The authors wish to thank Xiaobin Zhang for his plasmid. We also thank Shaorong Gao and Qianfei Wang for their kind help during the experiment. This study is supported by the National Natural Science Foundation of China (No.81101346, 81271963, 81100331), the Beijing 215 high-level talent project (No.2014-3-025), and the Beijing Chao-Yang Hospital Fund (No. CYXX-2017-01), and the Youth Innovation Promotion Association of Chinese Academy of Sciences (Y.L.).

The protocol for the generation of hiPSCs from PBCs can be found in our previous study5. The study was approved by the Institutional Review Board of our institution.
1. Embryoid Body (EB) Formation
<ol>
	<li>Make 50 mL of hiPSC medium: Knockout Dulbecco&#39;s Modified Eagle Medium (DMEM) supplemented with 15% knockout serum replacement (KSR), 5% fetal bovine serum (FBS), 1&#215; nonessential amino acids, 55 &#956;M 2-mercaptoethanol, 2 mM L-glutamine, and 8 ng/mL basic fibroblast growth factor (bFGF).</li>
	<li>Make 50 mLof EB formation medium: DMEM supplemented with 15% KSR, 5% FBS, 1x nonessential amino acids, 55 &#956;M 2-mercaptoethanol, and 2 mM L-glutamine.</li>
	<li>Make 50 mL of basal culture medium: DMEM supplemented with 20% FBS, 1&#215; nonessential amino acids, 55 &#956;M 2-mercaptoethanol, and 2 mM L-glutamine.</li>
	<li>Prepare 10 mL of dispase solution, 1 mg/mL in knockout DMEM.</li>
	<li>Culture hiPSCs onto 60-mm tissue culture dishes with feeder cells (i.e., a monolayer of irradiated mouse embryonic fibroblast cells). When the cells are 80-90% confluent, disassociate the cells with dispase and passage the hiPSCs 1:3 every 4-5 days. Place the cells into a 37 &#176;C and 5% CO2 incubator.</li>
	<li>Dissect the undifferentiated hiPSC colonies into smaller pieces (about 50-100 &#181;m in diameter) using a fire-drawn glass needle when the iPSCs are 80-90% confluent. Generally, use hiPSC colonies in a 60-mm dish to generate EBs in a 100 mm Petri dish.
	<ol>
		<li>Culture less than 100 small pieces of colonies in a 100 mm, non-adherent Petri dish containing 10 mL of EB formation medium. Place the dishes into a 37 &#176;C and 5% CO2 incubator.</li>
	</ol>
	</li>
	<li>Replace approximately 25% of the initial medium with an equal amount of the basal culture medium every 2 days. Tilt the dish to let the EBs settle. Carefully remove 3 mL of upper medium and add 4 mL of fresh basal culture medium. Do not disturb the EBs. 
	NOTE: The EBs are morphologically characterized by the pieces of colonies, taking on a round appearance with smooth borders under the microscope.</li>
	<li>After 10 days of culture in the non-adherent Petri dish, coat a new 100-mm tissue culture dish with 4 mL of 0.1% gelatin for 30 min at 37 &#176;C before use.</li>
	<li>Transfer the medium plus EBs from a 100 mm, non-adherent Petri dish to a 15-mL conical tube. Let the EBs sediment for 4-5 min. Aspirate the supernatant carefully and leave less than 0.5 mL of medium plus EBs</li>
	<li>Seed less than 100 EBs onto a 100 mm, gelatin-coated tissue culture dish with 10 mL of basal culture medium. Place the dishes into a 37 &#176;C and 5% CO2 incubator.</li>
</ol>
2. Cell Pellet Formation and Chondrocyte Differentiation
<ol>
	<li>Make 10 mL of 0.25% trypsin/ethylenediaminetetraacetic acid (EDTA). Make 80 mL of basal culture medium: DMEM supplemented with 20% FBS, 1x nonessential amino acids, 55 &#956;M 2-mercaptoethanol, and 2 mM L-glutamine.</li>
	<li>Make 10 mL of chondrogenic differentiation medium: DMEM (high glucose) supplemented with 10% insulin-transferrin-selenium solution (ITS), 0.1 &#181;M dexamethasone, 1 mM ascorbic acid, 1% sodium pyruvate, and 10 ng/mL transforming growth factor-beta 1(TGF-&#946;1).</li>
	<li>Refresh the medium with 10 mL of basal culture medium after 48 h. Thereafter, refresh the medium every three days with 10 mL of basal culture medium. 
	NOTE: After 10 days in culture, fibroblastic cell outgrowths should have expanded from the EBs.
	<ol>
		<li>Coat the 100 mm dishes with 4 mL of 0.1% gelatin for 30 min at 37 &#176;C before use. Discard the cell supernatant and wash the cells with Dulbecco&#39;s Phosphate-Buffered Saline (DPBS) once.</li>
		<li>Digest the cells with 3 mL of 0.25% trypsin/EDTA at 37 &#176;C for 5 min and neutralize with 4 mL of basal culture medium.</li>
	</ol>
	</li>
	<li>Dissociate the cells into single cells by pipetting up and down 5-10 times and passing them through a 70 &#181;m nylon mesh. Centrifuge the cell suspension at 200 x g for 5 min. Re-seed the cells on a new 100 mm, gelatin-coated tissue culture dish with 10 mL of basal culture medium.</li>
	<li>Refresh the medium with 10 mL of basal culture medium after 48 h. Thereafter, refresh the medium every three days with 10 mL of basal culture medium. 
	NOTE: The cells acquire a homogenous, fibroblast-like morphology.</li>
	<li>When ~90-100% confluence is reached (i.e., about 5-7 days), harvest the cells with 3 mL of 0.25% trypsin/EDTA at 37 &#176;C for 5 min. Neutralize with 4 mL of basal culture medium. Dissociate the cells into single cells by pipetting up and down 5 times. Use a hemocytometer to count the cell number.
	<ol>
		<li>Place 3 x 105 cells in a 15 mL polypropylene tube. Centrifuge at 200 x g for 5 min at room temperature (RT). Re-suspend the cells in 1 mL of chondrogenic differentiation medium.</li>
	</ol>
	</li>
	<li>Re-centrifuge the cells at 300 x g for 3 min and maintain the cells in small pellet form. Put the tube into the 37 &#176;C and 5% CO2&#160;incubator for 21 days. Do not screw the lid on tightly and let the gas exchange.</li>
	<li>Replace 3/4 of the culture medium every three days with fresh chondrogenic differentiation medium. 
	NOTE: After 21 days in culture, hiPSC-chondrogenic pellets (hiPSC-Chon) should have formed. Human mesenchymal stem cells (MSCs), as a positive control, are also collected and cultured in the chondrogenic differentiation medium for 21 days to form chondrogenic pellets (hMSC-Chon).</li>
</ol>
3. Analysis of Chondrogenic Differentiation
<ol>
	<li>Prepare 10 mL of 10% neutral-buffered formalin.</li>
	<li>Prepare 50 mL of 0.1% alcian blue reagent and 50 mL of 1% toluidine blue reagent.</li>
