Work described in this protocol was made possible by funding from the Victorian Government as part of an collaborative alliance with the Californian Institute for Regenerative Medicine (CIRM).

All procedures are carried out in a sterile laminar flow hood. All media and solutions are equilibrated to 37 &#176;C unless otherwise specified.
1. Expansion of Human PSCs (hESCs and hiPSCs, WA-09 used in this Protocol) for Transfection
Note: It is not necessary to expand hESCs on Matrigel or Geltrex. hESCs expanded on mouse embryonic fibroblasts (MEFs) can be used for electroporation or nucleofection following a MEF removal step (see section 2.8).
<ol>
	<li>Prepare 1 x 100 mm dish and 1 x 75cm2 flask of DR4 MEFs at 2.0 x 104 cells per cm2 in MEF media (see Table 1) on dishes pre-coated with 0.1% w/v gelatin. 
	Note: CF1, BLK6 or MF1 MEFs can be used, however, it is recommended that antibiotic resistant MEF lines are used, e.g., DR410.</li>
	<li>The next day, passage hESCs onto a 100 mm dish pre-plated with MEFs prepared in section 1.1. To do this aspirate hESC media from cultures dishes, wash hESCs with Ca2+/Mg2+-free Hanks&#8217; balanced salt solution (HBSS), add Dispase (see Table 2 for appropriate volumes) and place in a humidified incubator at 37&#176;C/5% CO2. Following 3-5 min incubation, aspirate Dispase and gently wash 1 - 2 times with HBSS to remove MEFs. Add hESC media (see Table 3) and using a cell scraper, or 5 ml pipette, gently scrape the colonies off the surface of the culture dish.</li>
	<li>Collect the colony fragments in suspension from the culture dish into a 15 ml centrifuge tube. Rinse culture dish with hESC media and transfer to the 15 ml tube. Be careful to not break up clumps into single cells or small fragments.</li>
	<li>Centrifuge for 5 min at 160 x g to pellet colony fragments.</li>
	<li>Aspirate supernatant. Tap bottom of 15 ml tube with finger to loosen colony fragment pellet. Gently resuspend colony fragments in hESC media according to split ratio (normally a split ratio between 1:4 and 1:8 is appropriate). Be extremely careful not to render clumps into single cells or small fragments as this will affect replating efficiency.</li>
	<li>Prior to replating hESC fragments onto MEFs wash 1x with HBSS. Slowly add an appropriate amount (see Table 2) of cell suspension containing hESC fragments in hESC media to dishes pre-plated with MEFs.</li>
	<li>Place culture dishes onto shelf in incubator and move slowly back and forth and side to side to evenly distribute colony fragments.</li>
	<li>Replace hESC media daily.</li>
	<li>To prepare conditioned media from MEFs (MEF-CM) wash the 75 cm2 flask pre-plated with MEFs 1 x with HBSS. Add hESC media. Following 24 hr, collect conditioned media and replace with fresh hESC media. Repeat daily for a maximum of 12 days. Store MEF-CM at 4 &#176;C until needed.</li>
</ol>
2. Preparation of Human ESCs for Transfection
<ol>
	<li>Observe the growth of hESCs under a microscope daily. When colonies become 40-50% confluent, plate 3 x 100 mm dishes with 2.0 x 105 MEFs per cm2.</li>
	<li>When colonies become 60 - 70% confluent they are ready to be transfected. &#8216;Groom&#8217; colonies by removing differentiated colonies or colony cores. 
	Note: As we believe higher transfection and targeting efficiencies occur when cells are in log phase growth, it is suggested that electroporation be conducted before hESCs reach &#8805; 70% confluency.</li>
	<li>Wash hESC colonies with HBSS and add Accutase. 
	Note: It is not necessary to pre-treat hESCs with ROCK inhibitor Y-27632 as sufficient inhibition will occur when incubated with Y-27632 during step 2.7</li>
	<li>Incubate for 10 - 20 min at 37&#176;C/5% CO2 until colonies are rendered single cells as viewed under a microscope. Triturate cells with a 1 ml pipette.</li>
	<li>Add hESC media and filter into a 15 ml conical tube using a 40 &#956;m cell strainer to remove cell clumps.</li>
	<li>Centrifuge at 160 x g for 5 min. Resuspend cell pellet in fresh hESC media and repeat to remove any residual Accutase solution.</li>
	<li>Resuspend cells in hESC media containing 10 &#956;M Y-27632 and transfer the total cell suspension to a 100 mm dish pre-coated with gelatin.</li>
	<li>Incubate at 37 &#176;C/5% CO2 for a minimum of 30 min.</li>
	<li>During this time MEFs will adhere to the gelatin coated dish. Collect non-adherent hESCs using a 1 ml pipette into a fresh 15 ml centrifuge tube and determine cell density using a hemocytometer.</li>
</ol>
3. Electroporation of hESCs
<ol>
	<li>Filter CM-MEF media using a 0.22 &#956;m filter and add 10 ng/ml&#160;recombinant human fibroblast growth factor 2 (rhFGF2).</li>
	<li>Transfer 7.5 x 106 hESCs from section 2.9 to a new 15 ml conical tube and centrifuge at 160 x g for 5 min.</li>
	<li>During this time set up the electroporator: Select program for exponential electroporation and set the following parameters, Voltage: 250 V, Capacitance: 500 &#956;F, and Resistance: &#8734;-.</li>
	<li>Aspirate the supernatant and re-suspend cell pellet in 0.8 ml of ice-cold 0.22 &#956;m filtered HBSS. Transfer the solution to a sterile 0.4 cm electroporation cuvette.</li>
	<li>Add TV-hPITX3-forward targeting construct (30 &#956;g DNA) and mix gently with a 200 &#956;l pipette. Incubate on ice for 5 min. During this time remove one aliquot of PITX3 ZFN mRNA and defrost on ice. When defrosted transfer 7.5 &#956;l of ZFN mRNA to DNA/cell mixture in electroporation cuvette. Mix gently with a 200 &#956;l pipette. 
	Note: The locus being targeted is the main factor that contributes to targeting efficiency. Loci encoding silent genes, genes not expressed in ESCs, such as PITX3 are difficult to target using conventional homologous recombination6. Thus, this protocol utilizes custom designed ZFNs for the human PITX3 locus to induce a DNA double strand break.</li>
