Name: differentiating chondrocytes from peripheral blood-derived human induced pluripotent stem cells
Uploaded: 2017-07-18T14:00:00.000+00:00
Duration: 7 min 51 s
Description: Watch this Scientific Journal Video about Differentiating Chondrocytes from Peripheral Blood-derived Human Induced Pluripotent Stem Cells at JoVE.com

The authors wish to thank Xiaobin Zhang for his plasmid. We also thank Shaorong Gao and Qianfei Wang for their kind help during the experiment. This study is supported by the National Natural Science Foundation of China (No.81101346, 81271963, 81100331), the Beijing 215 high-level talent project (No.2014-3-025), and the Beijing Chao-Yang Hospital Fund (No. CYXX-2017-01), and the Youth Innovation Promotion Association of Chinese Academy of Sciences (Y.L.).

The protocol for the generation of hiPSCs from PBCs can be found in our previous study5. The study was approved by the Institutional Review Board of our institution.
1. Embryoid Body (EB) Formation
<ol>
	<li>Make 50 mL of hiPSC medium: Knockout Dulbecco&#39;s Modified Eagle Medium (DMEM) supplemented with 15% knockout serum replacement (KSR), 5% fetal bovine serum (FBS), 1&#215; nonessential amino acids, 55 &#956;M 2-mercaptoethanol, 2 mM L-glutamine, and 8 ng/mL basic fibroblast growth factor (bFGF).</li>
	<li>Make 50 mLof EB formation medium: DMEM supplemented with 15% KSR, 5% FBS, 1x nonessential amino acids, 55 &#956;M 2-mercaptoethanol, and 2 mM L-glutamine.</li>
	<li>Make 50 mL of basal culture medium: DMEM supplemented with 20% FBS, 1&#215; nonessential amino acids, 55 &#956;M 2-mercaptoethanol, and 2 mM L-glutamine.</li>
	<li>Prepare 10 mL of dispase solution, 1 mg/mL in knockout DMEM.</li>
	<li>Culture hiPSCs onto 60-mm tissue culture dishes with feeder cells (i.e., a monolayer of irradiated mouse embryonic fibroblast cells). When the cells are 80-90% confluent, disassociate the cells with dispase and passage the hiPSCs 1:3 every 4-5 days. Place the cells into a 37 &#176;C and 5% CO2 incubator.</li>
	<li>Dissect the undifferentiated hiPSC colonies into smaller pieces (about 50-100 &#181;m in diameter) using a fire-drawn glass needle when the iPSCs are 80-90% confluent. Generally, use hiPSC colonies in a 60-mm dish to generate EBs in a 100 mm Petri dish.
	<ol>
		<li>Culture less than 100 small pieces of colonies in a 100 mm, non-adherent Petri dish containing 10 mL of EB formation medium. Place the dishes into a 37 &#176;C and 5% CO2 incubator.</li>
	</ol>
	</li>
	<li>Replace approximately 25% of the initial medium with an equal amount of the basal culture medium every 2 days. Tilt the dish to let the EBs settle. Carefully remove 3 mL of upper medium and add 4 mL of fresh basal culture medium. Do not disturb the EBs. 
	NOTE: The EBs are morphologically characterized by the pieces of colonies, taking on a round appearance with smooth borders under the microscope.</li>
	<li>After 10 days of culture in the non-adherent Petri dish, coat a new 100-mm tissue culture dish with 4 mL of 0.1% gelatin for 30 min at 37 &#176;C before use.</li>
	<li>Transfer the medium plus EBs from a 100 mm, non-adherent Petri dish to a 15-mL conical tube. Let the EBs sediment for 4-5 min. Aspirate the supernatant carefully and leave less than 0.5 mL of medium plus EBs</li>
	<li>Seed less than 100 EBs onto a 100 mm, gelatin-coated tissue culture dish with 10 mL of basal culture medium. Place the dishes into a 37 &#176;C and 5% CO2 incubator.</li>
</ol>
2. Cell Pellet Formation and Chondrocyte Differentiation
<ol>
	<li>Make 10 mL of 0.25% trypsin/ethylenediaminetetraacetic acid (EDTA). Make 80 mL of basal culture medium: DMEM supplemented with 20% FBS, 1x nonessential amino acids, 55 &#956;M 2-mercaptoethanol, and 2 mM L-glutamine.</li>
	<li>Make 10 mL of chondrogenic differentiation medium: DMEM (high glucose) supplemented with 10% insulin-transferrin-selenium solution (ITS), 0.1 &#181;M dexamethasone, 1 mM ascorbic acid, 1% sodium pyruvate, and 10 ng/mL transforming growth factor-beta 1(TGF-&#946;1).</li>
	<li>Refresh the medium with 10 mL of basal culture medium after 48 h. Thereafter, refresh the medium every three days with 10 mL of basal culture medium. 
	NOTE: After 10 days in culture, fibroblastic cell outgrowths should have expanded from the EBs.
	<ol>
		<li>Coat the 100 mm dishes with 4 mL of 0.1% gelatin for 30 min at 37 &#176;C before use. Discard the cell supernatant and wash the cells with Dulbecco&#39;s Phosphate-Buffered Saline (DPBS) once.</li>
		<li>Digest the cells with 3 mL of 0.25% trypsin/EDTA at 37 &#176;C for 5 min and neutralize with 4 mL of basal culture medium.</li>
	</ol>
	</li>
	<li>Dissociate the cells into single cells by pipetting up and down 5-10 times and passing them through a 70 &#181;m nylon mesh. Centrifuge the cell suspension at 200 x g for 5 min. Re-seed the cells on a new 100 mm, gelatin-coated tissue culture dish with 10 mL of basal culture medium.</li>
	<li>Refresh the medium with 10 mL of basal culture medium after 48 h. Thereafter, refresh the medium every three days with 10 mL of basal culture medium. 
	NOTE: The cells acquire a homogenous, fibroblast-like morphology.</li>
	<li>When ~90-100% confluence is reached (i.e., about 5-7 days), harvest the cells with 3 mL of 0.25% trypsin/EDTA at 37 &#176;C for 5 min. Neutralize with 4 mL of basal culture medium. Dissociate the cells into single cells by pipetting up and down 5 times. Use a hemocytometer to count the cell number.
	<ol>
		<li>Place 3 x 105 cells in a 15 mL polypropylene tube. Centrifuge at 200 x g for 5 min at room temperature (RT). Re-suspend the cells in 1 mL of chondrogenic differentiation medium.</li>
	</ol>
	</li>
	<li>Re-centrifuge the cells at 300 x g for 3 min and maintain the cells in small pellet form. Put the tube into the 37 &#176;C and 5% CO2&#160;incubator for 21 days. Do not screw the lid on tightly and let the gas exchange.</li>
	<li>Replace 3/4 of the culture medium every three days with fresh chondrogenic differentiation medium. 
	NOTE: After 21 days in culture, hiPSC-chondrogenic pellets (hiPSC-Chon) should have formed. Human mesenchymal stem cells (MSCs), as a positive control, are also collected and cultured in the chondrogenic differentiation medium for 21 days to form chondrogenic pellets (hMSC-Chon).</li>
</ol>