	<li>Prepare 1 mL of the primary antibodies: rabbit polyclonal antibodies against collagen II (1:50) or mouse monoclonal antibodies against collagen X (1:50). Also, prepare anti-rabbit or mouse secondary antibodies.</li>
	<li>Make 1 mL of papain solution: 10 U/mL in PBS with 0.1 M sodium acetate, 2.4 mM EDTA, and 5 mM L-cysteine.</li>
	<li>Make 100 mL dimethylmethylene blue (DMMB) dye solution: 100 &#181;L of 16 mg/L 1,9-dimethylmethylene blue, 40 mM glycine, 40 mM NaCl, and 9.5 mM HCl; pH 3.0.</li>
	<li>Assess chondrogenic differentiation by alcian blue and toluidine blue stains of the pellet sections.
	<ol>
		<li>Fix one hiPSC-Chon pellet or hMSC-Chon pellet in 1 mL of 10% neutral-buffered formalin for 24 h.</li>
		<li>Transfer the pellet to 1 mL of 70% ethanol in H2O. Dehydrate the pellet with 1 mL of a graded ethanol series (i.e., 25, 50, 75, 90, 95, 100, and 100%, 3 min each).</li>
		<li>Clarify the pellet in 1 mL of 100% xylene three times. Infiltrate the pellet with paraffin for 1 h in a 65 &#176;C oven. Embed the pellet into paraffin blocks with a 7 x 7 x 5 mm3 base mold, following routine histological procedures6.</li>
		<li>Make adjacent sections by microtome with a thickness of approximately 4 &#181;m7. Adhere the sections onto glass slides.</li>
		<li>Dry the slides for 2 h at 60 &#176;C in an oven. Deparaffinize the sections in three cycles (3 min each) using 100% xylene.</li>
		<li>Use a decreasing alcohol series for rehydration (i.e., 100, 100, 95, 95, 70, 50, and 25% in H2O, 3 min each) and then perform a final rinse with deionized water for 5 min.</li>
		<li>Stain the sections with 0.1% alcian blue reagent or 1% toluidine blue staining for 4-5 h and then rinse them with distilled water.</li>
		<li>Dehydrate with a graded ethanol series (i.e., 25, 50, 75, 90, 95, 100, and 100%, 3 min each) followed by three consecutive steps of clarification in 100% xylene. Mount the slides and visualize them under a microscope.</li>
	</ol>
	</li>
	<li>Perform immunohistochemistry. 
	NOTE: Additional pellet sections are further assessed by immunohistochemistry.
	<ol>
		<li>After deparaffinization and rehydration, bring the slides to a boil in 1 mM EDTA, pH 8.0 (waterproof in water boiled by autoclave). Let them sit for 8 min at a sub-boiling temperature and then allow the slides to cool at RT.</li>
		<li>Rinse the slides with deionized water 3 times. Incubate the sections in 3% H2O2 solution in methanol at RT for 15 min to block endogenous peroxidase activity.</li>
		<li>Rinse the slides with deionized water and immerse them in DPBS for 5 min. Apply 50-100 &#181;L of appropriately diluted (1:50) primary antibody to the sections on the slides and then incubate them in a humidified chamber at RT for 1 h.</li>
		<li>Wash the slides 3 times (5 min each) with DPBS. Incubate the samples with the corresponding secondary antibodies (i.e., anti-rabbit or mouse) for 15 min at RT.</li>
		<li>Wash the slides 3 times (for 5 min each) with DPBS. Perform DAB detection under a microscope.</li>
		<li>Wash the slides with DPBS 3 times (2 min each). Counterstain the cell nuclei by immersing the slides in hematoxylin for 1-2 min. Dehydrate with a graded ethanol series (25, 50, 75, 90, 95, 100, and 100%; 3 min each) followed by three consecutive steps of clarification with xylene. Finally, mount the slides and visualize them under the microscope.</li>
	</ol>
	</li>
	<li>Detect sGAG content.
	<ol>
		<li>Digest chondrogenic pellets in papain solution at 60 &#176;C for 2 h.</li>
		<li>Determine the DNA content using the dsDNA assay kit and fluorometer system. Measure the sGAG content by mixing it with DMMB dye solution under measuring absorbance at 525 nm8.</li>
		<li>Calculate the concentration of sGAG against a standard curve of shark chondroitin sulfate.</li>
	</ol>
	</li>
	<li>Perform the real-time PCR analysis of the chondrogenic differentiation markers in hiPSC-Chon pellets.
	<ol>
		<li>Harvest 3-4 of the same chondrogenic pellets by adding 500 &#181;L of ice-cold extraction reagent to one tube. Vortex thoroughly. Incubate the sample for 5 min at RT.</li>
		<li>Add 0.1 mL of chloroform. Vortex the sample for 15 s and incubate it at RT for 3 min. Centrifuge the sample for 15 min at 12,000 x g and 4 &#176;C. Transfer the upper aqueous phase (about 250 &#181;L) into a new 1.5 mL microcentrifuge tube.</li>
		<li>Add 25 &#181;L of sodium acetate and 1 &#181;L of glycogen to the sample. Precipitate the RNA by mixing it with 250 &#181;L of isopropyl alcohol. Mix thoroughly. Incubate the sample at RT for 10 min.</li>
		<li>Centrifuge for 10 min at 12,000 x g and 4 &#176;C. Remove the supernatant completely. Wash the RNA pellet twice with 500 &#181;L of 75% ethanol.</li>
		<li>Centrifuge for 5 min at 7,500 x g and 4 &#176;C. Remove all leftover ethanol and air-dry the RNA pellet for 5-10 min. Dissolve the RNA in 10 &#181;L of nuclease-free water.</li>
		<li>Convert the RNA into cDNA using a reverse transcriptase system. Subject the cDNA samples to real-time PCR using qPCR kit master mix (2x) and a real-time PCR system9. 
		NOTE: The primer sequences are: 
		hAGGRECAN-F:TCGAGGACAGCGAGGCC; 
		hAGGRECAN-R: TCGAGGGTGTAGCGTGTAGAGA; 
		h&#946;-ACTIN-F: TTTGAATGATGAGCCTTCGTCCCC; 
		h&#946;-ACTIN-R: GGTCTCAAGTCAGTGTACAGGTAAGC; 
		hCOL2-F:TGGACGATCAGGCGAAACC; 
		hCOL2-R:GCTGCGGATGCTCTCAATCT; 
		hSOX9-F:AGCGAACGCACATCAAGAC; 
		hSOX9-R:CTGTAGGCGATCTGTTGGGG; 
		hCOL10-F: ATGCTGCCACAAATACCCTTT; 