	<li>Electroporate by following the on screen instructions on the electroporator.</li>
	<li>Using a 200 &#956;l pipette transfer the contents from the electroporation cuvette to a 15 ml tube containing 10 ml hESC media. Wash the cuvette twice with 200 &#956;l of hESC media each time and transfer to a 15 ml tube. There will be &#8220;mucous-like&#8221; debris consisting of DNA and protein from the lysed cells which will negatively impact cell survival. Centrifuge at 160 x g for 5 min to remove this debris.</li>
	<li>Aspirate the supernatant and gently tap cell pellet to loosen. Re-suspend in 30 ml supplemented MEF-CM containing 10 &#956;M Y-27632 and replate onto 3 x 100 mm dishes preplated with MEFs.</li>
	<li>Change the media daily. On day 2, Y-27632 can be withdrawn and cells grown in hESC media only.</li>
	<li>After 2-3 days the hESCs should be 50-70% confluent. At this point begin antibiotic selection (e.g., 0.5 &#956;g/ml&#160;puromycin).</li>
	<li>Maintain selection by adding fresh hESC/puromycin media daily. After ~7 days small colonies should be visible. If antibiotic resistant MEFs are not used, MEFs can be supplemented by adding an additional 1.0 x 104 cells per cm2.</li>
</ol>
4. Picking Transgenic hESC Clones
<ol>
	<li>Approximately 14 - 21 days following selection (when colonies have reached ~1 mm diameter) prepare plates for expansion and screening. Begin by defrosting an aliquot of Matrigel or Geltrex at 4&#176;C for a minimum of 5 hr. Dilute as per manufacturers&#8217; instructions and add 75 &#956;l to each well of 3 x 96-well plates. Prepare 3 x 48-well plates by plating MEFs at 2.0 x 104 cells per cm2. Incubate both plates O/N at 37 &#176;C/5% CO2.</li>
	<li>The following day dissect colonies into 16-25 pieces using a 21 G needle on the end of a 2 ml pipette by cutting a grid.</li>
	<li>Aspirate Matrigel from 96-well plates and replace with supplemented CM-MEF media. Wash MEFs in 48-well plates 1 x with HBSS and add hESC media.</li>
	<li>Using a 200 &#956;l pipette gently transfer 1/3 of the dissected colony into a 48-well plate for expansion. Transfer the other 2/3 of the dissected colony into a corresponding 96-well plate containing supplemented CM-MEF media.</li>
	<li>Maintain both plates by changing the media daily (supplemented CM-MEF media for 96-well matrigel coated plates and hESC media for 48-well plates containing MEFs; both supplemented with 0.5 &#956;g/ml&#160;puromycin).</li>
	<li>Expand until 96-well plates are 100% confluent and then initially screen via PCR.</li>
</ol>
5. Screening and Expansion of Positive Clones
<ol>
	<li>To prepare genomic DNA (method based on&#160;11) remove all media from plates by inverting, then blot onto paper towels.</li>
	<li>Rinse each well twice with RT PBS (100 &#181;l/well each wash), invert and blot as for step 5.1. Place plates at -80 &#176;C for 1 - 2 hr to aid in cell lysis (plates can be stored indefinitely like this).</li>
	<li>While cells are at -80 &#176;C make Sarcosyl Lysis Buffer (see Table 4) (50 &#181;l/well). To lyse cells, warm plates for 5 min at RT then pipette lysis buffer into each well. Seal the edges of each plate with tape, place in a sealable container containing moist paper towels to create humidity, and incubate O/N at 60 &#176;C.</li>
	<li>After incubation add 150 &#181;l of 5M NaCl to 10 ml of -20 &#176;C absolute ethanol, mix well, and add 100 &#181;l to each well (Note: ethanol will go cloudy when NaCl is added). Tap plates gently to mix (do not pipette) and leave for a minimum of 30 min at RT. During this time the solution will go clear and the DNA will precipitate.</li>
	<li>Remove solution as in step 5.1 then add 150 &#181;l of 70% ethanol to each well. Invert plate gently and blot as before. Repeat this step a further 2x. 
	Note: Because the precipitated DNA naturally adheres to the tissue culture plastic it does not become dislodged during these washing steps.)</li>
	<li>After the final wash briefly centrifuge plates at top speed to concentrate the DNA to the bottom of each well then air-dry at RT (or 37 &#176;C) for at least 30 min.</li>
	<li>Add 40 - 50 &#181;l T0.1E (pH8.0) (see Table 5) or TE (pH8.0) to each well and place plates at 65 &#176;C for 1 hr or at 4 &#176;C O/N before using for PCR. Resuspend DNA by gently tapping the sides of the plate. Use 1-2 &#181;l of re-suspended DNA/10 &#181;l PCR reaction.</li>
	<li>Using the Expand Long Template PCR System with hPITX3 L arm gen. F and hPITX3 L arm GFP R primers perform initial screening of clones at 58 &#176;C annealing, 45 sec extension, 35 cycles.</li>
	<li>Electrophorese samples with Hyperladder 1kb in a 1% agarose gel containing GelRed at 100 V for 45 min and detect positive clones via UV illumination.</li>
	<li>Validate PCR positive clones by digesting genomic DNA from expanded clones (see below) with HindIII and hybridizing probes 5&#8217; and 3&#8217; of the vector homology arms to a Southern blot (as previously described in 1). Probes are generated by PCR using primer pairs hPITX3 5&#8217; probe F and R, and hPITX3 3&#8217; probe F and R, digested with EcoRI and ligated into a general cloning vector.</li>
	<li>Depending on the number of positive clones, prepare 2 wells of a 6-well plate by pre-plating with MEFs (2.0 x 104 cells per cm2).</li>
	<li>The next day pretreat positive clones in the 48-well plate with 10 &#956;M Y-27632 for a minimum of 1 hr.</li>
	<li>Wash positive clones with HBSS and add 300 &#956;l of Accutase.</li>
	<li>When colonies are rendered single cells, add 1 ml of hESC media and collect into a 15 ml tube.</li>
	<li>Change the media daily. On day 2, Y-27632 can be withdrawn and cells grown in hESC media.</li>
	<li>When colonies are 70 - 80% confluent, subculture and freeze the remainder of the colony fragments.</li>
</ol>

