R.H. is supported by US National Institutes of Health grants (R01HL116546 and R01 AR064241).

The animals used in this protocol were maintained at The Ohio State University Laboratory Animal Resources in accordance with animal use guidelines. All animal studies were authorized by the Institutional Animal Care, Use, and Review Committee of the Ohio State University.
1. Design and Cloning of gRNAs into the CRISPR Vector
<ol>
	<li>Select 2 gRNAs targeting dystrophin intron 20 and intron 23 (i20 and i23) for SaCas9: i20: 5&#39;-GGGCGTTGAAATTCTCATTAC CAGAGT and i23: 5&#39;-CACCGATGAGAGGGAAAGGTC CTGAAT (the PAM sequence is underlined and italicized). 
	NOTE: The target sites for i20 and i23 are about 23 kilo base pair (kbp) away. To disrupt a coding gene, two gRNAs targeting the common exons with the NNGRRT PAM sequence for SaCas9 (preferably NNGAAT, NNGGGT and NNGAGT) and distance within 20 kbp are recommended.</li>
	<li>Use the following PCR parameters to anneal the gRNA oligos (100 &#181;mol/L) in 1x annealing buffer (the 5x annealing buffer stock contains 0.5 mol/L K-acetate, 150 mmol/L HEPES-KOH, 10 mmol/L Mg-acetate, pH7.4): 95 &#176;C 10 min, 90 cycles of 95 to 59 &#176;C with a 0.4 &#176;C decrease per cycle for 20 s, 90 cycles of 59 to 32 &#176;C with a 0.3 &#176;C decrease per cycle for 20 s, 20 cycles of 32 to 26 &#176;C with a 0.3 &#176;C decrease per cycle for 20 s.</li>
	<li>Ligate the annealed gRNA oligos into the pX601-CMV-SaCas9-mPA-U6-gRNA using BsaI and T4 DNA ligase in one reaction (1 &#181;L 50 ng/&#181;L pX601-CMV-SaCas9-mPA-U6-gRNA, 1 &#181;L annealed oligos, 1.5 &#181;L 10x T4 DNA ligase buffer, 0.5 &#181;L T4 DNA ligase, 1 &#181;L BsaI, 10 &#181;L ddH2O), with the following reaction condition in a PCR cycler: 5 cycles of [37 &#176;C 5 min and 16 &#176;C 10 min]; 37 &#176;C 20 min; 80 &#176;C 5 min.</li>
	<li>Transform the 15 &#181;L ligation product into 30 &#181;L competent cells, plate the cells in agar plate with 100 &#181;g/mL Ampicillin, and culture at 37 &#176;C for 24 h.</li>
	<li>Pick up 5-10 colonies and culture in LB medium containing 100 &#181;g/mL Ampicillin at 37 &#176;C, 250 rpm in a shaker incubator for 3-4 h.</li>
	<li>Screen the colonies by PCR: 10 &#181;L 2x PCR master mix, 8 &#181;L ddH2O, 1 &#181;L E. Coli culture, 1 &#181;L 10 &#181;mol/L U6-forward primer, 1 &#181;L i20 or i23 gRNA reverse primer. The PCR cycling parameters: 95 &#176;C 5 min, 35 cycles of 95 &#176;C 30 s, 61 &#176;C 30 s, 72 &#176;C 30 s.</li>
	<li>Prepare 5 mL culture of the positive clones by adding 4 mL fresh LB medium containing100 &#181;g/mL Ampicillin, and culture overnight at 37 &#176;C, 250 rpm.</li>
	<li>Purify the plasmid DNA using the appropriate plasmid extraction kit, and verify the plasmid by Sanger sequencing with the U6-forward primer.</li>
	<li>Culture C2C12 cells in DMEM supplemented with 10% FBS and 1% Pen-Strep until reaching ~70% confluency for testing the gene editing efficacy of the plasmids.</li>
	<li>Electroporate a total of 5 &#181;g SaCas9/gRNA plasmid mixture in 1:1 molar ratio into 1 x 106 C2C12 cells according to the manufacturer&#39;s protocol.</li>
	<li>After 48 h post-transfection, harvest the C2C12 cells and extract genomic DNA.</li>
	<li>Use 100 ng genomic DNA as template to perform the PCR reaction for mouse dystrophin locus: forward primer 5&#39;-GGCCAAAGCAAACTCTGGTA (1 &#181;L 10 &#181;mol/L), reverse primer 5&#39;-TTTAATCCCACGTCATGCAA (1 &#181;L 10 &#181;mol/L), 10 &#181;L 2x the green PCR master mix, 7 &#181;L ddH2O, 1 &#181;L genomic DNA (100 ng). Use PCR cycling conditions as 95 &#176;C 5 min, 35 cycles of [95 &#176;C 30 s, 61 &#176;C 30 s, 72 &#176;C 30 s], 72 &#176;C 2 min.</li>
