usando electroporación como medio de suministro de ADN 1,2. Sin embargo, la generación de líneas celulares reportero a través de recombinación homóloga convencional es extremadamente ineficiente para CME humanas (hESCs), y por tanto sólo se ha documentado en un puñado de casos (revisado en 3). Mediante el uso de una proteína quimérica de ingeniería que contiene una fusión de una nucleasa Fok I con motivos de dedos de zinc específicos del sitio, conocidas colectivamente como nucleasas de dedos de zinc (ZFNs), la DNA se rompe la doble cadena se pueden introducir en loci genómico predeterminado. Cuando se añade un vector de ADN con homología a ambos lados de la ruptura del ADN de doble cadena, el sitio genómico se puede reparar mediante recombinación homóloga, permitiendo la incorporación de la secuencia donante de ADN. Esta técnica ha demostrado ser útil fo edición genómico tanto en las células primarias humanas 4,5 y 6,7 hESCs. Un trabajo más reciente de transcripción ha utilizado activador de nucleasas efectoras (Talens), factores de transcripción utilizados por fitopatógenos 8, para ayudar en el diseño de nucleasas específicas de sitio 9. En el siguiente protocolo se demuestra la generación de una línea celular de células madre reportero por electroporación de un EGFP que contiene homóloga vector de orientación 6 junto con ZFNs para el homeobox pituitaria humana 3 (Pitx3) locus. Tras la selección de antibióticos durante 2-3 semanas, hESCs con ADN integrado correctamente pueden ser recogidos manualmente, se expandieron y se seleccionaron inicialmente mediante PCR, y posteriormente validados por transferencia de Southern.

<table border="0" cellpadding="0" cellspacing="0" width="883">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Mouse Embryonic Fibroblasts (DR4)</td>
			<td style="width:207px;">GlobalStem</td>
			<td style="width:119px;">GSC-6004G</td>
			<td style="width:67px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gelatin</td>
			<td style="width:207px;">Sigma</td>
			<td style="width:119px;">G1393-100ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">HBSS, no Calcium, no Magnesium, no Phenol Red (HBSS)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">14175-095</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Dispase</td>
			<td style="width:207px;">StemCell Technologies</td>
			<td style="width:119px;">7923</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Cell Scraper</td>
			<td style="width:207px;">Corning</td>
			<td style="width:119px;">3008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Accutase</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">A11105-01</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Y27632</td>
			<td style="width:207px;">Axon Medchem</td>
			<td style="width:119px;">Axon 1683</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Strainer - 40um</td>
			<td>BD Biosciences</td>
			<td>352340</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">33mm - 0.22 um filter</td>
			<td style="width:207px;">Millipore</td>
			<td style="width:119px;">SLGP033RS</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">rhFGF2</td>
			<td style="width:207px;">R&#38;D Systems</td>
			<td>233-FB-025/CF</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Electroporator</td>
			<td style="width:207px;">BioRad</td>
			<td style="width:119px;">165-2661</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">0.4cm electroporation cuvette</td>
			<td style="width:207px;">BioRad</td>
			<td style="width:119px;">165-2088</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Human TV-hPITX3-forward targeting construct</td>
			<td style="width:207px;">Addgene</td>
			<td style="width:119px;">31942</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:491px;">ZFN Kit; Human PITX3</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td style="width:119px;">CKOZFN1050-1KT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Puromycin</td>
			<td style="width:207px;">Invivogen</td>
			<td style="width:119px;">ant-pr-1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Matrigel</td>
			<td style="width:207px;">BD Biosciences</td>
			<td>354277</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Geltrex</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">A1569601</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">NaCl</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td>S3014</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td style="width:207px;">Life Technologies</td>
			<td>10566-016</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Fetal Bovine Serum, Qualified, Heat Inactivated, US Origin (FBS)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">16140-071</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Pen/Strep</td>
			<td style="width:207px;">Life Technologies</td>
			<td>15070-063</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Dulbecco&#39;s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">11320-033</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">KnockOut Serum Replacement (KSR)</td>
			<td style="width:207px;">Life Technologies</td>
			<td>10828-028</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">MEM Non-Essential Amino Acids&#160; (NEAA)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">11140-050</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">GlutaMAX</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">35050-061</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">&#223;-mercaptoethanol</td>
			<td style="width:207px;">Life Technologies</td>
			<td>21985-023</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">N-Lauroylsarcosine sodium salt solution (Sarcosyl) (30%)</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td style="width:119px;">61747</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">EDTA</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td><a href="http://www.sigmaaldrich.com/catalog/product/sial/e9884?lang=en&amp;region=US">E9884</a></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Trizma Hydrochloride</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td>T3253</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Proteinase K solution (20mg/ml)</td>
			<td style="width:207px;">Bioline Australia</td>
			<td>BIO-37084</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Expand Long Template PCR System</td>
			<td style="width:207px;">Roche Australia</td>
			<td style="width:119px;">11681834001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">hPITX3 L arm gen. F (primer): 5&#8217; TGTCCTAAGGAGAATGGGTAACAGACA 3&#8217;</td>
			<td style="width:207px;">GeneWorks, Australia</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:491px;">hPITX3 L arm GFP R (primer): 5&#8217; ACACGCTGAACTTGTGGCCGTTTA 3&#8217;</td>
			<td style="width:207px;">GeneWorks, Australia</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">HyperLadder 1kb&#160;</td>
			<td style="width:207px;">Bioline Australia</td>
			<td>BIO-33025</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:491px;">GelRed</td>
			<td style="width:207px;">Jomar Bioscience, Australia</td>
			<td style="width:119px;">41003</td>
			<td></td>
		</tr>
	</tbody>
</table>