<ol>
	<li>Nefzger, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lmx1a+Allows+Context-Specific+Isolation+of+Progenitors+of+GABAergic+or+Dopaminergic+Neurons+During+Neural+Differentiation+of+Embryonic+Stem+Cells.">Lmx1a Allows Context-Specific Isolation of Progenitors of GABAergic or Dopaminergic Neurons During Neural Differentiation of Embryonic Stem Cells.</a> Stem Cells. 30 (7), 1349-1361 (2012).</li><li>Zeng, W. R., Fabb, S. R. A., Haynes, J. M., Pouton, C. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extended+periods+of+neural+induction+and+propagation+of+embryonic+stem+cell-derived+neural+progenitors+with+EGF+and+FGF2+enhances+Lmx1a+expression+and+neurogenic+potential.">Extended periods of neural induction and propagation of embryonic stem cell-derived neural progenitors with EGF and FGF2 enhances Lmx1a expression and neurogenic potential.</a> Neurochemistry International. 59 (3), 394-403 (2011).</li><li>Collin, J., Lako, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Concise+review:+putting+a+finger+on+stem+cell+biology:+zinc+finger+nuclease-driven+targeted+genetic+editing+in+human+embryonic+stem+cells.">Concise review: putting a finger on stem cell biology: zinc finger nuclease-driven targeted genetic editing in human embryonic stem cells.</a> Stem Cells. 29 (7), 1021-1033 (2011).</li><li>Carroll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progress+and+prospects:+zinc-finger+nucleases+as+gene+therapy+agents.">Progress and prospects: zinc-finger nucleases as gene therapy agents.</a> Gene Therapy. 15 (22), 1463-1468 (2008).</li><li>Urnov, F. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+endogenous+human+gene+correction+using+designed+zinc-finger+nucleases.">Highly efficient endogenous human gene correction using designed zinc-finger nucleases.</a> Nature. 435 (7042), 646-651 (2005).</li><li>Hockemeyer, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+targeting+of+expressed+and+silent+genes+in+human+ESCs+and+iESCs+using+zinc-finger+nucleases.">Efficient targeting of expressed and silent genes in human ESCs and iESCs using zinc-finger nucleases.</a> Nature Biotechnology. 27 (9), 851-857 (2009).</li><li>Lombardo, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+editing+in+human+stem+cells+using+zinc+finger+nucleases+and+integrase-defective+lentiviral+vector+delivery.">Gene editing in human stem cells using zinc finger nucleases and integrase-defective lentiviral vector delivery.</a> Nature Biotechnology. 25 (11), (2007).</li><li>Boch, J., Bonas, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Xanthomonas+AvrBs3+family-type+III+effectors:+discovery+and+function.">Xanthomonas AvrBs3 family-type III effectors: discovery and function.</a> Annual Review of Phytopathology. 48, 419-436 (2010).</li><li>Hockemeyer, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+engineering+of+human+embryonic+cells+using+TALE+nucleases.">Genetic engineering of human embryonic cells using TALE nucleases.</a> Nature Biotechnology. 29 (8), 731-734 (2011).</li><li>Tucker, K. L., Wang, Y., Dausman, J., Jaenisch, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transgenic+mouse+strain+expressing+four+drug-selectable+marker+genes.">A transgenic mouse strain expressing four drug-selectable marker genes.</a> Nucleic Acids Research. 25 (18), 3745-3746 (1997).</li><li>Ram&#237;rez-Solis, R., Rivera-P&#233;rez, J., Wallace, J. D., Wims, M., Zheng, H., Bradley, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+DNA+microextraction:+a+method+to+screen+numerous+samples.">Genomic DNA microextraction: a method to screen numerous samples.</a> Analytical Biochemistry. 201 (2), 331-335 (1992).</li><li>Kawasaki, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+midbrain+dopaminergic+neurons+from+ES+cells+by+stromal+cell-derived+inducing+activity.">Induction of midbrain dopaminergic neurons from ES cells by stromal cell-derived inducing activity.</a> Neuron. 28 (1), 31-40 (2000).</li><li>Denham, M., Thompson, L. H., Leung, J., P&#233;bay, A., Bj&#246;rklund, A., Dottori, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gli1+is+an+inducing+factor+in+generating+floor+plate+progenitor+cells+from+human+embryonic+stem+cells.">Gli1 is an inducing factor in generating floor plate progenitor cells from human embryonic stem cells.</a> Stem Cells. 28 (10), 1805-1815 (2010).</li><li>Smidt, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+homeodomain+gene+Ptx3+has+highly+restricted+brain+expression+in+mesencephalic+dopaminergic+neurons.">A homeodomain gene Ptx3 has highly restricted brain expression in mesencephalic dopaminergic neurons.</a> Proceedings of the National Academy of Sciences U.S.A. 94, 13305-13310 (1997).</li></ol>

The authors have nothing to disclose.