3. Analysis of Chondrogenic Differentiation
<ol>
	<li>Prepare 10 mL of 10% neutral-buffered formalin.</li>
	<li>Prepare 50 mL of 0.1% alcian blue reagent and 50 mL of 1% toluidine blue reagent.</li>
	<li>Prepare 1 mL of the primary antibodies: rabbit polyclonal antibodies against collagen II (1:50) or mouse monoclonal antibodies against collagen X (1:50). Also, prepare anti-rabbit or mouse secondary antibodies.</li>
	<li>Make 1 mL of papain solution: 10 U/mL in PBS with 0.1 M sodium acetate, 2.4 mM EDTA, and 5 mM L-cysteine.</li>
	<li>Make 100 mL dimethylmethylene blue (DMMB) dye solution: 100 &#181;L of 16 mg/L 1,9-dimethylmethylene blue, 40 mM glycine, 40 mM NaCl, and 9.5 mM HCl; pH 3.0.</li>
	<li>Assess chondrogenic differentiation by alcian blue and toluidine blue stains of the pellet sections.
	<ol>
		<li>Fix one hiPSC-Chon pellet or hMSC-Chon pellet in 1 mL of 10% neutral-buffered formalin for 24 h.</li>
		<li>Transfer the pellet to 1 mL of 70% ethanol in H2O. Dehydrate the pellet with 1 mL of a graded ethanol series (i.e., 25, 50, 75, 90, 95, 100, and 100%, 3 min each).</li>
		<li>Clarify the pellet in 1 mL of 100% xylene three times. Infiltrate the pellet with paraffin for 1 h in a 65 &#176;C oven. Embed the pellet into paraffin blocks with a 7 x 7 x 5 mm3 base mold, following routine histological procedures6.</li>
		<li>Make adjacent sections by microtome with a thickness of approximately 4 &#181;m7. Adhere the sections onto glass slides.</li>
		<li>Dry the slides for 2 h at 60 &#176;C in an oven. Deparaffinize the sections in three cycles (3 min each) using 100% xylene.</li>
		<li>Use a decreasing alcohol series for rehydration (i.e., 100, 100, 95, 95, 70, 50, and 25% in H2O, 3 min each) and then perform a final rinse with deionized water for 5 min.</li>
		<li>Stain the sections with 0.1% alcian blue reagent or 1% toluidine blue staining for 4-5 h and then rinse them with distilled water.</li>
		<li>Dehydrate with a graded ethanol series (i.e., 25, 50, 75, 90, 95, 100, and 100%, 3 min each) followed by three consecutive steps of clarification in 100% xylene. Mount the slides and visualize them under a microscope.</li>
	</ol>
	</li>
	<li>Perform immunohistochemistry. 
	NOTE: Additional pellet sections are further assessed by immunohistochemistry.
	<ol>
		<li>After deparaffinization and rehydration, bring the slides to a boil in 1 mM EDTA, pH 8.0 (waterproof in water boiled by autoclave). Let them sit for 8 min at a sub-boiling temperature and then allow the slides to cool at RT.</li>
		<li>Rinse the slides with deionized water 3 times. Incubate the sections in 3% H2O2 solution in methanol at RT for 15 min to block endogenous peroxidase activity.</li>
		<li>Rinse the slides with deionized water and immerse them in DPBS for 5 min. Apply 50-100 &#181;L of appropriately diluted (1:50) primary antibody to the sections on the slides and then incubate them in a humidified chamber at RT for 1 h.</li>
		<li>Wash the slides 3 times (5 min each) with DPBS. Incubate the samples with the corresponding secondary antibodies (i.e., anti-rabbit or mouse) for 15 min at RT.</li>
		<li>Wash the slides 3 times (for 5 min each) with DPBS. Perform DAB detection under a microscope.</li>
		<li>Wash the slides with DPBS 3 times (2 min each). Counterstain the cell nuclei by immersing the slides in hematoxylin for 1-2 min. Dehydrate with a graded ethanol series (25, 50, 75, 90, 95, 100, and 100%; 3 min each) followed by three consecutive steps of clarification with xylene. Finally, mount the slides and visualize them under the microscope.</li>
	</ol>
	</li>
	<li>Detect sGAG content.
	<ol>
		<li>Digest chondrogenic pellets in papain solution at 60 &#176;C for 2 h.</li>
		<li>Determine the DNA content using the dsDNA assay kit and fluorometer system. Measure the sGAG content by mixing it with DMMB dye solution under measuring absorbance at 525 nm8.</li>
		<li>Calculate the concentration of sGAG against a standard curve of shark chondroitin sulfate.</li>
	</ol>
	</li>
	<li>Perform the real-time PCR analysis of the chondrogenic differentiation markers in hiPSC-Chon pellets.
	<ol>
		<li>Harvest 3-4 of the same chondrogenic pellets by adding 500 &#181;L of ice-cold extraction reagent to one tube. Vortex thoroughly. Incubate the sample for 5 min at RT.</li>
		<li>Add 0.1 mL of chloroform. Vortex the sample for 15 s and incubate it at RT for 3 min. Centrifuge the sample for 15 min at 12,000 x g and 4 &#176;C. Transfer the upper aqueous phase (about 250 &#181;L) into a new 1.5 mL microcentrifuge tube.</li>
		<li>Add 25 &#181;L of sodium acetate and 1 &#181;L of glycogen to the sample. Precipitate the RNA by mixing it with 250 &#181;L of isopropyl alcohol. Mix thoroughly. Incubate the sample at RT for 10 min.</li>
		<li>Centrifuge for 10 min at 12,000 x g and 4 &#176;C. Remove the supernatant completely. Wash the RNA pellet twice with 500 &#181;L of 75% ethanol.</li>
		<li>Centrifuge for 5 min at 7,500 x g and 4 &#176;C. Remove all leftover ethanol and air-dry the RNA pellet for 5-10 min. Dissolve the RNA in 10 &#181;L of nuclease-free water.</li>
		<li>Convert the RNA into cDNA using a reverse transcriptase system. Subject the cDNA samples to real-time PCR using qPCR kit master mix (2x) and a real-time PCR system9. 
		NOTE: The primer sequences are: 
		hAGGRECAN-F:TCGAGGACAGCGAGGCC; 
		hAGGRECAN-R: TCGAGGGTGTAGCGTGTAGAGA; 
		h&#946;-ACTIN-F: TTTGAATGATGAGCCTTCGTCCCC; 
		h&#946;-ACTIN-R: GGTCTCAAGTCAGTGTACAGGTAAGC; 
		hCOL2-F:TGGACGATCAGGCGAAACC; 
		hCOL2-R:GCTGCGGATGCTCTCAATCT; 
		hSOX9-F:AGCGAACGCACATCAAGAC; 
		hSOX9-R:CTGTAGGCGATCTGTTGGGG; 
		hCOL10-F: ATGCTGCCACAAATACCCTTT; 