		hCOL10-R: GGTAGTGGGCCTTTTATGCCT.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Diekman, B. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cartilage+tissue+engineering+using+differentiated+and+purified+induced+pluripotent+stem+cells.">Cartilage tissue engineering using differentiated and purified induced pluripotent stem cells.</a> Proc Natl Acad Sci USA. 109 (47), 19172-19177 (2012).</li><li>Park, I. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disease-specific+induced+pluripotent+stem+cells.">Disease-specific induced pluripotent stem cells.</a> Cell. 134 (5), 877-886 (2008).</li><li>Loh, Y. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+induced+pluripotent+stem+cells+from+human+blood.">Generation of induced pluripotent stem cells from human blood.</a> Blood. 113 (22), 5476-5479 (2009).</li><li>Zhang, X. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+reprogramming+of+human+peripheral+blood+cells.">Cellular reprogramming of human peripheral blood cells.</a> Genomics Proteomics Bioinformatics. 11 (5), 264-274 (2013).</li><li>Li, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reprogramming+of+blood+cells+into+induced+pluripotent+stem+cells+as+a+new+cell+source+for+cartilage+repair.">Reprogramming of blood cells into induced pluripotent stem cells as a new cell source for cartilage repair.</a> Stem Cell Res Ther. 7 (31), (2016).</li><li>Canene-Adams, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+formalin-fixed+paraffin-embedded+tissue+for+immunohistochemistry.">Preparation of formalin-fixed paraffin-embedded tissue for immunohistochemistry.</a> Methods Enzymol. 533, 225-233 (2013).</li><li>Solchaga, L. A., Penick, K. J., Welter, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chondrogenic+differentiation+of+bone+marrow-derived+mesenchymal+stem+cells:+tips+and+tricks.">Chondrogenic differentiation of bone marrow-derived mesenchymal stem cells: tips and tricks.</a> Methods Mol Biol. 698, 253-278 (2011).</li><li>Oldershaw, R. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+differentiation+of+human+embryonic+stem+cells+toward+chondrocytes.">Directed differentiation of human embryonic stem cells toward chondrocytes.</a> Nat Biotechnol. 28 (11), 1187-1194 (2010).</li><li>Monje, L., Varayoud, J., Luque, E. H., Ramos, J. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neonatal+exposure+to+bisphenol+A+modifies+the+abundance+of+estrogen+receptor+alpha+transcripts+with+alternative+5'-untranslated+regions+in+the+female+rat+preoptic+area.">Neonatal exposure to bisphenol A modifies the abundance of estrogen receptor alpha transcripts with alternative 5'-untranslated regions in the female rat preoptic area.</a> J Endocrinol. 194 (1), 201-212 (2007).</li><li>Teramura, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+mesenchymal+progenitor+cells+with+chondrogenic+property+from+mouse-induced+pluripotent+stem+cells.">Induction of mesenchymal progenitor cells with chondrogenic property from mouse-induced pluripotent stem cells.</a> Cell Reprogram. 12 (3), 249-261 (2010).</li><li>Su, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+generation+of+integration-free+ips+cells+from+human+adult+peripheral+blood+using+BCL-XL+together+with+Yamanaka+factors.">Efficient generation of integration-free ips cells from human adult peripheral blood using BCL-XL together with Yamanaka factors.</a> PLoS One. 8 (5), e64496 (2013).</li><li>Carey, B. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reprogramming+factor+stoichiometry+influences+the+epigenetic+state+and+biological+properties+of+induced+pluripotent+stem+cells.">Reprogramming factor stoichiometry influences the epigenetic state and biological properties of induced pluripotent stem cells.</a> Cell Stem Cell. 9 (6), 588-598 (2011).</li><li>Okita, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+nonviral+method+to+generate+integration-free+human-induced+pluripotent+stem+cells+from+cord+blood+and+peripheral+blood+cells.">An efficient nonviral method to generate integration-free human-induced pluripotent stem cells from cord blood and peripheral blood cells.</a> Stem Cells. 31 (3), 458-466 (2013).</li><li>Staerk, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reprogramming+of+human+peripheral+blood+cells+to+induced+pluripotent+stem+cells.">Reprogramming of human peripheral blood cells to induced pluripotent stem cells.</a> Cell Stem Cell. 7 (1), 20-24 (2010).</li><li>Qu, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chondrogenic+differentiation+of+human+pluripotent+stem+cells+in+chondrocyte+co-culture.">Chondrogenic differentiation of human pluripotent stem cells in chondrocyte co-culture.</a> Int J Biochem Cell Biol. 45 (8), 1802-1812 (2013).</li><li>Guzzo, R. M., Gibson, J., Xu, R. H., Lee, F. Y., Drissi, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+differentiation+of+human+iPSC-derived+mesenchymal+stem+cells+to+chondroprogenitor+cells.">Efficient differentiation of human iPSC-derived mesenchymal stem cells to chondroprogenitor cells.</a> J Cell Biochem. 114 (2), 480-490 (2013).</li><li>Koyama, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+induced+pluripotent+stem+cells+differentiated+into+chondrogenic+lineage+via+generation+of+mesenchymal+progenitor+cells.">Human induced pluripotent stem cells differentiated into chondrogenic lineage via generation of mesenchymal progenitor cells.</a> Stem Cells Dev. 22 (1), 102-113 (2013).</li><li>Liu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+insulin-transferrin-selenium+in+auricular+chondrocyte+proliferation+and+engineered+cartilage+formation+in+vitro.">Role of insulin-transferrin-selenium in auricular chondrocyte proliferation and engineered cartilage formation in vitro.</a> Int J Mol Sci. 15 (1), 1525-1537 (2014).</li><li>Guzzo, R. M., Scanlon, V., Sanjay, A., Xu, R. H., Drissi, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishment+of+human+cell+type-specific+iPS+cells+with+enhanced+chondrogenic+potential.">Establishment of human cell type-specific iPS cells with enhanced chondrogenic potential.</a> Stem Cell Rev. 10 (6), 820-829 (2014).</li><li>Goepfert, C., Slobodianski, A., Schilling, A. F., Adamietz, P., Portner, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cartilage+engineering+from+mesenchymal+stem+cells.">Cartilage engineering from mesenchymal stem cells.</a> Adv Biochem Eng Biotechnol. 123, 163-200 (2010).</li><li>Ingber, D. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tissue+engineering+and+developmental+biology:+going+biomimetic.">Tissue engineering and developmental biology: going biomimetic.</a> Tissue Eng. 12 (12), 3265-3283 (2006).</li><li>Yoshida, Y., Yamanaka, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+stem+cell+advances:+induced+pluripotent+stem+cells+for+disease+modeling+and+stem+cell-based+regeneration.">Recent stem cell advances: induced pluripotent stem cells for disease modeling and stem cell-based regeneration.</a> Circulation. 122 (1), 80-87 (2010).</li></ol>