The generation of reporter cell lines offers a powerful means to track, visualize and isolate cells of interest from a heterogeneous population derived from hESCs.&#160; However, gene targeting via conventional homologous recombination has proven to be extremely inefficient for human ESCs3.&#160; In this protocol we describe a relatively simple technique for introducing a RP into exon one of the PITX3 locus, in hESCs using a widely available targeting vector together with ZFNs.&#160; In our hands the ...

Current embryonic stem cell (ESC) differentiation protocols result in heterogeneous cell populations, particularly with respect to the derivation of specific neuronal phenotypes.&#160; Thus, although cultures contain the desired cellular phenotype, other neuronal, non-neuronal and un-differentiated cell types are often present1.&#160; These characteristics limit the application of ESC derived cell sources for use in cell replacement therapy and in vitro disease modeling.
Genetic reporter cell lines offer a means to visualize, track and isolate cells of interest, provided that the expression of the reporter protein (RP) reproduces endogenous expression.&#160; Use of promoters immediately upstream of a gene coding region can be used to derive crude genetic reporters but such constructs lack the precise regulatory elements that control endogenous gene expression.&#160; In contrast, homologous recombination offers the opportunity to ensure high-fidelity expression of the RP.&#160; In the past, targeting vectors designed for homologous recombination at specific loci of interest have been used to target RPs in mouse ESCs (mESCs) using electroporation as a means of DNA delivery1,2.&#160; However the generation of reporter cell lines via conventional homologous recombination is extremely inefficient for human ESCs (hESCs), and thus has only been documented in a handful of cases (reviewed in3). By using an engineered chimeric protein containing a fusion of a FokI nuclease with site-specific zinc-finger motifs, known collectively as zinc-finger nucleases (ZFNs), DNA double-strand breaks can be introduced at pre-determined genomic loci.&#160; When a DNA vector with homology to both sides of the DNA double strand break is added, the genomic site can be repaired by homologous recombination, allowing the incorporation of the DNA donor sequence. This technique has proved useful for genomic editing in both human primary cells4,5 and hESCs6,7.&#160; More recent work has utilized transcription activator-like effector nucleases (TALENs), transcription factors used by plant pathogens8, to aid in the design of site-specific nucleases9.
In the following protocol we demonstrate the generation of a hESC reporter cell line by electroporation of an EGFP containing homologous targeting vector6 together with ZFNs for the human Pituitary homeobox 3 (PITX3) locus.&#160; Following antibiotic selection for 2-3 weeks, hESCs with correctly integrated DNA can be manually picked, expanded and screened initially via PCR, and subsequently validated by Southern blotting.

<table><tbody><tr><td>Mouse Embryonic Fibroblasts (DR4)</td><td>GlobalStem</td><td>GSC-6004G</td><td></td></tr><tr><td>Gelatin</td><td>Sigma</td><td>G1393-100ML</td><td></td></tr><tr><td>HBSS, no Calcium, no Magnesium, no Phenol Red (HBSS)</td><td>Life Technologies</td><td>14175-095</td><td></td></tr><tr><td>Dispase</td><td>StemCell Technologies</td><td>7923</td><td></td></tr><tr><td>Cell Scraper</td><td>Corning</td><td>3008</td><td></td></tr><tr><td>Accutase</td><td>Life Technologies</td><td>A11105-01</td><td></td></tr><tr><td>Y27632</td><td>Axon Medchem</td><td>Axon 1683</td><td></td></tr><tr><td>Cell Strainer - 40 &amp;mu;m</td><td>BD Biosciences</td><td>352340</td><td></td></tr><tr><td>33 mm - 0.22 &amp;mu;m filter</td><td>Millipore</td><td>SLGP033RS</td><td></td></tr><tr><td>rhFGF2</td><td>R&amp;amp;D Systems</td><td>233-FB-025/CF</td><td></td></tr><tr><td>Electroporator</td><td>BioRad</td><td>165-2661</td><td></td></tr><tr><td>0.4 cm electroporation cuvette</td><td>BioRad</td><td>165-2088</td><td></td></tr><tr><td>Human TV-hPITX3-forward targeting construct</td><td>Addgene</td><td>31942</td><td></td></tr><tr><td>ZFN Kit; Human PITX3</td><td>Sigma-Aldrich</td><td>CKOZFN1050-1KT</td><td></td></tr><tr><td>Puromycin</td><td>InvivoGen</td><td>ant-pr-1</td><td></td></tr><tr><td>Matrigel</td><td>BD Biosciences</td><td>354277</td><td></td></tr><tr><td>Geltrex</td><td>Life Technologies</td><td>A1569601</td><td></td></tr><tr><td>NaCl</td><td>Sigma-Aldrich</td><td>S3014</td><td></td></tr><tr><td>Dulbecco&#039;s Modified Eagle Medium (DMEM)</td><td>Life Technologies</td><td>10566-016</td><td></td></tr><tr><td>Fetal Bovine Serum, Qualified, Heat Inactivated, US Origin (FBS)</td><td>Life Technologies</td><td>16140-071</td><td></td></tr><tr><td>Pen/Strep</td><td>Life Technologies</td><td>15070-063</td><td></td></tr><tr><td>Dulbecco&#039;s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12)</td><td>Life Technologies</td><td>11320-033</td><td></td></tr><tr><td>KnockOut Serum Replacement (KSR)</td><td>Life Technologies</td><td>10828-028</td><td></td></tr><tr><td>MEM Non-Essential Amino Acids&amp;nbsp; (NEAA)</td><td>Life Technologies</td><td>11140-050</td><td></td></tr><tr><td>GlutaMAX</td><td>Life Technologies</td><td>35050-061</td><td></td></tr><tr><td>&amp;szlig;-mercaptoethanol</td><td>Life Technologies</td><td>21985-023</td><td></td></tr><tr><td>N-Lauroylsarcosine sodium salt solution (Sarcosyl) (30%)</td><td>Sigma-Aldrich</td><td>61747</td><td></td></tr><tr><td>EDTA</td><td>Sigma-Aldrich</td><td>&lt;a href=&quot;http://www.sigmaaldrich.com/catalog/product/sial/e9884?lang=en&amp;amp;region=US&quot;&gt;E9884&lt;/a&gt;</td><td></td></tr><tr><td>Trizma Hydrochloride</td><td>Sigma-Aldrich</td><td>T3253</td><td></td></tr><tr><td>Proteinase K solution (20 mg/ml)</td><td>Bioline Australia</td><td>BIO-37084</td><td></td></tr><tr><td>Expand Long Template PCR System</td><td>Roche Australia</td><td>11681834001</td><td></td></tr><tr><td>hPITX3 L arm gen. F (primer): 5&amp;rsquo; TGTCCTAAGGAGAATGGGTAACAGACA 3&amp;rsquo;</td><td>GeneWorks, Australia</td><td></td><td></td></tr><tr><td>hPITX3 L arm GFP R (primer): 5&amp;rsquo; ACACGCTGAACTTGTGGCCGTTTA 3&amp;rsquo;</td><td>GeneWorks, Australia</td><td></td><td></td></tr><tr><td>HyperLadder 1 kb&amp;nbsp;</td><td>Bioline Australia</td><td>BIO-33025</td><td></td></tr><tr><td>GelRed</td><td>Jomar Bioscience, Australia</td><td>41003</td><td></td></tr></tbody></table>