		hCOL10-R: GGTAGTGGGCCTTTTATGCCT.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Diekman, B. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cartilage+tissue+engineering+using+differentiated+and+purified+induced+pluripotent+stem+cells.">Cartilage tissue engineering using differentiated and purified induced pluripotent stem cells.</a> Proc Natl Acad Sci USA. 109 (47), 19172-19177 (2012).</li><li>Park, I. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disease-specific+induced+pluripotent+stem+cells.">Disease-specific induced pluripotent stem cells.</a> Cell. 134 (5), 877-886 (2008).</li><li>Loh, Y. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+induced+pluripotent+stem+cells+from+human+blood.">Generation of induced pluripotent stem cells from human blood.</a> Blood. 113 (22), 5476-5479 (2009).</li><li>Zhang, X. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+reprogramming+of+human+peripheral+blood+cells.">Cellular reprogramming of human peripheral blood cells.</a> Genomics Proteomics Bioinformatics. 11 (5), 264-274 (2013).</li><li>Li, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reprogramming+of+blood+cells+into+induced+pluripotent+stem+cells+as+a+new+cell+source+for+cartilage+repair.">Reprogramming of blood cells into induced pluripotent stem cells as a new cell source for cartilage repair.</a> Stem Cell Res Ther. 7 (31), (2016).</li><li>Canene-Adams, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+formalin-fixed+paraffin-embedded+tissue+for+immunohistochemistry.">Preparation of formalin-fixed paraffin-embedded tissue for immunohistochemistry.</a> Methods Enzymol. 533, 225-233 (2013).</li><li>Solchaga, L. A., Penick, K. J., Welter, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chondrogenic+differentiation+of+bone+marrow-derived+mesenchymal+stem+cells:+tips+and+tricks.">Chondrogenic differentiation of bone marrow-derived mesenchymal stem cells: tips and tricks.</a> Methods Mol Biol. 698, 253-278 (2011).</li><li>Oldershaw, R. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+differentiation+of+human+embryonic+stem+cells+toward+chondrocytes.">Directed differentiation of human embryonic stem cells toward chondrocytes.</a> Nat Biotechnol. 28 (11), 1187-1194 (2010).</li><li>Monje, L., Varayoud, J., Luque, E. H., Ramos, J. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neonatal+exposure+to+bisphenol+A+modifies+the+abundance+of+estrogen+receptor+alpha+transcripts+with+alternative+5'-untranslated+regions+in+the+female+rat+preoptic+area.">Neonatal exposure to bisphenol A modifies the abundance of estrogen receptor alpha transcripts with alternative 5'-untranslated regions in the female rat preoptic area.</a> J Endocrinol. 194 (1), 201-212 (2007).</li><li>Teramura, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+mesenchymal+progenitor+cells+with+chondrogenic+property+from+mouse-induced+pluripotent+stem+cells.">Induction of mesenchymal progenitor cells with chondrogenic property from mouse-induced pluripotent stem cells.</a> Cell Reprogram. 12 (3), 249-261 (2010).</li><li>Su, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+generation+of+integration-free+ips+cells+from+human+adult+peripheral+blood+using+BCL-XL+together+with+Yamanaka+factors.">Efficient generation of integration-free ips cells from human adult peripheral blood using BCL-XL together with Yamanaka factors.</a> PLoS One. 8 (5), e64496 (2013).</li><li>Carey, B. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reprogramming+factor+stoichiometry+influences+the+epigenetic+state+and+biological+properties+of+induced+pluripotent+stem+cells.">Reprogramming factor stoichiometry influences the epigenetic state and biological properties of induced pluripotent stem cells.</a> Cell Stem Cell. 9 (6), 588-598 (2011).</li><li>Okita, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+nonviral+method+to+generate+integration-free+human-induced+pluripotent+stem+cells+from+cord+blood+and+peripheral+blood+cells.">An efficient nonviral method to generate integration-free human-induced pluripotent stem cells from cord blood and peripheral blood cells.</a> Stem Cells. 31 (3), 458-466 (2013).</li><li>Staerk, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reprogramming+of+human+peripheral+blood+cells+to+induced+pluripotent+stem+cells.">Reprogramming of human peripheral blood cells to induced pluripotent stem cells.</a> Cell Stem Cell. 7 (1), 20-24 (2010).</li><li>Qu, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chondrogenic+differentiation+of+human+pluripotent+stem+cells+in+chondrocyte+co-culture.">Chondrogenic differentiation of human pluripotent stem cells in chondrocyte co-culture.</a> Int J Biochem Cell Biol. 45 (8), 1802-1812 (2013).</li><li>Guzzo, R. M., Gibson, J., Xu, R. H., Lee, F. Y., Drissi, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+differentiation+of+human+iPSC-derived+mesenchymal+stem+cells+to+chondroprogenitor+cells.">Efficient differentiation of human iPSC-derived mesenchymal stem cells to chondroprogenitor cells.</a> J Cell Biochem. 114 (2), 480-490 (2013).</li><li>Koyama, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+induced+pluripotent+stem+cells+differentiated+into+chondrogenic+lineage+via+generation+of+mesenchymal+progenitor+cells.">Human induced pluripotent stem cells differentiated into chondrogenic lineage via generation of mesenchymal progenitor cells.</a> Stem Cells Dev. 22 (1), 102-113 (2013).</li><li>Liu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+insulin-transferrin-selenium+in+auricular+chondrocyte+proliferation+and+engineered+cartilage+formation+in+vitro.">Role of insulin-transferrin-selenium in auricular chondrocyte proliferation and engineered cartilage formation in vitro.</a> Int J Mol Sci. 15 (1), 1525-1537 (2014).</li><li>Guzzo, R. M., Scanlon, V., Sanjay, A., Xu, R. H., Drissi, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishment+of+human+cell+type-specific+iPS+cells+with+enhanced+chondrogenic+potential.">Establishment of human cell type-specific iPS cells with enhanced chondrogenic potential.</a> Stem Cell Rev. 10 (6), 820-829 (2014).</li><li>Goepfert, C., Slobodianski, A., Schilling, A. F., Adamietz, P., Portner, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cartilage+engineering+from+mesenchymal+stem+cells.">Cartilage engineering from mesenchymal stem cells.</a> Adv Biochem Eng Biotechnol. 123, 163-200 (2010).</li><li>Ingber, D. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tissue+engineering+and+developmental+biology:+going+biomimetic.">Tissue engineering and developmental biology: going biomimetic.</a> Tissue Eng. 12 (12), 3265-3283 (2006).</li><li>Yoshida, Y., Yamanaka, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+stem+cell+advances:+induced+pluripotent+stem+cells+for+disease+modeling+and+stem+cell-based+regeneration.">Recent stem cell advances: induced pluripotent stem cells for disease modeling and stem cell-based regeneration.</a> Circulation. 122 (1), 80-87 (2010).</li></ol>