The authors have nothing to disclose.

Here, we provide a protocol to generate chondrocytes from PBCs via iPSCs. Because PBCs are more common and widely used in the clinical field, they are presented as a potential alternative for reprogramming. In this study, episomal vectors (EV) were utilized to reprogram PBCs into iPSCs, following the method established by Zhang et al.11. This integration-free approach does not involve integrating virus-associated genotoxicity, which is believed to have a broad effect in the clinical field...

An erratum was issued for: <a href="https://www.jove.com/video/55722/differentiating-chondrocytes-from-peripheral-blood-derived-human">Differentiating Chondrocytes from Peripheral Blood-derived Human Induced Pluripotent Stem Cells</a>.
The corresponding author was updated from:
Yueying Li 
yueyinglee2010@hotmail.com 
Key Laboratory of Genomic and Precision Medicine, Beijing Institute of Genomics, Chinese Academy of Sciences
The corresponding author is now listed as:
Tie Liu 
waterkins@163.com 
Department of Orthopedics, Beijing Chao-Yang Hospital, Capital Medical University

An erratum was issued for: <a href="https://www.jove.com/video/55722/differentiating-chondrocytes-from-peripheral-blood-derived-human">Differentiating Chondrocytes from Peripheral Blood-derived Human Induced Pluripotent Stem Cells</a>.

Erratum: Differentiating Chondrocytes from Peripheral Blood-derived Human Induced Pluripotent Stem Cells

Cartilage tissue has a very poor capacity for self-repair and regeneration. Various surgical interventions and biological treatments are used to restore cartilage and joint function, with unsatisfying results. The recent development of stem cell technology may change the entire cartilage repair field1. Various stem cells have been studied as seed cells, but human induced pluripotent stem cells (hiPSCs) appear to be the most promising choice, as they can provide many types of patient-specific cells without causing rejection reactions2. Furthermore, they can overcome the limited proliferative nature of adult cells and maintain their self-renewal and pluripotent abilities. Moreover, gene targeting can be used to change the genotype to obtain specific types of chondrocytes.
Fibroblasts have been widely used to generate iPSCs because their reprogramming potentials have also been well studied. However, there are still some limitations that must be overcome, such as the painful biopsy from patients and the need for the in vitro expansion of the fibroblasts, which may result in gene mutations3. Recently, PBCs were found to be advantageous for reprogramming4; moreover, they were commonly utilized and abundantly stored. It is possible that they may redirect study focus from the skin. However, to the best of our knowledge, there are few reports on PBC reprogramming followed by differentiation into chondrocytes.
In the current study, we utilize PBCs as an alternative source by reprogramming them into iPSCs and then differentiating the iPSCs into the chondrogenic lineage through a pellet culture system in order to mimic chondrocyte formation.