</ol>
2. rAAV Production
<ol>
	<li>To culture the cells, seed AD293 cells onto 20 to 40 of 15-cm dishes and maintain in DMEM supplemented with 10% FBS and 1% Pen-Strep until reaching ~90% confluency for transfection.</li>
	<li>Dilute 3 plasmids with 200 &#181;L reduced serum medium (per dish): 1)10 &#181;g pHelper; 2) 5 &#181;g pXR(rh.74 or other serotypes) and 3) A total of 5 &#181;g of pX601-i20 and pX601-i23 mixture (1:1 ratio). Perform polyethylenimine (PEI) transfection by mixing with 80 &#181;L PEI and incubate at room temperature for 10 min. Add the mixture on to the AD293 cell cultures in a dropwise manner.</li>
	<li>For AAV virus production, after 72 h post transfection, use a cell scraper to collect both the media and the AD293 cell pellets by centrifugation at 1100 x g for 10 mins.</li>
	<li>Resuspend the cell pellets in 15 mL rAAV lysis buffer (50 mmol/L Tris Base, 150 mmol/L NaCl, pH 8.5) followed by 3 freeze-thaw cycles with alternating incubation in liquid nitrogen and a 42 &#176;C water bath. Store the cell lysates in -80 &#176;C for future processing if they are not being processed immediately.</li>
	<li>Filter the culture media with a 0.45-&#181;m filter and add a 40% PEG8000 in 2.5 mol/L NaCl to a final concentration of 8%. Incubate the mixture at 4 &#176;C for 1 h and centrifuge at 1100 x g for 15 min.</li>
	<li>Resuspend the pellets in rAAV lysis buffer and combine with the cell lysates from step 2.3, followed by benzonase (50 U/mL) treatment at 37 &#176;C for 1 h.</li>
	<li>Centrifuge the benzonase-treated rAAV containing mixture 1100 x g for 15 min at 4 &#176;C, and save the supernatant (the crude rAAV preparation).</li>
</ol>
3. rAAV Purification and Concentration
<ol>
	<li>Load the crude rAAV preparation onto an iodixanol gradient in an ultracentrifuge tube in the following order from the top to the bottom: crude AAV lysate (~15 mL), 8 mL 15% Iodixanol, 6 mL 25% Iodixanol, 5 mL 40% Iodixanol, 5 mL 58% Iodixanol. Fill the remaining empty volume of the tube to the top using 1x DPBS.</li>
	<li>Centrifuge the samples at 230,000 x g in an ultracentrifuge rotor for 120 min at 10 &#176;C and collect 3 - 4 mL of the 40% gradient fraction containing the rAAV particles with an 18 G needle.</li>
	<li>Dilute the rAAV particles with 1x DPBS and centrifuge using the centrifugal filter unit (MWCO 100 kDa). Repeat this step for 3-5 times and finally concentrate the rAAV preparation to 300-500 &#181;L.</li>
</ol>
4. rAAV Titering
<ol>
	<li>Extract the genomic DNA from 2 &#181;L concentrated rAAV, precipitate with 3 M NaOAc in ethanol, and resuspend in 20 &#181;L ddH2O.</li>
	<li>Obtain the standard curve for rAAV quantitation by serial dilution of the pX601 plasmid: 1 x 109, 1 x 108, 1 x 107, 1 x 106, 1 x 105 copies in each 10 &#181;L ddH2O. Dilute the DNAase-treated rAAV samples as 1:10, 1:50, 1:100, and 1:1000.</li>
	<li>Determine rAAV titer by quantitative real-time PCR (qPCR) using qPCR Kit according to manufacturer&#39;s instruction in a Real-Time PCR system: 1 &#181;L 10 &#181;mol/L of each primer (5&#39;-GGATTTCCAAGTCTCCACCC and 5&#39;-TCCCACCGT ACACGCCTAC), 5 &#181;L 2x PCR master mix, 1 &#181;L diluted rAAV samples and 2 &#181;L ddH2O. Run the reaction with the following cycling parameters: 95 &#176;C 3 min, 45 cycles of [95 &#176;C 5 sec and 61 &#176;C 20 sec].</li>
</ol>
5. Intravenous and Intraperitoneal Injection of rAAVrh.74-CRISPR into Neonatal mdx/utrophin+/- Mice
<ol>
	<li>Immobilize the mdx/utrophin+/- mouse pups (day 3) by placing on ice for 1 min, and then administer with 1 x 1012 viral particles in 50 &#181;L per mouse systemically via a retro-orbital approach or an intraperitoneal injection.</li>