The authors have nothing to disclose.

Here, we provide a protocol to generate chondrocytes from PBCs via iPSCs. Because PBCs are more common and widely used in the clinical field, they are presented as a potential alternative for reprogramming. In this study, episomal vectors (EV) were utilized to reprogram PBCs into iPSCs, following the method established by Zhang et al.11. This integration-free approach does not involve integrating virus-associated genotoxicity, which is believed to have a broad effect in the clinical field...

An erratum was issued for: <a href="https://www.jove.com/video/55722/differentiating-chondrocytes-from-peripheral-blood-derived-human">Differentiating Chondrocytes from Peripheral Blood-derived Human Induced Pluripotent Stem Cells</a>.
The corresponding author was updated from:
Yueying Li 
yueyinglee2010@hotmail.com 
Key Laboratory of Genomic and Precision Medicine, Beijing Institute of Genomics, Chinese Academy of Sciences
The corresponding author is now listed as:
Tie Liu 
waterkins@163.com 
Department of Orthopedics, Beijing Chao-Yang Hospital, Capital Medical University

An erratum was issued for: <a href="https://www.jove.com/video/55722/differentiating-chondrocytes-from-peripheral-blood-derived-human">Differentiating Chondrocytes from Peripheral Blood-derived Human Induced Pluripotent Stem Cells</a>.

Erratum: Differentiating Chondrocytes from Peripheral Blood-derived Human Induced Pluripotent Stem Cells

Cartilage tissue has a very poor capacity for self-repair and regeneration. Various surgical interventions and biological treatments are used to restore cartilage and joint function, with unsatisfying results. The recent development of stem cell technology may change the entire cartilage repair field1. Various stem cells have been studied as seed cells, but human induced pluripotent stem cells (hiPSCs) appear to be the most promising choice, as they can provide many types of patient-specific cells without causing rejection reactions2. Furthermore, they can overcome the limited proliferative nature of adult cells and maintain their self-renewal and pluripotent abilities. Moreover, gene targeting can be used to change the genotype to obtain specific types of chondrocytes.
Fibroblasts have been widely used to generate iPSCs because their reprogramming potentials have also been well studied. However, there are still some limitations that must be overcome, such as the painful biopsy from patients and the need for the in vitro expansion of the fibroblasts, which may result in gene mutations3. Recently, PBCs were found to be advantageous for reprogramming4; moreover, they were commonly utilized and abundantly stored. It is possible that they may redirect study focus from the skin. However, to the best of our knowledge, there are few reports on PBC reprogramming followed by differentiation into chondrocytes.
In the current study, we utilize PBCs as an alternative source by reprogramming them into iPSCs and then differentiating the iPSCs into the chondrogenic lineage through a pellet culture system in order to mimic chondrocyte formation.