zinc-finger nuclease enhanced gene targeting in human embryonic stem cells

Una de las principales limitaciones con células madre embrionarias (ESC) protocolos de diferenciación actuales es la generación de poblaciones de células heterogéneas. Estos cultivos contienen las células de interés, pero también se contaminan con los CES indiferenciadas, derivados no neurales y otros subtipos neuronales. Esto limita su uso en in vitro y en aplicaciones in vivo, tales como el modelado in vitro para el descubrimiento de fármacos o la terapia de reemplazo celular. Para ayudar a superar esto, las líneas celulares reporteras, que ofrecen un medio para visualizar, controlar y aislar las células de interés, se pueden diseñar. Sin embargo, para lograr esto en células madre embrionarias humanas a través de recombinación homóloga convencional es extremadamente ineficiente. Este protocolo describe la orientación de la homeobox pituitaria 3 (Pitx3) locus de células madre embrionarias humanas mediante nucleasas de dedos de zinc de diseño personalizado, que introducen rupturas de doble hebra de ADN específicas del lugar, junto con unPitx3 - EGFP específico de vector donante de ADN. Después de la generación de la línea celular reportera Pitx3, entonces se puede diferenciar usando protocolos publicados para su uso en estudios in vitro tales como el modelado de la enfermedad o el reemplazo de células en la terapia de Parkinson.

Después de co-electroporación de la Pitx3 par zinc-finger de diseño personalizado junto con el Pitx3 - EGFP ADN específico de vector donante, y la selección de puromicina posterior, los clones de células madre positivas se detectaron inicialmente a través de la selección por PCR genómico (Figura 1). Hibridación de transferencia Southern de estos clones positivos de PCR con 5 &#39;y 3&#39; sondas específicas confirmó la orientación correcta para el exón 1 del locu...

Watch this Scientific Journal Video about Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells at JoVE.com

Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells

Líneas celulares Reporter ofrecen un medio para visualizar, controlar y aislar las células de interés por parte de las poblaciones heterogéneas. Sin embargo, gen de la orientación mediante recombinación homóloga convencional en células madre de embriones humanos es extremadamente ineficiente. Aquí se describe la orientación del SNC locus cerebro medio específico Pitx3 factor de transcripción con EGFP usando nucleasa dedo de zinc mejorado recombinación homóloga.

Nucleasa dedo de zinc-gen mejorada en células madre embrionarias humanas

One major limitation with current human embryonic stem cell (ESC) differentiation protocols is the generation of heterogeneous cell ...

zinc-finger-nuclease-enhanced-gene-targeting-human-embryonic-stem

Research

JoVE Journal

Biology

10.7K vistas.  Monash University.  Líneas celulares Reporter ofrecen un medio para visualizar, controlar y aislar las células de interés por parte de las poblaciones heterogéneas. Sin embargo, gen de la orientación mediante recombinación homóloga convencional en células madre de embriones humanos es extremadamente ineficiente. Aquí se describe la orientación del SNC locus cerebro medio específico Pitx3 factor de transcripción con EGFP usando nucleasa dedo de zinc mejorado recombinación homól...

Video: Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells

Propagation of Human Embryonic Stem (ES) Cells

Propagation of Human Embryonic Stem ES Cells

Propagación de la madre embrionarias humanas (ES) Células

Investigación

Biología

Derivation of Human Embryonic Stem Cells by Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass. 