	<li>Allow the mice to recover and place back into their home cages. At ten weeks after rAAV administration, euthanize the mice by CO2 exposure for tissue collection.</li>
	<li>Snap-freeze tissues for genomic DNA and RNA extraction, and use cooling isopentane in liquid nitrogen to freeze tissues with optimal cutting temperature compound for cryosectioning.</li>
</ol>
6. Analysis of Target Gene Editing Outcomes
<ol>
	<li>Genomic DNA PCR analysis
	<ol>
		<li>Isolate the total genomic DNA from the heart tissues of mdx/utrophin+/- mice treated with or without rAAV.</li>
		<li>Use the same protocol in Step 1.12 for PCR analysis.</li>
	</ol>
	</li>
	<li>RT-PCR analysis of dystrophin expression
	<ol>
		<li>Extract total RNA from the heart tissues with the RNA extraction kit following the manufacturer&#39;s manual.</li>
		<li>To perform reverse transcription, pre-treat the total RNA with an RNase-free DNase and use 5 &#181;g of treated RNA as the template for first-strand cDNA synthesis with the reverse transcription kit.</li>
		<li>Use the reverse transcription product for RT-PCR analysis of dystrophin expression with the dystrophin cDNA primers: 5&#39;-GGCTAGAGTATCAAACCAACATCAT and 5&#39;- TGGAGGCTTACGGTTTTATCC.</li>
	</ol>
	</li>
	<li>Estimate the gene editing efficacy by qPCR analysis
	<ol>
		<li>Estimate the gene editing efficacy by quantitative RT-PCR to detect the reduction of exon 22-containing transcripts using the forward primer (exon 21): 5&#39;-TTGTCAGCTCTTCAGCCTCAAA, and the reverse primer (exon 23): 5&#39;-AAACTCTCCTTCACAGTGTCACT. Use Gapdh as a reference gene with the forward primer: 5&#39;- AGGTTGTCTCCTGCGACTTC and the reverse primer: 5&#39;- GGTGGTCCAGGGTTTCTTACT.</li>
		<li>Run the quantitative real-time PCR (qPCR) using the qPCR Kit according to manufacturer&#39;s instruction in a Real-Time PCR system and the 2-step reaction conditions: 95 &#176;C 3 min, 45 cycles of 95 &#176;C 5 sec and 61 &#176;C 30 sec.</li>
	</ol>
	</li>
	<li>Immunofluorescence staining to analyze dystrophin expression
	<ol>
		<li>Cut the frozen tissues using a cryostat at a thickness of 10 &#181;m. Fix the frozen sections with 4% paraformaldehyde at room temperature for 15 min.</li>
		<li>Wash 2x with PBS and incubate with blocking solution (10% horse serum) for 1 h.</li>
		<li>Incubate the anti-dystrophin primary antibody, at 4 &#176;C overnight.</li>
		<li>Wash the slides with PBS 3 x 5 min and incubate with fluorescent secondary antibodies (1:500) at room temperature for 1 h.</li>
		<li>Mount the slides using the mounting medium with DAPI and imaging with an inverted confocal microscope.</li>
	</ol>
	</li>
</ol>
7. Off-target analysis by T7E1 assay
<ol>
	<li>Predict the potential off-target sites using the online CRISPR design tools such as &#60;http://crispr.mit.edu&#62;.</li>
	<li>Amplify the genomic regions covering the top 5-10 potential off-target sites by PCR: genomic DNA 200 ng, 1 &#181;L high-fidelity DNA polymerase, 5 &#181;L 10x PCR Buffer mix, 1.5 &#181;L 10 &#181;mol/L of site-specific forward and reverse primers, adjusting the total volume to 50 &#181;L with ddH2O.</li>
	<li>Run the PCR products by electrophoresis, extract and purify the DNA using a gel extraction kit. Measure the concentration using spectrophotometers.</li>
	<li>Promote heteroduplex formation by denaturing and re-annealing the purified amplicons slowly in the Buffer 2.1 using a PCR cycler. Use the same cycling conditions as detailed in step 1.2.</li>
	<li>Digest the re-annealed products for 30 min at 37 &#176;C with 0.5 &#181;L T7E1 enzyme, and analyze the reaction by electrophoresis using 1-2% agarose gel. 