<table>
	<tbody>
		<tr>
			<td>Knockout DMEM</td>
			<td>Invitrogen</td>
			<td>10829018</td>
			<td>Basal medium used for hiPSC culture and EB formation medium</td>
		</tr>
		<tr>
			<td>Knockout Serum Replacement (KSR)</td>
			<td>Invitrogen</td>
			<td>10828028</td>
			<td>A more defined, FBS-free medium supplement used for hiPSC culture and EB formation medium</td>
		</tr>
		<tr>
			<td>Fetal bovine serum (FBS)</td>
			<td>Hyclone</td>
			<td>sh30070.03</td>
			<td>Used for hiPSC culture and EB formation medium,offers excellent value for cell culture</td>
		</tr>
		<tr>
			<td>Nonessential amino acids</td>
			<td>Chemicon</td>
			<td>TMS-001-C</td>
			<td>Used as a growth supplement in all the cell culture medium, to increase cell growth and viability</td>
		</tr>
		<tr>
			<td>L-glutamine</td>
			<td>Invitrogen</td>
			<td>35050061</td>
			<td>An amino acid required for cell culture</td>
		</tr>
		<tr>
			<td>Basic fibroblast growth factor (bFGF)</td>
			<td>Peprotech</td>
			<td>100-18B</td>
			<td>A cytokine used for sustaining the pluripotency and self-renewal of hiPSCs</td>
		</tr>
		<tr>
			<td>Dispase</td>
			<td>Invitrogen</td>
			<td>17105041</td>
			<td>Used for hiPSC dissociation for subculture</td>
		</tr>
		<tr>
			<td>DMEM</td>
			<td>Gibco</td>
			<td>C11960</td>
			<td>Basal medium used for MSC culture medium</td>
		</tr>
		<tr>
			<td>0.1% gelatin</td>
			<td>Millipore</td>
			<td>ES-006-B</td>
			<td>Used for cell attachment onto the dishes</td>
		</tr>
		<tr>
			<td>0.25% trypsin/EDTA</td>
			<td>Gibco</td>
			<td>25200072</td>
			<td>Used for cell dissociation</td>
		</tr>
		<tr>
			<td>DPBS</td>
			<td>Gibco</td>
			<td>14190250</td>
			<td>A balanced salt solution used for cell wash or reagent preparing</td>
		</tr>
		<tr>
			<td>&#946;-mercaptoethanol</td>
			<td>invitrogen</td>
			<td>21985023</td>
			<td>Used as a growth supplement in all the cell culture medium.</td>
		</tr>
		<tr>
			<td>ITS</td>
			<td>invitrogen</td>
			<td>41400045</td>
			<td>Insulin, Transferrin, Selenium Solution.Used for chondrogenic differentiation.</td>
		</tr>
		<tr>
			<td>Ascorbic acid</td>
			<td>Sigma</td>
			<td>4403</td>
			<td>Known as vitamin C. It helps in active growth and has antioxidant property.</td>
		</tr>
		<tr>
			<td>Sodium pyruvate</td>
			<td>Gibco</td>
			<td>11360070</td>
			<td>Added to cell culture medium as an energy source in addition to glucose.</td>
		</tr>
		<tr>
			<td>Transforming growth factor-beta 1</td>
			<td>Peprotech</td>
			<td>AF-100-21C</td>
			<td>A cytokine that regulate cell proliferation, growth and chondrogenic differentiation.</td>
		</tr>
		<tr>
			<td>Rabbit polyclonal antibodies against Collagen II</td>
			<td>Abcam</td>
			<td>ab34712</td>
			<td>This antibody reacts with Type II collagens,which is specific for cartilaginous tissues.</td>
		</tr>
		<tr>
			<td>Mouse monoclonal antibodies to Collagen X</td>
			<td>Abcam</td>
			<td>ab49945</td>
			<td>This antibody reacts with Type X collagen,which is a product of hyperthrophic chondrotocytes.</td>
		</tr>
		<tr>
			<td>Permount</td>
			<td>Fisher Scientific</td>
			<td>SP15-100</td>
			<td>For mounting and long-term storage of slides</td>
		</tr>
		<tr>
			<td>Toluidine blue</td>
			<td>Sigma</td>
			<td>89640</td>
			<td>Used for proteoglycans detection.</td>
		</tr>
		<tr>
			<td>Alcian blue</td>
			<td>Amresco</td>
			<td>#0298</td>
			<td>Used for glucosaminoglycans detection.</td>
		</tr>
		<tr>
			<td>Papain</td>
			<td>Sigma</td>
			<td>P4762-25MG</td>
			<td>Used to digest chondrogenic pellets.</td>
		</tr>
		<tr>
			<td>Dimethylmethylene blue</td>
			<td>Sigma</td>
			<td>341088-1G</td>
			<td>Used to quantitate glycosaminoglyans</td>
		</tr>
		<tr>
			<td>Chondroitin sulfate sodium salt from shark cartilage</td>
			<td>Sigma</td>
			<td>C4384-250MG</td>
			<td>Used to draw the standard curve for sGAG content measurement.</td>
		</tr>
		<tr>
			<td>Qubit dsDNA HS assay kit</td>
			<td>Invitrogen</td>
			<td>Q32851 (100)</td>
			<td>Used to determine DNA content</td>
		</tr>
		<tr>
			<td>TRIzol</td>
			<td>Invitrogen</td>
			<td>15596018</td>
			<td>Used for RNA isolation from cells</td>
		</tr>
		<tr>
			<td>Reverse Transcriptase System</td>
			<td>Promega</td>
			<td>A3500</td>
			<td>Used to convert RNA into cDNA</td>
		</tr>
		<tr>
			<td>SYBR FAST qPCR kit Master Mix</td>
			<td>Kapa</td>
			<td>KK4601</td>
			<td>Used for Real-time PCR</td>
		</tr>
	</tbody>
</table>

differentiating chondrocytes from peripheral blood-derived human induced pluripotent stem cells