zinc-finger nuclease enhanced gene targeting in human embryonic stem cells

One major limitation with current human embryonic stem cell (ESC) differentiation protocols is the generation of heterogeneous cell populations.&#160;These cultures contain the cells of interest, but are also contaminated with undifferentiated ESCs, non-neural derivatives and other neuronal subtypes.&#160; This limits their use in in vitro and in vivo applications, such as in vitro modeling for drug discovery or cell replacement therapy. To help overcome this, reporter cell lines, which offer a means to visualize, track and isolate cells of interest, can be engineered.&#160;However, to achieve this in human embryonic stem cells via conventional homologous recombination is extremely inefficient.&#160;This protocol describes targeting of the Pituitary homeobox 3 (PITX3) locus in human embryonic stem cells using custom designed zinc-finger nucleases, which introduce site-specific double-strand DNA breaks, together with a PITX3-EGFP-specific DNA donor vector. Following the generation of the PITX3 reporter cell line, it can then be differentiated using published protocols for use in studies such as in vitro Parkinson&#8217;s disease modeling or cell replacement therapy.

Following co-electroporation of the custom designed PITX3 zinc-finger pair together with the PITX3-EGFP-specific DNA donor vector, and subsequent puromycin selection, positive hESC clones were initially detected via genomic PCR screening (Figure 1). Southern blot hybridization of these PCR positive clones with 5&#8217; and 3&#8217; specific probes confirmed correct targeting to exon 1 of the PITX3 locus (Figure 2), with an efficiency of 19%. Immunofluo...

Watch this Scientific Journal Video about Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells at JoVE.com

Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells

Reporter cell lines offer a means to visualize, track and isolate cells of interest from heterogeneous populations.&#160;However, gene-targeting using conventional homologous recombination in human embryonic stem cells is extremely inefficient. Herein, we describe targeting CNS midbrain specific transcription factor PITX3 locus with EGFP using zinc-finger nuclease enhanced homologous recombination.

One major limitation with current human embryonic stem cell (ESC) differentiation protocols is the generation of heterogeneous cell ...

zinc-finger-nuclease-enhanced-gene-targeting-human-embryonic-stem

Research

JoVE Journal

Biology

10.8K Views.  Monash University. Reporter cell lines offer a means to visualize, track and isolate cells of interest from heterogeneous populations. However, gene-targeting using conventional homologous recombination in human embryonic stem cells is extremely inefficient. Herein, we describe targeting CNS midbrain specific transcription factor PITX3 locus with EGFP using zinc-finger nuclease enhanced homologous recombination.

Video: Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells

Transfection, Selection, and Colony-picking of Human Induced Pluripotent Stem Cells TALEN-targeted with a GFP Gene into the AAVS1 Safe Harbor

Targeted transgene addition can provide persistent gene expression while circumventing the gene silencing and insertional mutagenesis caused by viral vector mediated random integration. This protocol describes a universal and efficient transgene targeted addition platform in human iPSCs based on utilization of validated open-source TALENs and a gene-trap-like donor to deliver transgenes into a safe harbor locus. Importantly, effective gene editing is rate-limited by the delivery efficiency of gene editing vectors. Therefore, this protocol first focuses on preparation of iPSCs for transfection to achieve high nuclear delivery efficiency. When iPSCs are dissociated into single cells using a gentle-cell dissociation reagent and transfected using an optimized program, >50% cells can be induced to take up the large gene editing vectors. Because the AAVS1 locus is located in the intron of an active gene (PPP1R12C), a splicing acceptor (SA)-linked puromycin resistant gene (PAC) was used to select targeted iPSCs while excluding random integration-only and untransfected cells. This strategy greatly increases the chance of obtaining targeted clones, and can be used in other active gene targeting experiments as well. Two weeks after puromycin selection at the dose adjusted for the specific iPSC line, clones are ready to be picked by manual dissection of large, isolated colonies into smaller pieces that are transferred to fresh medium in a smaller well for further expansion and genetic and functional screening. One can follow this protocol to readily obtain multiple GFP reporter iPSC lines that are useful for in vivo and in vitro imaging and cell isolation.