<table><tbody><tr><td>Knockout DMEM</td><td>Invitrogen</td><td>10829018</td><td>Basal medium used for hiPSC culture and EB formation medium</td></tr><tr><td>Knockout Serum Replacement (KSR)</td><td>Invitrogen</td><td>10828028</td><td>A more defined, FBS-free medium supplement used for hiPSC culture and EB formation medium</td></tr><tr><td>Fetal bovine serum (FBS)</td><td>Hyclone</td><td>sh30070.03</td><td>Used for hiPSC culture and EB formation medium,offers excellent value for cell culture</td></tr><tr><td>Nonessential amino acids</td><td>Chemicon</td><td>TMS-001-C</td><td>Used as a growth supplement in all the cell culture medium, to increase cell growth and viability</td></tr><tr><td>L-glutamine</td><td>Invitrogen</td><td>TMS-002-C</td><td>An amino acid required for cell culture</td></tr><tr><td>Basic fibroblast growth factor (bFGF)</td><td>Peprotech</td><td>100-18B</td><td>A cytokine used for sustaining the pluripotency and self-renewal of hiPSCs</td></tr><tr><td>Dispase</td><td>Invitrogen</td><td>17105041</td><td>Used for hiPSC dissociation for subculture</td></tr><tr><td>DMEM</td><td>Gibco</td><td>C11960</td><td>Basal medium used for MSC culture medium</td></tr><tr><td>0.1% gelatin</td><td>Millipore</td><td>ES-006-B</td><td>Used for cell attachment onto the dishes</td></tr><tr><td>0.25% trypsin/EDTA</td><td>Gibco</td><td>25200072</td><td>Used for cell dissociation</td></tr><tr><td>DPBS</td><td>Gibco</td><td>14190250</td><td>A balanced salt solution used for cell wash or reagent preparing</td></tr><tr><td>2-mercaptoethanol</td><td>invitrogen</td><td>21985023</td><td>Used as a growth supplement in all the cell culture medium.</td></tr><tr><td>ITS</td><td>invitrogen</td><td>41400045</td><td>Insulin, Transferrin, Selenium Solution.Used for chondrogenic differentiation.</td></tr><tr><td>Ascorbic acid</td><td>Sigma</td><td>4403</td><td>Known as vitamin C. It helps in active growth and has antioxidant property.</td></tr><tr><td>Sodium pyruvate</td><td>Gibco</td><td>11360070</td><td>Added to cell culture medium as an energy source in addition to glucose.</td></tr><tr><td>Transforming growth factor-beta 1</td><td>Peprotech</td><td>AF-100-21C</td><td>A cytokine that regulate cell proliferation, growth and chondrogenic differentiation.</td></tr><tr><td>Rabbit polyclonal antibodies against Collagen II</td><td>Abcam</td><td>ab34712</td><td>This antibody reacts with Type II collagens,which is specific for cartilaginous tissues.</td></tr><tr><td>Mouse monoclonal antibodies to Collagen X</td><td>Abcam</td><td>ab49945</td><td>This antibody reacts with Type X collagen,which is a product of hyperthrophic chondrotocytes.</td></tr><tr><td>Permount</td><td>Fisher Scientific</td><td>SP15-100</td><td>For mounting and long-term storage of slides</td></tr><tr><td>Toluidine blue</td><td>Sigma</td><td>89640</td><td>Used for proteoglycans detection.</td></tr><tr><td>Alcian blue</td><td>Amresco</td><td>#0298</td><td>Used for glucosaminoglycans detection.</td></tr><tr><td>Papain</td><td>Sigma</td><td>P4762-25MG</td><td>Used to digest chondrogenic pellets.</td></tr><tr><td>Dimethylmethylene blue</td><td>Sigma</td><td>341088-1G</td><td>Used to quantitate glycosaminoglyans</td></tr><tr><td>Chondroitin sulfate sodium salt from shark cartilage</td><td>Sigma</td><td>C4384-250MG</td><td>Used to draw the standard curve for sGAG content measurement.</td></tr><tr><td>Qubit dsDNA HS assay kit</td><td>Invitrogen</td><td>Q32851 (100)</td><td>Used to determine DNA content</td></tr><tr><td>TRIzol</td><td>Invitrogen</td><td>15596018</td><td>Used for RNA isolation from cells</td></tr><tr><td>Reverse Transcriptase System</td><td>Promega</td><td>A3500</td><td>Used to convert RNA into cDNA</td></tr><tr><td>SYBR FAST qPCR kit Master Mix</td><td>Kapa</td><td>KK4601</td><td>Used for Real-time PCR</td></tr></tbody></table>

differentiating chondrocytes from peripheral blood-derived human induced pluripotent stem cells

In this study, we used peripheral blood cells (PBCs) as seed cells to produce chondrocytes via induced pluripotent stem cells (iPSCs) in an integration-free method. Following embryoid body (EB) formation and fibroblastic cell expansion, the iPSCs are induced for chondrogenic differentiation for 21 days under serum-free and xeno-free conditions. After chondrocyte induction, the phenotypes of the cells are evaluated by morphological, immunohistochemical, and biochemical analyses, as well as by the quantitative real-time PCR examination of chondrogenic differentiation markers. The chondrogenic pellets show positive alcian blue and toluidine blue staining. The immunohistochemistry of collagen II and X staining is also positive. The sulfated glycosaminoglycan (sGAG) content and the chondrogenic differentiation markers COLLAGEN 2 (COL2), COLLAGEN 10 (COL10), SOX9, and AGGRECAN are significantly upregulated in chondrogenic pellets compared to hiPSCs and fibroblastic cells. These results suggest that PBCs can be used as seed cells to generate iPSCs for cartilage repair, which is patient-specific and cost-effective.

Chondrogenic Differentiation of hiPSCs:
EB formation medium and basal culture medium were used to differentiate the hiPSCs into the mesenchymal lineage. A multi-step culture method was used (Figure 1). First, the hiPSCs were spontaneously differentiated via EB formation for 10 days (D10; Figure 2A). Second, cells outgrew from the EBs for another 10 days (D10+10). During th...