In this study, we used peripheral blood cells (PBCs) as seed cells to produce chondrocytes via induced pluripotent stem cells (iPSCs) in an integration-free method. Following embryoid body (EB) formation and fibroblastic cell expansion, the iPSCs are induced for chondrogenic differentiation for 21 days under serum-free and xeno-free conditions. After chondrocyte induction, the phenotypes of the cells are evaluated by morphological, immunohistochemical, and biochemical analyses, as well as by the quantitative real-time PCR examination of chondrogenic differentiation markers. The chondrogenic pellets show positive alcian blue and toluidine blue staining. The immunohistochemistry of collagen II and X staining is also positive. The sulfated glycosaminoglycan (sGAG) content and the chondrogenic differentiation markers COLLAGEN 2 (COL2), COLLAGEN 10 (COL10), SOX9, and AGGRECAN are significantly upregulated in chondrogenic pellets compared to hiPSCs and fibroblastic cells. These results suggest that PBCs can be used as seed cells to generate iPSCs for cartilage repair, which is patient-specific and cost-effective.

Chondrogenic Differentiation of hiPSCs:
EB formation medium and basal culture medium were used to differentiate the hiPSCs into the mesenchymal lineage. A multi-step culture method was used (Figure 1). First, the hiPSCs were spontaneously differentiated via EB formation for 10 days (D10; Figure 2A). Second, cells outgrew from the EBs for another 10 days (D10+10). During th...

Watch this Scientific Journal Video about Differentiating Chondrocytes from Peripheral Blood-derived Human Induced Pluripotent Stem Cells at JoVE.com

Differentiating Chondrocytes from Peripheral Blood-derived Human Induced Pluripotent Stem Cells

We present a protocol to generate a chondrogenic lineage from human peripheral blood (PB) via induced pluripotent stem cells (iPSCs) using an integration-free method, which includes embryoid body (EB) formation, fibroblastic cells expansion, and chondrogenic induction.

In this study, we used peripheral blood cells (PBCs) as seed cells to produce chondrocytes via induced pluripotent stem cells (iPSCs) in an ...

differentiating-chondrocytes-from-peripheral-blood-derived-human

Research

JoVE Journal

Developmental Biology

9.1K Views.  Capital Medical University. We present a protocol to generate a chondrogenic lineage from human peripheral blood (PB) via induced pluripotent stem cells (iPSCs) using an integration-free method, which includes embryoid body (EB) formation, fibroblastic cells expansion, and chondrogenic induction.

Video: Differentiating Chondrocytes from Peripheral Blood-derived Human Induced Pluripotent Stem Cells

Three-dimensional Quantification of Dendritic Spines from Pyramidal Neurons Derived from Human Induced Pluripotent Stem Cells

Dendritic spines are small protrusions that correspond to the post-synaptic compartments of excitatory synapses in the central nervous system. They are distributed along the dendrites. Their morphology is largely dependent on neuronal activity, and they are dynamic. Dendritic spines express glutamatergic receptors (AMPA and NMDA receptors) on their surface and at the levels of postsynaptic densities. Each spine allows the neuron to control its state and local activity independently. Spine morphologies have been extensively studied in glutamatergic pyramidal cells of the brain cortex, using both in vivo approaches and neuronal cultures obtained from rodent tissues. Neuropathological conditions can be associated to altered spine induction and maturation, as shown in rodent cultured neurons and one-dimensional quantitative analysis 1. The present study describes a protocol for the 3D quantitative analysis of spine morphologies using human cortical neurons derived from neural stem cells (late cortical progenitors). These cells were initially obtained from induced&#160;pluripotent stem cells. This protocol allows the analysis of spine morphologies at different culture periods, and with possible comparison between induced&#160;pluripotent stem cells obtained from control individuals with those obtained from patients with psychiatric diseases.

Dendritic spines of pyramidal neurons are the sites of most excitatory synapses in mammalian brain cortex. This method describes a 3D quantitative analysis of spine morphologies in human cortical pyramidal glutamatergic neurons derived from induced&#160;pluripotent stem cells.

Dendritic spines are small protrusions that correspond to the post-synaptic compartments of excitatory synapses in the central nervous system. They are ...

Generation of Induced Pluripotent Stem Cells from Human Peripheral T Cells Using Sendai Virus in Feeder-free Conditions

Recently, iPSCs have attracted attention as a new source of cells for regenerative therapies. Although the initial method for generating iPSCs relied on dermal fibroblasts obtained by invasive biopsy and retroviral genomic insertion of transgenes, there have been many efforts to avoid these disadvantages. Human peripheral T cells are a unique cell source for generating iPSCs. iPSCs derived from T cells contain rearrangements of the T cell receptor (TCR) genes and are a source of antigen-specific T cells. Additionally, T cell receptor rearrangement in the genome has the potential to label individual cell lines and distinguish between transplanted and donor cells. For safe clinical application of iPSCs, it is important to minimize the risk of exposing newly generated iPSCs to harmful agents. Although fetal bovine serum and feeder cells have been essential for pluripotent stem cell culture, it is preferable to remove them from the culture system to reduce the risk of unpredictable pathogenicity. To address this, we have established a protocol for generating iPSCs from human peripheral T cells using Sendai virus to reduce the risk of exposing iPSCs to undefined pathogens. Although handling Sendai virus requires equipment with the appropriate biosafety level, Sendai virus infects activated T cells without genome insertion, yet with high efficiency. In this protocol, we demonstrate the generation of iPSCs from human peripheral T cells in feeder-free conditions using a combination of activated T cell culture and Sendai virus.

This protocol describes how to generate induced pluripotent stem cells (iPSCs) from human peripheral T cells in feeder-free conditions using a combination of matrigel and Sendai virus vectors containing reprogramming factors.

Recently, iPSCs have attracted attention as a new source of cells for regenerative therapies. Although the initial method for generating iPSCs relied on ...