The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass.

Derivación de células estaminales embrionarias humanas por Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both ...

Probing for Mitochondrial Complex Activity in Human Embryonic Stem Cells

Mitochondria are cytoplasmic organelles that have a primary role in cellular metabolism and homeostasis, regulation of the cell signaling network, and programmed cell death. Mitochondria produce ATP, regulate the cytoplasmic redox state and Ca2+ balance, catabolize fatty acids, synthesize heme, nucleotides, steroid hormones, amino acids, and help assemble iron-sulfur clusters in proteins. Mitochondria also have an essential role in heat production. Mutations of the mitochondrial genome cause several types of human disorder. The accumulation of mtDNA mutations correlates with aging and is suspected to have an important role in the development of cancer. Due to their vitally important role in all cell types, the function of mitochondria must also be critical for stem cells. Key advances have been made in our understanding of stem cell viability, proliferation, and differentiation capacity. But the functional activity of stem cells, in particular their energy status, was not yet been studied in detail. Almost nothing is known about the mitochondrial properties of human embryonic stem cells (hESCs) and their differentiated precursor progeny. One way to understand and evaluate the role of mitochondria in hESC function and developmental potential is to directly measure the activity of mitochondrial respiratory complexes. Here, we describe high resolution clear native gel electrophoresis and subsequent in gel activity visualization as a method for analyzing the five respiratory chain complexes of hESCs.

In this video, we will show you how the mitochondrial respiratory chain complexes of human embryonic stem cells can be analyzed using in gel activity assays.

Sondeo de la actividad mitocondrial complejo en células estaminales embrionarias humanas

Mitochondria are cytoplasmic organelles that have a primary role in cellular metabolism and homeostasis, regulation of the cell signaling network, and ...

In vitro and in vivo Bioluminescence Reporter Gene Imaging of Human Embryonic Stem Cells

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative medicine. However, direct injection of hESCs, and cells differentiated from hESCs, into living organisms has thus far been hampered by significant cell death, teratoma formation, and host immune rejection. Understanding the in vivo hESC behavior after transplantation requires novel imaging techniques to longitudinally monitor hESC localization, proliferation, and viability. Molecular imaging has given investigators a high-throughput, inexpensive, and sensitive means for tracking in vivo cell proliferation over days, weeks, and even months. This advancement has significantly increased the understanding of the spatio-temporal kinetics of hESC engraftment, proliferation, and teratoma-formation in living subjects.

A major advance in molecular imaging has been the extension of noninvasive reporter gene assays from molecular and cellular biology into in vivo multi-modality imaging platforms. These reporter genes, under control of engineered promoters and enhancers that take advantage of the host cell s transcriptional machinery, are introduced into cells using a variety of vector and non-vector methods. Once in the cell, reporter genes can be transcribed either constitutively or only under specific biological or cellular conditions, depending on the type of promoter used. Transcription and translation of reporter genes into bioactive proteins is then detected with sensitive, noninvasive instrumentation (e.g., CCD cameras) using signal-generating probes such as D-luciferin.

To avoid the need for excitatory light to track stem cells in vivo as is required for fluorescence imaging, bioluminescence reporter gene imaging systems require only an exogenously administered probe to induce light emission. Firefly luciferase, derived from the firefly Photinus pyralis, encodes an enzyme that catalyzes D-luciferin to the optically active metabolite, oxyluciferin. Optical activity can then be monitored with an external CCD camera. Stably transduced cells that carry the reporter construct within their chromosomal DNA will pass the reporter construct DNA to daughter cells, allowing for longitudinal monitoring of hESC survival and proliferation in vivo. Furthermore, because expression of the reporter gene product is required for signal generation, only viable parent and daughter cells will create bioluminescence signal; apoptotic or dead cells will not. 

In this video, the specific materials and methods needed for tracking stem cell proliferation and teratoma formation with bioluminescence imaging will be described.

With the growing interest in stem cell therapies, molecular imaging techniques are ideal for monitoring stem cell behavior after transplantation. Luciferase reporter genes have enabled non-invasive, repetitive assessment of cell survival, location, and proliferation in vivo. This video will demonstrate how to track hESC proliferation in a living mouse.

In vitro e in vivo de imágenes de bioluminiscencia gen reportero de células estaminales embrionarias humanas

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative ...