Watch this Scientific Journal Video about Differentiating Chondrocytes from Peripheral Blood-derived Human Induced Pluripotent Stem Cells at JoVE.com

Differentiating Chondrocytes from Peripheral Blood-derived Human Induced Pluripotent Stem Cells

We present a protocol to generate a chondrogenic lineage from human peripheral blood (PB) via induced pluripotent stem cells (iPSCs) using an integration-free method, which includes embryoid body (EB) formation, fibroblastic cells expansion, and chondrogenic induction.

In this study, we used peripheral blood cells (PBCs) as seed cells to produce chondrocytes via induced pluripotent stem cells (iPSCs) in an ...

differentiating-chondrocytes-from-peripheral-blood-derived-human

Research

JoVE Journal

Developmental Biology

9.1K Views.  Capital Medical University. We present a protocol to generate a chondrogenic lineage from human peripheral blood (PB) via induced pluripotent stem cells (iPSCs) using an integration-free method, which includes embryoid body (EB) formation, fibroblastic cells expansion, and chondrogenic induction.

Video: Differentiating Chondrocytes from Peripheral Blood-derived Human Induced Pluripotent Stem Cells

Chondrogenic Differentiation Induction of Adipose-derived Stem Cells by Centrifugal Gravity

Impaired cartilage cannot heal naturally. Currently, the most advanced therapy for defects in cartilage is the transplantation of chondrocytes differentiated from stem cells using cytokines. Unfortunately, cytokine-induced chondrogenic differentiation is costly, time-consuming, and associated with a high risk of contamination during in vitro differentiation. However, biomechanical stimuli also serve as crucial regulatory factors for chondrogenesis. For example, mechanical stress can induce chondrogenic differentiation of stem cells, suggesting a potential therapeutic approach for the repair of impaired cartilage. In this study, we demonstrated that centrifugal gravity (CG, 2,400 &#215; g), a mechanical stress easily applied by centrifugation, induced the upregulation of sex determining region Y (SRY)-box 9 (SOX9) in adipose-derived stem cells (ASCs), causing them to express chondrogenic phenotypes. The centrifuged ASCs expressed higher levels of chondrogenic differentiation markers, such as aggrecan (ACAN), collagen type 2 alpha 1 (COL2A1), and collagen type 1 (COL1), but lower levels of collagen type 10 (COL10), a marker of hypertrophic chondrocytes. In addition, chondrogenic aggregate formation, a prerequisite for chondrogenesis, was observed in centrifuged ASCs.

Mechanical stress can induce the chondrogenic differentiation of stem cells, providing a potential therapeutic approach for the repair of impaired cartilage. We present a protocol to induce the chondrogenic differentiation of adipose-derived stem cells (ASCs) using centrifugal gravity (CG). CG-induced upregulation of SOX9 results in the development of chondrogenic phenotypes.

Impaired cartilage cannot heal naturally. Currently, the most advanced therapy for defects in cartilage is the transplantation of chondrocytes ...

Directed Differentiation of Primitive and Definitive Hematopoietic Progenitors from Human Pluripotent Stem Cells

One of the major goals for regenerative medicine is the generation and maintenance of hematopoietic stem cells (HSCs) derived from human pluripotent stem cells (hPSCs). Until recently, efforts to differentiate hPSCs into HSCs have predominantly generated hematopoietic progenitors that lack HSC potential, and instead resemble yolk sac hematopoiesis.&#160;These resulting hematopoietic progenitors may have limited utility for in vitro disease modeling of various adult hematopoietic disorders, particularly those of the lymphoid lineages. However, we have recently described methods to generate erythro-myelo-lymphoid multilineage definitive hematopoietic progenitors from hPSCs using a stage-specific directed differentiation protocol, which we outline here. Through enzymatic dissociation of hPSCs on basement membrane matrix-coated plasticware, embryoid bodies (EBs) are formed. EBs are differentiated to mesoderm by recombinant BMP4, which is subsequently specified to the definitive hematopoietic program by the GSK3&#946; inhibitor, CHIR99021. Alternatively, primitive hematopoiesis is specified by the PORCN inhibitor, IWP2. Hematopoiesis is further driven through the addition of recombinant VEGF and supportive hematopoietic cytokines. The resulting hematopoietic progenitors generated using this method have the potential to be used for disease and developmental modeling, in vitro.

Here, we present human pluripotent stem cell (hPSC) culture protocols, used to differentiate hPSCs into CD34+ hematopoietic progenitors. This method uses stage-specific manipulation of canonical WNT signaling to specify cells exclusively to either the definitive or primitive hematopoietic program.

One of the major goals for regenerative medicine is the generation and maintenance of hematopoietic stem cells (HSCs) derived from human pluripotent stem ...

Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells

Human articular cartilage lacks the ability to repair itself. Cartilage degeneration is thus treated not by curative but by conservative treatments. Currently, efforts are being made to regenerate damaged cartilage with ex vivo expanded chondrocytes or bone marrow-derived mesenchymal stem cells (BMSCs). However, the restricted viability and instability of these cells limit their application in cartilage reconstruction. Human induced pluripotent stem cells (hiPSCs) have received scientific attention as a new alternative for regenerative applications. With unlimited self-renewal ability and multipotency, hiPSCs have been highlighted as a new replacement cell source for cartilage repair. However, obtaining a high quantity of high-quality chondrogenic pellets is a major challenge to their clinical application. In this study, we used embryoid body (EB)-derived outgrowth cells for chondrogenic differentiation. Successful chondrogenesis was confirmed by PCR and staining with alcian blue, toluidine blue, and antibodies against collagen types I and II (COL1A1 and COL2A1, respectively). We provide a detailed method for the differentiation of cord blood mononuclear cell-derived iPSCs (CBMC-hiPSCs) into chondrogenic pellets.

Here, we propose a protocol for chondrogenic differentiation from cord blood mononuclear cell-derived human induced pluripotent stem cells.

Human articular cartilage lacks the ability to repair itself. Cartilage degeneration is thus treated not by curative but by conservative treatments. ...