	NOTE: The amplicons can also be analyzed by targeted deep sequencing.</li>
</ol>

<ol>
	<li>Makarova, K. S., Koonin, E. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Annotation+and+Classification+of+CRISPR-Cas+Systems.">Annotation and Classification of CRISPR-Cas Systems.</a> Methods Mol Biol. 1311, 47-75 (2015).</li><li>Zetsche, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cpf1+is+a+single+RNA-guided+endonuclease+of+a+class+2+CRISPR-Cas+system.">Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system.</a> Cell. 163, 759-771 (2015).</li><li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+using+CRISPR/Cas+systems.">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339, 819-823 (2013).</li><li>Mali, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-guided+human+genome+engineering+via+Cas9.">RNA-guided human genome engineering via Cas9.</a> Science. 339, 823-826 (2013).</li><li>Lieber, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mechanism+of+double-strand+DNA+break+repair+by+the+nonhomologous+DNA+end-joining+pathway.">The mechanism of double-strand DNA break repair by the nonhomologous DNA end-joining pathway.</a> Annual review of biochemistry. 79, 181-211 (2010).</li><li>Ran, F. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+engineering+using+the+CRISPR-Cas9+system.">Genome engineering using the CRISPR-Cas9 system.</a> Nature protocols. 8, 2281-2308 (2013).</li><li>Zhang, X., Wang, J., Cheng, Q., Zheng, X., Zhao, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+gene+regulation+by+CRISPR-ddCpf1.">Multiplex gene regulation by CRISPR-ddCpf1.</a> Cell discovery. 3, 17018 (2017).</li><li>Zhang, X. H., Tee, L. Y., Wang, X. G., Huang, Q. S., Yang, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Off-target+Effects+in+CRISPR/Cas9-mediated+Genome+Engineering.">Off-target Effects in CRISPR/Cas9-mediated Genome Engineering.</a> Molecular therapy. Nucleic acids. 4, e264 (2015).</li><li>Xu, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-mediated+genome+editing+restores+dystrophin+expression+and+function+in+mdx+mice.">CRISPR-mediated genome editing restores dystrophin expression and function in mdx mice.</a> Mol Ther. 24, 564-569 (2015).</li><li>Long, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Postnatal+genome+editing+partially+restores+dystrophin+expression+in+a+mouse+model+of+muscular+dystrophy.">Postnatal genome editing partially restores dystrophin expression in a mouse model of muscular dystrophy.</a> Science. 351, 400-403 (2016).</li><li>Long, C. Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prevention+of+muscular+dystrophy+in+mice+by+CRISPR/Cas9-mediated+editing+of+germline+DNA.">Prevention of muscular dystrophy in mice by CRISPR/Cas9-mediated editing of germline DNA.</a> Science. 345, 1184-1188 (2014).</li><li>Nelson, C. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+genome+editing+improves+muscle+function+in+a+mouse+model+of+Duchenne+muscular+dystrophy.">In vivo genome editing improves muscle function in a mouse model of Duchenne muscular dystrophy.</a> Science. 351, 403-407 (2016).</li><li>Ousterout, D. G. K., Thakore, A. M., Majoros, P. I., Reddy, T. E. W. H., Gersbach, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+CRISPR/Cas9-based+genome+editing+for+correction+of+dystrophin+mutations+that+cause+Duchenne+muscular+dystrophy.">Multiplex CRISPR/Cas9-based genome editing for correction of dystrophin mutations that cause Duchenne muscular dystrophy.</a> Nat Commun. 6, 6244 (2015).</li><li>Tabebordbar, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+gene+editing+in+dystrophic+mouse+muscle+and+muscle+stem+cells.">In vivo gene editing in dystrophic mouse muscle and muscle stem cells.</a> Science. 351, 407-411 (2016).</li><li>Bengtsson, N. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Muscle-specific+CRISPR/Cas9+dystrophin+gene+editing+ameliorates+pathophysiology+in+a+mouse+model+for+Duchenne+muscular+dystrophy.">Muscle-specific CRISPR/Cas9 dystrophin gene editing ameliorates pathophysiology in a mouse model for Duchenne muscular dystrophy.</a> Nat Commun. 8, 14454 (2017).</li><li>Hoffman, E. P., Brown, R. H., Kunkel, L. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dystrophin:+the+protein+product+of+the+Duchenne+muscular+dystrophy+locus.">Dystrophin: the protein product of the Duchenne muscular dystrophy locus.</a> Cell. 51, 919-928 (1987).</li><li>Nowak, K. J., Davies, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Duchenne+muscular+dystrophy+and+dystrophin:+pathogenesis+and+opportunities+for+treatment.">Duchenne muscular dystrophy and dystrophin: pathogenesis and opportunities for treatment.</a> EMBO reports. 5, 872-876 (2004).</li><li>Mendell, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence-based+path+to+newborn+screening+for+Duchenne+muscular+dystrophy.">Evidence-based path to newborn screening for Duchenne muscular dystrophy.</a> Annals of neurology. 71, 304-313 (2012).</li><li>Mendell, J. R., Lloyd-Puryear, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Report+of+MDA+muscle+disease+symposium+on+newborn+screening+for+Duchenne+muscular+dystrophy.">Report of MDA muscle disease symposium on newborn screening for Duchenne muscular dystrophy.</a> Muscle Nerve. 48, 21-26 (2013).</li><li>Spurney, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardiomyopathy+of+Duchenne+muscular+dystrophy:+current+understanding+and+future+directions.">Cardiomyopathy of Duchenne muscular dystrophy: current understanding and future directions.</a> Muscle Nerve. 44, 8-19 (2011).</li><li>Moriuchi, T., Kagawa, N., Mukoyama, M., Hizawa, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Autopsy+analyses+of+the+muscular+dystrophies.">Autopsy analyses of the muscular dystrophies.</a> Tokushima J Exp Med. 40, 83-93 (1993).</li><li>McNally, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+approaches+in+the+therapy+of+cardiomyopathy+in+muscular+dystrophy.">New approaches in the therapy of cardiomyopathy in muscular dystrophy.</a> Annual review of medicine. 58, 75-88 (2007).</li><li>Baker, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Approvals,+Submission,+and+Important+Labeling+Changes+for+US+Marketed+Pharmaceuticals.">Approvals, Submission, and Important Labeling Changes for US Marketed Pharmaceuticals.</a> Hosp Pharm. 52, 306-307 (2013).</li><li>Baker, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Eteplirsen.">Eteplirsen.</a> Hosp Pharm. 52, 302-305 (2017).</li><li>Sicinski, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+basis+of+muscular+dystrophy+in+the+mdx+mouse:+a+point+mutation.">The molecular basis of muscular dystrophy in the mdx mouse: a point mutation.</a> Science. 244, 1578-1580 (1989).</li><li>Xu, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-mediated+Genome+Editing+Restores+Dystrophin+Expression+and+Function+in+mdx+Mice.">CRISPR-mediated Genome Editing Restores Dystrophin Expression and Function in mdx Mice.</a> Molecular therapy : the journal of the American Society of Gene Therapy. 24, 564-569 (2016).</li><li>El Refaey, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Vivo+Genome+Editing+Restores+Dystrophin+Expression+and+Cardiac+Function+in+Dystrophic+Mice.">In Vivo Genome Editing Restores Dystrophin Expression and Cardiac Function in Dystrophic Mice.</a> Circ Res. 121, 923-929 (2017).</li><li>Tabebordbar, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+gene+editing+in+dystrophic+mouse+muscle+and+muscle+stem+cells.">In vivo gene editing in dystrophic mouse muscle and muscle stem cells.</a> Science. 351, 407-411 (2016).</li><li>Pozsgai, E. R., Griffin, D. A., Heller, K. N., Mendell, J. R., Rodino-Klapac, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=beta-Sarcoglycan+gene+transfer+decreases+fibrosis+and+restores+force+in+LGMD2E+mice.">beta-Sarcoglycan gene transfer decreases fibrosis and restores force in LGMD2E mice.