Chromatin Immunoprecipitation from Human Embryonic Stem Cells

The functional and structural complexity of the myriad of cells in metazoan organisms arises from a small number of stem cells. Stem cells are characterized by two fundamental properties: self-renewal and multipotency that allows a stem cell to differentiate into virtually any cell type 1. The progression stem cell to differentiated cell is characterized by loss of multipotency, structural and morphological changes and the hierarchic activity of transcription factors and signaling molecules, whose activities establish and maintain cell-type specific gene expression patterns. At the molecular level, cell differentiation involves dynamic changes of the structure and composition of chromatin and the detection of those dynamic changes can provide valuable insights into the functional features of stem cells and the cell differentiation process 2,3. Chromatin is a highly compacted DNA-protein complex that forms when cells package chromosomal DNA with proteins, mainly histones 4. Stemcellness and cell differentiation has been correlated with the presence of specific arrays of regulatory proteins such as epigenetic factors, histone variants, and transcription factors 2,3,5.
 Chromatin immunoprecipitation (ChIP) provides a valuable method to monitor the presence of RNA, proteins, and protein modifications in chromatin 6,7. The comparison of chromatin from different cell types can elucidate dynamic changes in protein-chromatin associations that occur during cell differentiation.
Chromatin immunoprecipitation involves the purification of in vivo cross-linked chromatin. The isolated chromatin is reduced to smaller fragments by enzymatic digestion or mechanical force. Chromatin fragments are precipitated using specific antibodies to target proteins or protein and DNA modifications. The precipitated DNA or RNA is purified and used as a template for PCR or DNA microarray based assays. Prerequisites for a successful ChIP are high quality antibodies to the desired antigen and the availability of chromatin from control cells that do not express the target molecule. ChIP can correlate the presence of proteins, protein and RNA modifications, and RNA with specific target DNA, and depending on the choice of outread tool, detects the association of target molecules at specific target genes or in the context of an entire genome. The comparison of the distribution of proteins in the chromatin of differentiating cells can elucidate the dynamic changes of chromatin composition that coincide with the progression of cells along a cell lineage.

The differentiation of ESC coincides with cell-type specific changes in the structure and composition of chromatin. The detection of those changes provides valuable insights into the mechanisms that define stemcellness and cell differentiation. Chromatin immunoprecipitation (ChIP) represents a valuable method to dissect the molecular mechanisms underlying stem cell differentiation.

Inmunoprecipitación de la cromatina de células estaminales embrionarias humanas

The functional and structural complexity of the myriad of cells in metazoan organisms arises from a small number of stem cells. Stem cells are ...

In vitro Labeling of Human Embryonic Stem Cells for Magnetic Resonance Imaging

Human embryonic stem cells (hESC) have demonstrated the ability to restore the injured myocardium. Magnetic resonance imaging (MRI) has emerged as one of the predominant imaging modalities to assess the restoration of the injured myocardium. Furthermore, ex-vivo labeling agents, such as iron-oxide nanoparticles, have been employed to track and localize the transplanted stem cells. However, this method does not monitor a fundamental cellular biology property regarding the viability of transplanted cells. It has been known that manganese chloride (MnCl2) enters the cells via voltage-gated calcium (Ca2+) channels when the cells are biologically active, and accumulates intracellularly to generate T1 shortening effect. Therefore, we suggest that manganese-guided MRI can be useful to monitor cell viability after the transplantation of hESC into the myocardium.
In this video, we will show how to label hESC with MnCl2 and how those cells can be clearly seen by using MRI in vitro. At the same time, biological activity of Ca2+-channels will be modulated utilizing both Ca2+-channel agonist and antagonist to evaluate concomitant signal changes.

In this video, we are showing how to label human embryonic stem cells (hESC) with manganese chloride (MnCl2) which can enter cells via voltage-gated calcium channels when the cells are biologically active. Additionally, we show the use of MnCl2 as cellular MRI contrast agent to determine the in vitro viability of hESC.

En el etiquetado in vitro de células estaminales embrionarias humanas de Resonancia Magnética

Human embryonic stem cells (hESC) have demonstrated the ability to restore the injured myocardium. Magnetic resonance imaging (MRI) has emerged as one of ...

Culture and Maintenance of Human Embryonic Stem Cells  

Human embryonic stem (hES) cells must be monitored and cared for in order to maintain healthy, undifferentiated cultures. At minimum, the cultures must be  fed  every day by performing a complete medium change to replenish lost nutrients and to keep the cultures free of unwanted differentiation factors. Although a small amount of differentiation is normal and expected in stem cell cultures, the culture should be routinely cleaned up by manually removing, or "picking" differentiated areas. Identifying and removing excess differentiation from hES cell cultures are essential techniques in the maintenance of a healthy population of cells.