TALEN-mediated gene editing at the safe harbor AAVS1 locus enables high-efficiency transgene addition in human iPSCs. This protocol describes the procedures for preparing iPSCs for TALEN and donor vector delivery, transfecting iPSCs, and selecting and isolating iPSC clones to achieve targeted integration of a GFP gene to generate reporter lines.

Targeted transgene addition can provide persistent gene expression while circumventing the gene silencing and insertional mutagenesis caused by viral ...

Developmental Biology

Establishment of Genome-edited Human Pluripotent Stem Cell Lines: From Targeting to Isolation

Genome-editing of human pluripotent stem cells (hPSCs) provides a genetically controlled and clinically relevant platform from which to understand human development and investigate the pathophysiology of disease. By employing site-specific nucleases (SSNs) for genome editing, the rapid derivation of new hPSC lines harboring specific genetic alterations in an otherwise isogenic setting becomes possible. Zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 are the most commonly used SSNs. All of these nucleases function by introducing a double stranded DNA break at a specified site, thereby promoting precise gene editing at a genomic locus. SSN-meditated genome editing exploits two of the cell&#39;s endogenous DNA repair mechanisms, non-homologous end joining (NHEJ) and homology directed repair (HDR), to either introduce insertion/deletion mutations or alter the genome using a homologous repair template at the site of the double stranded break. Electroporation of hPSCs is an efficient means of transfecting SSNs and repair templates that incorporate transgenes such as fluorescent reporters and antibiotic resistance cassettes. After electroporation, it is possible to isolate only those hPSCs that incorporated the repair construct by selecting for antibiotic resistance. Mechanically separating hPSC colonies and confirming proper integration at the target site through genotyping allows for the isolation of correctly targeted and genetically homogeneous cell lines. The validity of this protocol is demonstrated here by using all three SSN platforms to incorporate EGFP and a puromycin resistance construct into the AAVS1 safe harbor locus in human pluripotent&#160;stem cells.

Genome editing of human pluripotent stem cells (hPSCs) can be done quickly and efficiently. Presented here is a robust experimental procedure to genetically engineer hPSCs as exemplified by editing the AAVS1 safe harbor locus to express EGFP and introduce antibiotic resistance.

Genome-editing of human pluripotent stem cells (hPSCs) provides a genetically controlled and clinically relevant platform from which to understand human ...

Introducing Point Mutations into Human Pluripotent Stem Cells Using Seamless Genome Editing

Custom designed endonucleases, such as RNA-guided Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9, enable efficient genome editing in mammalian cells. Here we describe detailed procedures to seamlessly genome edit the hepatocyte nuclear factor 4 alpha (HNF4&#945;) locus as an example in human pluripotent stem cells. Combining a piggyBac-based donor plasmid and the CRISPR-Cas9 nickase mutant in a two-step genetic selection, we demonstrate correct and efficient targeting of the HNF4&#945; locus.

Here, we describe a detailed method for seamless gene editing in human pluripotent stem cells using a piggyBac-based donor plasmid and the Cas9 nickase mutant. Two point mutations were introduced into exon 8 of the hepatocyte nuclear factor 4 alpha (HNF4&#945;) locus in human embryonic stem cells (hESCs).

Custom designed endonucleases, such as RNA-guided Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9, enable efficient genome editing ...

Genetics

CRISPR/Cas9-Mediated Highly Efficient Gene Targeting in Embryonic Stem Cells for Developing Gene-Manipulated Mouse Models

The CRISPR/Cas9 system has made it possible to develop genetically modified mice by direct genome editing using fertilized zygotes. However, although the efficiency in developing gene-knockout mice by inducing small indel mutation would be sufficient enough, the efficiency of embryo genome editing for making large-size DNA knock-in (KI) is still low. Therefore, in contrast to the direct KI method in embryos, gene targeting using embryonic stem cells (ESCs) followed by embryo injection to develop chimera mice still has several advantages (e.g., high throughput targeting in vitro, multi-allele manipulation, and Cre and flox gene manipulation can be carried out in a short period). In addition, strains with difficult-to-handle embryos in vitro, such as BALB/c, can also be used for ESC targeting. This protocol describes the optimized method for large-size DNA (several kb) KI in ESCs by applying CRISPR/Cas9-mediated genome editing followed by chimera mice production to develop gene-manipulated mouse models.

Here we present a protocol for developing genetically modified mouse models using embryonic stem cells, especially for large DNA knock-in (KI). This protocol is tuned up using CRISPR/Cas9 genome editing, resulting in significantly improved KI efficiency compared with the conventional homologous recombination-mediated linearized DNA targeting method.

The CRISPR/Cas9 system has made it possible to develop genetically modified mice by direct genome editing using fertilized zygotes. However, although the ...