</a> Gene therapy. 23, 57-66 (2016).</li><li>Chicoine, L. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasmapheresis+eliminates+the+negative+impact+of+AAV+antibodies+on+microdystrophin+gene+expression+following+vascular+delivery.">Plasmapheresis eliminates the negative impact of AAV antibodies on microdystrophin gene expression following vascular delivery.</a> Mol Ther. 22, 338-347 (2014).</li><li>Chicoine, L. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vascular+delivery+of+rAAVrh74.MCK.GALGT2+to+the+gastrocnemius+muscle+of+the+rhesus+macaque+stimulates+the+expression+of+dystrophin+and+laminin+alpha2+surrogates.">Vascular delivery of rAAVrh74.MCK.GALGT2 to the gastrocnemius muscle of the rhesus macaque stimulates the expression of dystrophin and laminin alpha2 surrogates.</a> Mol Ther. 22, 713-724 (2014).</li><li>Vouillot, L., Thelie, A., Pollet, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+T7E1+and+surveyor+mismatch+cleavage+assays+to+detect+mutations+triggered+by+engineered+nucleases.">Comparison of T7E1 and surveyor mismatch cleavage assays to detect mutations triggered by engineered nucleases.</a> G3. 5, 407-415 (2015).</li><li>Tsai, S. Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GUIDE-seq+enables+genome-wide+profiling+of+off-target+cleavage+by+CRISPR-Cas+nucleases.">GUIDE-seq enables genome-wide profiling of off-target cleavage by CRISPR-Cas nucleases.</a> Nat Biotechnol. 33, 187-197 (2015).</li></ol>

No conflict of interest exists.

In this protocol, we detail all the steps necessary to achieve in vivo cardiac gene editing in postnatal mice using rAAVrh.74-mediated delivery of SaCas9 and two gRNAs. As previously noted, this approach can be used to restore dystrophin expression in dystrophic mice as described in our work27, but it could also enable rapid reverse genetics studies of cardiac-related genes in mice without the lengthy process of the traditional knockout approach to generate and breed knockout mouse models.
In order to achieve high gene editing efficiency in the target tissue, there are several critical steps to keep in mind: 1) the efficacy of the SaCas9/gRNA to induce the deletion of targeted genomic DNA needs to be validated using appropriate cell lines; 2) it is very crucial to select a proper AAV serotype that can mediate a high level of gene transduction into the target tissue and 3) determine the optimal delivery route of AAV vectors for gene transfer to the desired tissue.
In the current protocol, the designed SaCas9/gRNAs were packaged into AAVrh.74 rather than previously reported AAV8 and AAV9 to edit Dmd gene12,28. AAVrh.74 exhibits about 93% homology to AAV829 and has been shown to be non-pathogenic and effective in transducing skeletal muscle following isolated limb delivery29,30,31. In this protocol, we use retro-orbital and intraperitoneal injection of rh.74 into neonatal mice for cardiac gene transfer. We found that the neonate administration of rAAVrh.74 is highly efficient for the restoration of dystrophin expression in about 30-40% of cardiomyocytes in the mice receiving a high dosage of rAAVrh.74 (1 x 1012 vg). Interestingly, we found that the skeletal muscle dystrophin expression was not effectively rescued. This is likely due to the low skeletal muscle tropism of rh.74 serotype when administered via intravenous or intraperitoneal injection, although previous studies showed that isolated limb delivery of rAAVrh.74 can effectively transduce mouse and monkey skeletal muscle29,30,31. Also, when the rAAVrh.74 was administered into adult mice, we observed very low efficiency in restoring dystrophin expression. It would be interesting to determine the minimum dosage which is required to achieve the highest dystrophin rescue. Furthermore, other serotypes and delivery methods can be tested and compared for achieving optimal cardiac gene editing.