Culture and Maintenance of Human Embryonic Stem Cells

This protocol demonstrates how to maintain healthy, undifferentiated human embryonic stem (ES) cells.

La cultura y el mantenimiento de células estaminales embrionarias humanas

Human embryonic stem (hES) cells must be monitored and cared for in order to maintain healthy, undifferentiated cultures. At minimum, the cultures must be ...

Freezing and Thawing Human Embryonic Stem Cells

Since James Thomson et al developed a technique in 1998 to isolate and grow hES in culture, freezing cells for later use and thawing and expanding cells from a frozen stock have become important procedures performed in routine hES cell culture. Since hES cells are very sensitive to the stresses of freezing and thawing, special care must taken. Here we demonstrate the proper technique for rapidly thawing hES cells from liquid nitrogen stocks, plating them on mouse embryonic feeder cells, and slowly freezing them for long-term storage.

Since James Thomson et al developed a technique in 1998 to isolate and grow hES in culture, freezing cells for later use and thawing and expanding cells from a frozen stock have become important procedures performed in routine hES cell culture. Since hES cells are very sensitive to the stresses of freezing and thawing, special care must taken. Here we demonstrate the proper technique for rapidly thawing hES cells from liquid nitrogen stocks, plating them on mouse embryonic feeder cells, and slowly freezing them for long-term storage.

Congelación y descongelación células estaminales embrionarias humanas

Since James Thomson et al developed a technique in 1998 to isolate and grow hES in culture, freezing cells for later use and thawing and expanding cells ...

Differentiation of Embryonic Stem Cells into Oligodendrocyte Precursors

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant interest in deriving a pure population of lineage-committed oligodendrocyte precursor cells (OPCs) for transplantation. OPCs are characterized by the activity of the transcription factor Olig2 and surface expression of a proteoglycan NG2. Using the GFP-Olig2 (G-Olig2) mouse embryonic stem cell (mESC) reporter line, we optimized conditions for the differentiation of mESCs into GFP+Olig2+NG2+ OPCs. In our protocol, we first describe the generation of embryoid bodies (EBs) from mESCs. Second, we describe treatment of mESC-derived EBs with small molecules: (1) retinoic acid (RA) and (2) a sonic hedgehog (Shh) agonist purmorphamine (Pur) under defined culture conditions to direct EB differentiation into the oligodendroglial lineage. By this approach, OPCs can be obtained with high efficiency (&gt;80%) in a time period of 30 days. Cells derived from mESCs in this protocol are phenotypically similar to OPCs derived from primary tissue culture. The mESC-derived OPCs do not show the spiking property described for a subpopulation of brain OPCs in situ. To study this electrophysiological property, we describe the generation of spiking mESC-derived OPCs by ectopically expressing NaV1.2 subunit. The spiking and nonspiking cells obtained from this protocol will help advance functional studies on the two subpopulations of OPCs.

We describe a small molecule-based protocol for differentiation of mouse embryonic stem cells into oligodendrocyte precursor cells (OPCs). This protocol generates Olig2+NG2+ OPCs with high efficiency by 30 days of differentiation. We also describe a method to generate "spiking" OPCs that can fire action potentials.

La diferenciación de células madre embrionarias en los precursores de oligodendrocitos

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant ...

Fate Mapping of Human Embryonic Stem Cells by Teratoma Formation

Human embryonic stem cells (hESCs) have an unlimited capacity for self-renewal, and the ability to differentiate into cells derived from all three embryonic germ layers (1). Directed differentiation of hESCs into specific cell types has generated much interest in the field of regenerative medicine (e.g., (2-5)), and methods for determining the in vivo fate of selected or manipulated hESCs are essential to this endeavor. We have adapted a highly efficient teratoma formation assay for this purpose. A small number of specifically selected hESCs is mixed with undifferentiated wild type hESCs and Phaseolus vulgaris lectin to form a cell pellet. This is grafted beneath the kidney capsule in an immunodeficient mouse. As few as 2.5 x 105 hESCs are needed to form a 16 cm3 teratoma within 8-12 weeks. The fate of the originally selected hESCs can then be determined by immunohistochemistry. This method provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.

Directed differentiation of hESCs into specific cells has generated much interest in regenerative medicine. We provide a concise, step-by-step protocol for determining the in vivo fate of selected hESCs that provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.