Transfecting and Nucleofecting Human Induced Pluripotent Stem Cells

Genetic modification is continuing to be an essential tool in studying stem cell biology and in setting forth potential clinical applications of human embryonic stem cells (HESCs)1. While improvements in several gene delivery methods have been described2-9, transfection remains a capricious process for HESCs, and has not yet been reported in human induced pluripotent stem cells (iPSCs). In this video, we demonstrate how our lab routinely transfects and nucleofects human iPSCs using plasmid with an enhanced green fluorescence protein (eGFP) reporter. Human iPSCs are adapted and maintained as feeder-free cultures to eliminate the possibility of feeder cell transfection and to allow efficient selection of stable transgenic iPSC clones following transfection. For nucleofection, human iPSCs are pre-treated with ROCK inhibitor11, trypsinized into small clumps of cells, nucleofected and replated on feeders in feeder cell-conditioned medium to enhance cell recovery. Transgene-expressing human iPSCs can be obtained after 6 hours. Antibiotic selection is applied after 24 hours and stable transgenic lines appear within 1 week. Our protocol is robust and reproducible for human iPSC lines without altering pluripotency of these cells.

Despite recent advancements in genetic modification, transfection of human embryonic stem cells (HESCs) remains a capricious process. To our knowledge, systematic and efficient methods to transfect human induced pluripotent stem cells (iPSCs) have not been reported. Here, we describe robust protocols to efficiently transfect and nucleofect human iPSCs.

Genetic modification is continuing to be an essential tool in studying stem cell biology and in setting forth potential clinical applications of human ...

Genome Editing with CompoZr Custom Zinc Finger Nucleases (ZFNs)

Genome editing is a powerful technique that can be used to elucidate gene function and the genetic basis of disease. Traditional gene editing methods such as chemical-based mutagenesis or random integration of DNA sequences confer indiscriminate genetic changes in an overall inefficient manner and require incorporation of undesirable synthetic sequences or use of aberrant culture conditions, potentially confusing biological study. By contrast, transient ZFN expression in a cell can facilitate precise, heritable gene editing in a highly efficient manner without the need for administration of chemicals or integration of synthetic transgenes.
Zinc finger nucleases (ZFNs) are enzymes which bind and cut distinct sequences of double-stranded DNA (dsDNA). A functional CompoZr ZFN unit consists of two individual monomeric proteins that bind a DNA "half-site" of approximately 15-18 nucleotides (see Figure 1). When two ZFN monomers "home" to their adjacent target sites the DNA-cleavage domains dimerize and create a double-strand break (DSB) in the DNA.1 Introduction of ZFN-mediated DSBs in the genome lays a foundation for highly efficient genome editing. Imperfect repair of DSBs in a cell via the non-homologous end-joining (NHEJ) DNA repair pathway can result in small insertions and deletions (indels). Creation of indels within the gene coding sequence of a cell can result in frameshift and subsequent functional knockout of a gene locus at high efficiency.2 While this protocol describes the use of ZFNs to create a gene knockout, integration of transgenes may also be conducted via homology-directed repair at the ZFN cut site.
The CompoZr Custom ZFN Service represents a systematic, comprehensive, and well-characterized approach to targeted gene editing for the scientific community with ZFN technology. Sigma scientists work closely with investigators to 1) perform due diligence analysis including analysis of relevant gene structure, biology, and model system pursuant to the project goals, 2) apply this knowledge to develop a sound targeting strategy, 3) then design, build, and functionally validate ZFNs for activity in a relevant cell line. The investigator receives positive control genomic DNA and primers, and ready-to-use ZFN reagents supplied in both plasmid DNA and in-vitro transcribed mRNA format. These reagents may then be delivered for transient expression in the investigator&#x2019;s cell line or cell type of choice. Samples are then tested for gene editing at the locus of interest by standard molecular biology techniques including PCR amplification, enzymatic digest, and electrophoresis. After positive signal for gene editing is detected in the initial population, cells are single-cell cloned and genotyped for identification of mutant clones/alleles.

Genome Editing with CompoZr Custom Zinc Finger Nucleases ZFNs

The CompoZr Custom Zinc-Finger Nuclease (ZFN) Service enables precise genome editing in any organism or cell line at any locus defined by the user. This article describes the process for the design, manufacture, validation and implementation of the CompoZr Custom ZFN Service.

Genome editing is a powerful technique that can be used to elucidate gene function and the genetic basis of disease. Traditional gene editing methods such ...

Rapid and Efficient Generation of Recombinant Human Pluripotent Stem Cells by Recombinase-mediated Cassette Exchange in the AAVS1 Locus

Even with the revolution of gene-targeting technologies led by CRISPR-Cas9, genetic modification of human pluripotent stem cells&#160;(hPSCs)&#160;is still time consuming. Comparative studies that use recombinant lines with transgenes integrated into safe harbor loci could benefit from approaches that use site-specific targeted recombinases, like Cre or FLPe, which are more rapid and less prone to off-target effects. Such methods have been described, although they do not significantly outperform gene targeting in most aspects. Using Zinc-finger nucleases, we previously created a master cell line in the AAVS1 locus of hPSCs&#160;that contains a GFP-Hygromycin-tk expressing cassette, flanked by heterotypic FRT sequences. Here, we describe the procedures to perform FLPe recombinase-mediated cassette exchange (RMCE) using this line. The master cell line is transfected with a RMCE donor vector, which contains a promoterless Puromycin resistance, and with FLPe recombinase. Application of both a positive (Puromycin) and negative (FIAU) selection program leads to the selection of RMCE without random integrations. RMCE generates fully characterized pluripotent polyclonal transgenic lines in 15 d&#160;with 100% efficiency. Despite the recently described limitations of the AAVS1 locus, the ease of the system paves the way for hPSC transgenesis in isogenic settings, is necessary for comparative studies, and enables semi-high-throughput genetic screens for gain/loss of function analysis that would otherwise be highly time consuming.

Rapid and Efficient Generation of Recombinant Human Pluripotent Stem Cells by Recombinase-mediated Cassette Exchange in the AAVS1 Locus

Here we report a rapid and efficient gene editing method based on RMCE in the AAVS1 locus of human Pluripotent Stem Cells (hPSCs) that improves upon previously described systems. Using this technique, isogenic lines can be rapidly and reliably generated for proper comparative studies, facilitating transgenesis-mediated research with hPSCs.