Feeder-free Derivation of Melanocytes from Human Pluripotent Stem Cells

Human pluripotent stem cells (hPSCs) represent a platform to study human development in vitro under both normal and disease conditions. Researchers can direct the differentiation of hPSCs into the cell type of interest by manipulating the culture conditions to recapitulate signals seen during development. One such cell type is the melanocyte, a pigment-producing cell of neural crest (NC) origin responsible for protecting the skin against UV irradiation. This protocol presents an extension of a currently available in vitro Neural Crest differentiation protocol from hPSCs to further differentiate NC into fully pigmented melanocytes. Melanocyte precursors can be enriched from the Neural Crest protocol via a timed exposure to activators of WNT, BMP, and EDN3 signaling under dual-SMAD-inhibition conditions. The resultant melanocyte precursors are then purified and matured into fully pigmented melanocytes by culture in a selective medium. The resultant melanocytes are fully pigmented and stain appropriately for proteins characteristic of mature melanocytes.

This work describes an in vitro differentiation protocol to produce pigmented, mature melanocytes from human pluripotent stem cells via a neural crest and melanoblast intermediate stage using a feeder-free, 25 day protocol.

Human pluripotent stem cells (hPSCs) represent a platform to study human development in vitro under both normal and disease conditions. Researchers can ...

Generation of Induced Pluripotent Stem Cells from Human Melanoma Tumor-infiltrating Lymphocytes

Adoptive transfer of ex vivo expanded autologous tumor-infiltrating lymphocytes (TILs) can mediate durable and complete responses in significant subsets of patients with metastatic melanoma. Major obstacles of this approach are the reduced viability of transferred T cells, caused by telomere shortening, and the limited number of TILs obtained from patients. Less-differentiated T cells with long telomeres would be an ideal T cell subset for adoptive T cell therapy;however, generating large numbers of these less-differentiated T cells is problematic. This limitation of adoptive T cell therapy can be theoretically overcome by using induced pluripotent stem cells (iPSCs) that self-renew, maintain pluripotency, have elongated telomeres, and provide an unlimited source of autologous T cells for immunotherapy. Here, we present a protocol to generate iPSCs using Sendai virus vectors for the transduction of reprogramming factors into TILs. This protocol generates fully reprogrammed, vector-free clones. These TIL-derived iPSCs might be able to generate less-differentiated patient- and tumor-specific T cells for adoptive T cell therapy.

The goal of this protocol is to show the protocol for reprogramming melanoma tumor-infiltrating lymphocytes into induced pluripotent stem cells.

Adoptive transfer of ex vivo expanded autologous tumor-infiltrating lymphocytes (TILs) can mediate durable and complete responses in significant subsets ...

Generation of Integration-free Induced Pluripotent Stem Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors

Induced Pluripotent Stem Cells (iPSCs) hold great promise for disease modeling and regenerative therapies. We previously reported the use of Episomal Vectors (EV) to generate integration-free iPSCs from peripheral blood mononuclear cells (PB MNCs). The episomal vectors used are DNA plasmids incorporated with oriP and EBNA1 elements from the Epstein-Barr (EB) virus, which&#160;allow for replication and long-term retainment of plasmids in mammalian cells, respectively. With further optimization, thousands of iPSC colonies can be obtained from 1 mL of peripheral blood. Two critical factors for achieving high reprogramming efficiencies&#160;are: 1) the use of a 2A &#34;self-cleavage&#34; peptide to link OCT4 and SOX2, thus achieving equimolar expression of the two factors; 2) the use of two vectors to express MYC and KLF4 individually. Here we describe a step-by-step protocol for generating integration-free iPSCs from adult peripheral blood samples. The generated iPSCs are integration-free as residual episomal plasmids are undetectable after five passages. Although the reprogramming efficiency is comparable to that of Sendai Virus (SV) vectors, EV plasmids are considerably more economical than the commercially available SV vectors. This affordable EV reprogramming system holds potential for clinical applications in regenerative medicine and provides an approach for the direct reprogramming of PB MNCs to integration-free mesenchymal stem cells, neural stem cells, etc.

This protocol describes a detailed method for efficient generation of integration-free iPSCs from human adult peripheral blood cells. With the use of four oriP/EBNA-based episomal vectors to express the reprogramming factors, KLF4, MYC, BCL-XL, or OCT4 and SOX2, thousands of iPSC colonies can be obtained from 1 mL of peripheral blood.

Induced Pluripotent Stem Cells (iPSCs) hold great promise for disease modeling and regenerative therapies. We previously reported the use of Episomal ...

Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells

Human articular cartilage lacks the ability to repair itself. Cartilage degeneration is thus treated not by curative but by conservative treatments. Currently, efforts are being made to regenerate damaged cartilage with ex vivo expanded chondrocytes or bone marrow-derived mesenchymal stem cells (BMSCs). However, the restricted viability and instability of these cells limit their application in cartilage reconstruction. Human induced pluripotent stem cells (hiPSCs) have received scientific attention as a new alternative for regenerative applications. With unlimited self-renewal ability and multipotency, hiPSCs have been highlighted as a new replacement cell source for cartilage repair. However, obtaining a high quantity of high-quality chondrogenic pellets is a major challenge to their clinical application. In this study, we used embryoid body (EB)-derived outgrowth cells for chondrogenic differentiation. Successful chondrogenesis was confirmed by PCR and staining with alcian blue, toluidine blue, and antibodies against collagen types I and II (COL1A1 and COL2A1, respectively). We provide a detailed method for the differentiation of cord blood mononuclear cell-derived iPSCs (CBMC-hiPSCs) into chondrogenic pellets.

Here, we propose a protocol for chondrogenic differentiation from cord blood mononuclear cell-derived human induced pluripotent stem cells.

Human articular cartilage lacks the ability to repair itself. Cartilage degeneration is thus treated not by curative but by conservative treatments. ...