Generation of 3D Skin Organoid from Cord Blood-derived Induced Pluripotent Stem Cells

The skin is the body&#8217;s largest organ and has many functions. The skin acts as a physical barrier and protector of the body and regulates bodily functions. Biomimetics is the imitation of the models, systems, and elements of nature for the purpose of solving complex human problems1. Skin biomimetics is a useful tool for in vitro disease research and in vivo regenerative medicine. Human induced pluripotent stem cells (iPSCs) have the characteristic of unlimited proliferation and the ability of differentiation to three germ layers. Human iPSCs are generated from various primary cells, such as blood cells, keratinocytes, fibroblasts, and more. Among them, cord blood mononuclear cells (CBMCs) have emerged as an alternative cell source from the perspective of allogeneic regenerative medicine. CBMCs are useful in regenerative medicine because human leukocyte antigen (HLA) typing is essential to the cell banking system. We provide a method for the differentiation of CBMC-iPSCs into keratinocytes and fibroblasts and for generation of a 3D skin organoid. CBMC-iPSC-derived keratinocytes and fibroblasts have characteristics similar to a primary cell line. The 3D skin organoids are generated by overlaying an epidermal layer onto a dermal layer. By transplanting this 3D skin organoid, a humanized mice model is generated. This study shows that a 3D human iPSC-derived skin organoid may be a novel, alternative tool for dermatologic research in vitro and in vivo.

We propose a protocol that shows how to differentiate induced pluripotent stem cell-derived keratinocytes and fibroblasts and generate a 3D skin organoid, using these keratinocytes and fibroblasts. This protocol contains an additional step of generating a humanized mice model. The technique presented here will improve dermatologic research.

The skin is the body&#8217;s largest organ and has many functions. The skin acts as a physical barrier and protector of the body and regulates bodily ...

Directed Differentiation of Hemogenic Endothelial Cells from Human Pluripotent Stem Cells

Blood vessels are ubiquitously distributed within all tissues of the body and perform diverse functions. Thus, derivation of mature vascular endothelial cells, which line blood vessel lumens, from human pluripotent stem cells is crucial for a multitude of tissue engineering and regeneration applications. In vivo, primordial endothelial cells are derived from the mesodermal lineage and are specified toward specific subtypes, including arterial, venous, capillary, hemogenic, and lymphatic. Hemogenic endothelial cells are of particular interest because, during development, they give rise to hematopoietic stem and progenitor cells, which then generate all blood lineages throughout life. Thus, creating a system to generate hemogenic endothelial cells in vitro would provide an opportunity to study endothelial-to-hematopoietic transition, and may lead to ex vivo production of human blood products and reduced reliance on human donors. While several protocols exist for the derivation of progenitor and primordial endothelial cells, generation of well-characterized hemogenic endothelial cells from human stem cells has not been described. Here, a method for the derivation of hemogenic endothelial cells from human embryonic stem cells in approximately 1 week is presented: a differentiation protocol with primitive streak cells formed in response to GSK3&#946; inhibitor (CHIR99021), then mesoderm lineage induction mediated by bFGF, followed by primordial endothelial cell development promoted by BMP4 and VEGF-A, and finally hemogenic endothelial cell specification induced by retinoic acid. This protocol yields a well-defined population of hemogenic endothelial cells that can be used to further understand their molecular regulation and endothelial-to-hematopoietic transition, which has the potential to be applied to downstream therapeutic applications.

Presented here is a simple protocol for the directed differentiation of hemogenic endothelial cells from human pluripotent stem cells in approximately 1 week.

Blood vessels are ubiquitously distributed within all tissues of the body and perform diverse functions. Thus, derivation of mature vascular endothelial ...

Differentiation and Characterization of Osteoclasts from Human Induced Pluripotent Stem Cells

This protocol details the propagation and passaging of human iPSCs and their differentiation into osteoclasts. First, iPSCs are dissociated into a single-cell suspension for further use in embryoid body induction. Following mesodermal induction, embryoid bodies undergo hematopoietic differentiation, producing a floating hematopoietic cell population. Subsequently, the harvested hematopoietic cells undergo a macrophage colony-stimulating factor maturation step and, finally, osteoclast differentiation. After osteoclast differentiation, osteoclasts are characterized by staining for TRAP in conjunction with a methyl green nuclear stain. Osteoclasts are observed as multinucleated, TRAP+ polykaryons. Their identification can be further supported by Cathepsin K staining. Bone and mineral resorption assays allow for functional characterization, confirming the identity of bona fide osteoclasts. This protocol demonstrates a robust and versatile method to differentiate human osteoclasts from iPSCs and allows for easy adoption in applications requiring large quantities of functional human osteoclasts. Applications in the areas of bone research, cancer research, tissue engineering, and endoprosthesis research could be envisioned.

This protocol presents the differentiation of human osteoclasts from induced pluripotent stem cells (iPSCs) and describes methods for the characterization of osteoclasts and osteoclast precursors.

This protocol details the propagation and passaging of human iPSCs and their differentiation into osteoclasts. First, iPSCs are dissociated into a ...

Generating Spheroids from Various Chondrocytes using Low-Adhesive Conditions under Gravity and Homemade Mini-Bioreactors

Cartilage repair in chronic joint diseases demands advanced cell-based therapies to regenerate damaged tissues effectively. This protocol provides a step-by-step method for differentiating induced pluripotent stem cells (iPSCs) into chondrocyte-based spheroids, supporting tissue engineering and cell therapy applications. The differentiation process is carefully structured to promote chondrogenic lineage commitment, beginning with iPSCs cultured in specific media that sequentially guide cells through critical stages of differentiation. Initially, iPSCs are expanded to reach optimal confluency before induction toward chondrogenic lineage using a series of defined media changes. By day 10, cells are transitioned to a chondrogenesis-promoting medium that enhances the formation of chondrocyte-like cells expressing key markers of mature chondrocytes. Further aggregation in 96-well agarose-coated plates leads to the formation of three-dimensional spheroids, which are then cultured in custom mini-bioreactors designed to simulate a microenvironment that encourages extracellular matrix (ECM) deposition. By enabling scalable production of chondrocyte spheroids that mimic native cartilage characteristics, this approach offers a promising, reproducible solution for developing cell-based treatments for cartilage defects, providing broad utility for clinical and research applications in musculoskeletal regenerative medicine.