Even with the revolution of gene-targeting technologies led by CRISPR-Cas9, genetic modification of human pluripotent stem cells&#160;(hPSCs)&#160;is ...

Medicine

Mouse Genome Engineering Using Designer Nucleases

Transgenic mice carrying site-specific genome modifications (knockout, knock-in) are of vital importance for dissecting complex biological systems as well as for modeling human diseases and testing therapeutic strategies. Recent advances in the use of designer nucleases such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system for site-specific genome engineering open the possibility to perform rapid targeted genome modification in virtually any laboratory species without the need to rely on embryonic stem (ES) cell technology. A genome editing experiment typically starts with identification of designer nuclease target sites within a gene of interest followed by construction of custom DNA-binding domains to direct nuclease activity to the investigator-defined genomic locus. Designer nuclease plasmids are in vitro transcribed to generate mRNA for microinjection of fertilized mouse oocytes. Here, we provide a protocol for achieving targeted genome modification by direct injection of TALEN mRNA into fertilized mouse oocytes.

Designer nucleases such as zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) can be used to modify the genome of mouse preimplantation embryos by triggering both the nonhomologous end joining (NHEJ) and homologous recombination (HR) pathways. These advances enable the rapid generation of mice with precise genetic modifications.

Transgenic mice carrying site-specific genome modifications (knockout, knock-in) are of vital importance for dissecting complex biological systems as well ...

CRISPR-Cas9 Mediated Gene Deletion in Human Pluripotent Stem Cells Cultured Under Feeder-Free Conditions

The CRISPR-Cas9 system for genome editing has revolutionized gene function studies in mammalian cells, including stem cells. However, the practical application of this technique, particularly in pluripotent stem cells, presents certain challenges, such as being time- and labor-intensive and having low editing efficiency. Here, we describe the generation of a CRISPR-mediated gene knockout in a human embryonic stem cell (hESC) line stably expressing sgRNAs for the L2HGDH gene, using a highly efficient and stable lentiviral-mediated gene delivery system. The sgRNAs targeting exon 1 of the L2HGDH gene were chemically synthesized and cloned into the lentiCRISPR v2-puro vector, which combines the constitutive expression of sgRNAs with Cas9 in a highly efficient single-vector system to achieve higher lentiviral titers for hESC infection and stable selection using puromycin. Puromycin-selected cells were further expanded, and single-cell clones were obtained using the limited dilution method. The single clones were expanded, and several homozygous knockout clones for the L2HGDH gene were obtained, as confirmed by a 100% reduction in L2HGDH expression using Western blot analysis. Furthermore, using MSBSP-PCR, the CRISPR mutation site was mapped upstream of the PAM recognition sequence of Cas9 in the selected homozygous clones. Sanger sequencing was performed to analyze the exact insertions/deletions, and functional characterization of the clones was conducted. This method produced a significantly higher percentage of homozygous deletions compared to previously reported non-viral gene delivery methods. Although this report focuses on the L2HGDH gene, this robust and cost-effective approach can be used to create homozygous knockouts for other genes in pluripotent stem cells for gene function studies.

The presented method describes the generation of a CRISPR-mediated gene knockout in the human embryonic stem cell (hESC) line H9, which stably expresses sgRNAs targeting the L2HGDH gene using a highly efficient lentiviral-mediated gene delivery system.

The CRISPR-Cas9 system for genome editing has revolutionized gene function studies in mammalian cells, including stem cells. However, the practical ...

Zinc Finger Nuclease-Based Genome Editing: A Technique for Modifying Genome in Human Pluripotent Stem Cells by Double-Stranded Homology Dependant Repair Mechanism

Source: Blair, J. D., et al. <a href="https://www.jove.com/v/53583">Establishment of Genome-edited Human Pluripotent Stem Cell Lines: From Targeting to Isolation.</a> J. Vis. Exp. (2016).
This video demonstrates a technique of zinc-finger nuclease-based genome editing in human pluripotent stem cells (hPSCs). As hPSCs can potentially be differentiated into various cell types, this technology is helpful for in vitro pathological and pharmacological studies in a patient-specific manner.

Source: Blair, J. D., et al. Establishment of Genome-edited Human Pluripotent Stem Cell Lines: From Targeting to Isolation. J. Vis. Exp. (2016).
This ...

Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells

Summary

Explore More Videos

Transfection, Selection, and Colony-picking of Human Induced Pluripotent Stem Cells TALEN-targeted with a GFP Gene into the AAVS1 Safe Harbor

Establishment of Genome-edited Human Pluripotent Stem Cell Lines: From Targeting to Isolation

Introducing Point Mutations into Human Pluripotent Stem Cells Using Seamless Genome Editing

CRISPR/Cas9-Mediated Highly Efficient Gene Targeting in Embryonic Stem Cells for Developing Gene-Manipulated Mouse Models

Transfecting and Nucleofecting Human Induced Pluripotent Stem Cells

Genome Editing with CompoZr Custom Zinc Finger Nucleases (ZFNs)

Rapid and Efficient Generation of Recombinant Human Pluripotent Stem Cells by Recombinase-mediated Cassette Exchange in the AAVS1 Locus

Mouse Genome Engineering Using Designer Nucleases

CRISPR-Cas9 Mediated Gene Deletion in Human Pluripotent Stem Cells Cultured Under Feeder-Free Conditions

Zinc Finger Nuclease-Based Genome Editing: A Technique for Modifying Genome in Human Pluripotent Stem Cells by Double-Stranded Homology Dependant Repair Mechanism