Rapid, Directed Differentiation of Retinal Pigment Epithelial Cells from Human Embryonic or Induced Pluripotent Stem Cells

We describe a robust method to direct the differentiation of pluripotent stem cells into retinal pigment epithelial cells (RPE). The purpose of providing a detailed and thorough protocol is to clearly demonstrate each step and to make this readily available to researchers in the field. This protocol results in a homogenous layer of RPE with minimal or no manual dissection needed. The method presented here has been shown to be effective for induced pluripotent stem cells (iPSC) and human embryonic stem cells. Additionally, we describe methods for cryopreservation of intermediate cell banks that allow long-term storage. RPE generated using this protocol might be useful for iPSC disease-in-a-dish modeling or clinical application.

This protocol describes how to produce retinal pigment epithelial cells (RPE) from pluripotent stem cells. The method uses a combination of growth factors and small molecules to direct the differentiation of stem cells into immature RPE in fourteen days and mature, functional RPE after three months.

We describe a robust method to direct the differentiation of pluripotent stem cells into retinal pigment epithelial cells (RPE). The purpose of providing ...

Generation of 3D Skin Organoid from Cord Blood-derived Induced Pluripotent Stem Cells

The skin is the body&#8217;s largest organ and has many functions. The skin acts as a physical barrier and protector of the body and regulates bodily functions. Biomimetics is the imitation of the models, systems, and elements of nature for the purpose of solving complex human problems1. Skin biomimetics is a useful tool for in vitro disease research and in vivo regenerative medicine. Human induced pluripotent stem cells (iPSCs) have the characteristic of unlimited proliferation and the ability of differentiation to three germ layers. Human iPSCs are generated from various primary cells, such as blood cells, keratinocytes, fibroblasts, and more. Among them, cord blood mononuclear cells (CBMCs) have emerged as an alternative cell source from the perspective of allogeneic regenerative medicine. CBMCs are useful in regenerative medicine because human leukocyte antigen (HLA) typing is essential to the cell banking system. We provide a method for the differentiation of CBMC-iPSCs into keratinocytes and fibroblasts and for generation of a 3D skin organoid. CBMC-iPSC-derived keratinocytes and fibroblasts have characteristics similar to a primary cell line. The 3D skin organoids are generated by overlaying an epidermal layer onto a dermal layer. By transplanting this 3D skin organoid, a humanized mice model is generated. This study shows that a 3D human iPSC-derived skin organoid may be a novel, alternative tool for dermatologic research in vitro and in vivo.

We propose a protocol that shows how to differentiate induced pluripotent stem cell-derived keratinocytes and fibroblasts and generate a 3D skin organoid, using these keratinocytes and fibroblasts. This protocol contains an additional step of generating a humanized mice model. The technique presented here will improve dermatologic research.

The skin is the body&#8217;s largest organ and has many functions. The skin acts as a physical barrier and protector of the body and regulates bodily ...

In Vitro Generation of Somite Derivatives from Human Induced Pluripotent Stem Cells

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give rise to multiple cell types, including the myotome (MYO), sclerotome (SCL), dermatome (D), and syndetome (SYN), which in turn develop into skeletal muscle, axial skeleton, dorsal dermis, and axial tendon/ligament, respectively. Therefore, the generation of SMs and their derivatives from human induced pluripotent stem cells (iPSCs) is critical to obtain pluripotent stem cells (PSCs) for application in regenerative medicine and for disease research in the field of orthopedic surgery. Although the induction protocols for MYO and SCL from PSCs have been previously reported by several researchers, no study has yet demonstrated the induction of SYN and D from iPSCs. Therefore, efficient induction of fully competent SMs remains a major challenge. Here, we recapitulate human SM patterning with human iPSCs in vitro by mimicking the signaling environment during chick/mouse SM development, and report on methods of systematic induction of SM derivatives (MYO, SCL, D, and SYN) from human iPSCs under chemically defined conditions through the presomitic mesoderm (PSM) and SM states. Knowledge regarding chick/mouse&#160;SM development was successfully applied to the induction of SMs with human iPSCs. This method could be a novel tool for studying human somitogenesis and patterning without the use of embryos and for cell-based therapy and disease modeling.

We present here a protocol for the differentiation of human induced pluripotent stem cells into each somite derivative (myotome, sclerotome, dermatome, and syndetome) in chemically defined conditions, which has applications in future disease modeling and cell-based therapies in orthopedic surgery.

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give ...

In vitro Neuromuscular Junction Induced from Human Induced Pluripotent Stem Cells

The neuromuscular junction (NMJ) is a specialized synapse that transmits action potentials from the motor neuron to skeletal muscle for mechanical movement. The architecture of the NMJ structure influences the functions of the neuron, the muscle and the mutual interaction. Previous studies have reported many strategies by co-culturing the motor neurons and myotubes to generate NMJ in vitro with complex induction process and long culture period but have struggled to recapitulate mature NMJ morphology and function. Our in vitro NMJ induction system is constructed by differentiating human iPSC in a single culture dish. By switching the myogenic and neurogenic induction medium for induction, the resulting NMJ contained pre- and post- synaptic components, including motor neurons, skeletal muscle and Schwann cells in the one month culture. The functional assay of NMJ also showed that the myotubes contraction can be triggered by Ca++ then inhibited by curare, an acetylcholine receptor (AChR) inhibitor, in which the stimulating signal is transmitted through NMJ. This simple and robust approach successfully derived the complex structure of NMJ with functional connectivity. This in vitro human NMJ, with its integrated structures and function, has promising potential for studying pathological mechanisms and compound screening.

Here we provide a protocol to generate in vitro NMJs from human induced pluripotent stem cells (iPSCs). This method can induce NMJs with mature morphology and function in 1 month in a single well. The resulting NMJs could potentially be used to model related diseases, to study pathological mechanisms or to screen drug compounds for therapy.