This study describes a method for producing chondrocytic spheroids by aggregating cells into spheroids under low-adhesion conditions using gravity, followed by culturing the resulting spheroids in mini-bioreactors.

Cartilage repair in chronic joint diseases demands advanced cell-based therapies to regenerate damaged tissues effectively. This protocol provides a ...

Bioengineering

Differentiation Capacity of Human Aortic Perivascular Adipose Progenitor Cells

Adipose tissue is a rich source of multi-potent mesenchymal stem cells (MSC) capable of differentiating into osteogenic, adipogenic, and chondrogenic lineages. Adipogenic differentiation of progenitor cells is a major mechanism driving adipose tissue expansion and dysfunction in response to obesity. Understanding changes to perivascular adipose tissue (PVAT) is thus clinically relevant in metabolic disease. However, previous studies have been predominately performed in the mouse and other animal models. This protocol uses human thoracic PVAT samples collected from patients undergoing coronary artery bypass graft surgery. Adipose tissue from the ascending aorta was collected and used for explantation of the stromal vascular fraction. We previously confirmed the presence of adipose progenitor cells in human PVAT with the capacity to differentiate into lipid-containing adipocytes. In this study, we further analyzed the differentiation potential of cells from the stromal vascular fraction, presumably containing multi-potent progenitor cells. We compared PVAT-derived cells to human bone marrow MSC for differentiation into adipogenic, osteogenic, and chondrogenic lineages. Following 14 days of differentiation, specific stains were utilized to detect lipid accumulation in adipocytes (Oil red O), calcific deposits in osteogenic cells (Alizarin Red), or glycosaminoglycans and collagen in chondrogenic cells (Masson&#8217;s Trichrome). While bone marrow MSC efficiently differentiated into all three lineages, PVAT-derived cells had adipogenic and chondrogenic potential, but lacked robust osteogenic potential.

The goal of this protocol is to test the ability of progenitor cells derived from human perivascular adipose tissue to differentiate into multiple cell lineages. Differentiation was compared to mesenchymal stem cells derived from human bone marrow, which is known to differentiate into adipocyte, osteocyte, and chondrocyte lineages.

Adipose tissue is a rich source of multi-potent mesenchymal stem cells (MSC) capable of differentiating into osteogenic, adipogenic, and chondrogenic ...

Biology

Characterizing Surface Antigens and Proliferation Ability in hiPSC-Driving MSCs

Comparison of Two Representative Methods for Differentiation of Human Induced Pluripotent Stem Cells into Mesenchymal Stromal Cells

Mesenchymal stromal cells (MSCs) are adult pluripotent stem cells which have been widely used in regenerative medicine. As somatic tissue-derived MSCs are restricted by limited donation, quality variations, and biosafety, the past 10 years have seen a great rise in efforts to generate MSCs from human induced pluripotent stem cells (hiPSCs). Past and recent efforts in the differentiation of hiPSCs into MSCs have been centered around two culture methodologies: (1) the formation of embryoid bodies (EBs) and (2) the use of monolayer culture. This protocol describes these two representative methods in deriving MSC from hiPSCs. Each method presents its advantages and disadvantages, including time, cost, cell proliferation ability, the expression of MSC markers, and their capability of differentiation in vitro. This protocol demonstrates that both methods can derive mature and functional MSCs from hiPSCs. The monolayer method is characterized by lower cost, simpler operation, and easier osteogenic differentiation, while the EB method is characterized by lower time consumption.

Author Spotlight: Advancements in iPSCs and Genetic Disease Research 

This protocol describes and compares two representative methods for differentiating hiPSCs into mesenchymal stromal cells (MSCs). The monolayer method is characterized by lower cost, simpler operation, and easier osteogenic differentiation. The embryoid bodies (EBs) method is characterized by lower time consumption.

Mesenchymal stromal cells (MSCs) are adult pluripotent stem cells which have been widely used in regenerative medicine. As somatic tissue-derived MSCs are ...

Chondroprogenitor and Chondrocyte Isolation from Human Articular Cartilage

Isolation of Chondrocytes and Chondroprogenitors Using Fibronectin Adhesion and Migratory Assay

Chondroprogenitor cells (CPCs), recently identified as a distinct subpopulation, exhibit promise due to their mesenchymal properties, heightened chondrogenesis, and limited hypertrophic traits. The enrichment of progenitors is achieved through differential fibronectin adhesion and migration-based explant assays, with Fibronectin Adhesion Assay-derived Chondroprogenitors (FAA-CPs) and Migratory Chondroprogenitors (MCPs) demonstrating superior potential compared to chondrocytes. This article delves into the details of isolating resident cartilage-derived cells, namely chondrocytes and chondroprogenitors. While valuable insights from chondrocyte research contribute to our understanding of cartilage repair, ongoing efforts are directed toward the use of chondroprogenitors and exploring their potential as an alternative therapeutic approach. Additionally, this methodology article provides a detailed step-by-step protocol for isolating three specific cell types from cartilage: chondrocytes, FAA-CPs, and MCPs. By following standardized procedures, this protocol facilitates the successful extraction of these cell subtypes. Grounded in extensive research, the article focuses on the intricate techniques utilized in isolating the different subsets and the optimized culture conditions required to expand and maintain their cultures. The methodology encompasses enzymatic isolation of human articular cartilage-derived chondrocytes, differential fibronectin adhesion following sequential enzymatic digestion, and migration-based explant assays to obtain cartilage-resident cells.

This protocol details the isolation of chondrocytes, Fibronectin Adhesion Assay-derived Chondroprogenitors (FAA-CPs), and Migratory Chondroprogenitors (MCPs) from human articular cartilage. It covers enzymatic digestion, fibronectin adhesion, and migration-based assays for isolating and characterizing these cells.