Successful deletion of a large genomic DNA piece requires simultaneous delivery of two gRNAs. We found it is not necessary to make two separate rAAV preparations for delivering two gRNAs. In this protocol, we simply mixed the two gRNA plasmids in an equal amount during transfection for rAAV production, and this combined production of rAAV was found to be effective in delivering both gRNAs. This combined approach is, therefore, cost- and labor-saving and recommended when simultaneous delivery of two gRNAs are required.
In many cases, it may be necessary to analyze the gene editing efficiency by genetic approaches when a good antibody is not available for the target gene product. However, it is technically challenging to accurately quantify the gene editing efficacy with two gRNAs targeting the same locus since the gene editing products would include target sequence deletion, target sequence inversion, and small indels at only one target site. Instead, it is more meaningful and feasible to quantify the efficiency of the desired targeted sequence deletion as in our case where the reduction of the transcripts containing exons 21-23 can be quantified by real-time RT-PCR.
In this protocol, we also describe the use of T7E1 assay and computational prediction to analyze the potential off-target activity. For the assay to work well, it is necessary to use a high-fidelity DNA polymerase. Also, it is always a good idea to prepare for a negative control experiment (e.g. control DNA products amplified from the cells/tissues without gene editing, and treated the same way as the test samples) and a positive control experiment (e.g. a known sample with well-characterized gene editing). However, it is of note that the detection limit of the T7E1 assay is about 5%32, and thus it may not be detectable by the T7E1 assay if the off-target activity is below 5%. GUIDE-seq33 can be used to unbiasedly analyze the off-target activity of the SaCas9/gRNA-mediated gene editing. The identified off-target sites from T7E1 assay, computational prediction and/or GUIDE-seq approaches can further be quantified for indel frequencies following in vivo gene editing by high-throughput sequencing.
Taken together, we have provided an optimized cardiac gene editing approach using rAAVrh.74. This established protocol can be further tested for therapeutic applications and reverse genetic studies.

The clustered, regularly interspaced, short palindromic repeat (CRISPR) technology represents the most recent advancement in genome engineering and has revolutionized the current practice of genetics in cells and organisms. CRISPR-based genome editing utilizes a single guide RNA (gRNA) to direct a CRISPR-associated endonuclease such as CRISPR-associated protein 9 (Cas9) and Cpf1 to a genomic DNA target that is complementary in sequence to the protospacer encoded by the gRNA with a specific protospacer adjacent motif (PAM)1,2. The PAM varies depending on the bacterial species of the Cas9 or Cpf1 gene. The most commonly used Cas9 nuclease derived from Streptococcus pyogenes (SpCas9) recognizes a PAM sequence of NGG that is found directly downstream of the target sequence in the genomic DNA, on the non-target strand. At the target site, the Cas9 and Cpf1 proteins generate a double-strand break (DSB), which is then repaired via intrinsic cellular DNA repair mechanisms including non-homologous end joining (NHEJ) and homology-directed repair (HDR) pathways3,4. In the absence of a DNA template for homologous recombination, the DSB is primarily repaired by the error-prone NHEJ pathway, which can result in insertions or deletions (indels) of nucleotides causing frameshift mutations if the DSB were created in the coding region of a gene5,6. Thus, the CRISPR system has been widely used to engineer loss-of-function mutations in various cellular models and whole organisms, in order to investigate the function of a gene. Moreover, the catalytically inactive Cas9 and Cpf1 have been developed to transcriptionally and epigenetically modulate the expression of target genes7,8.
More recently, both SpCas9 and SaCas9 (derived from Staphylococcus aureus) have been packaged into recombinant adeno-associated virus (rAAV) vectors for postnatal gene correction in the animal model of human diseases, particularly, Duchenne muscular dystrophy (DMD)9,10,11,12,13,14,15. DMD is a fatal X-linked recessive disease caused by mutations in the DMD gene, which encodes dystrophin protein16,17, affecting approximately one in 3500 male births according to newborn screening18,19. It is characterized by progressive muscle weakness and wasting. The DMD patients usually lose the ability to walk between 10 and 12 years of age and die of respiratory and/or cardiac failure by the age of 20-30 years20. Notably, cardiomyopathy develops in &#62;90% of DMD patients and represents the leading cause of death in DMD patients21,22. Although Deflazacort (an anti-inflammation drug) and Eteplirsen (an exon skipping medicine for skipping exon 51) have recently been approved for DMD by Food and Drug Administration (FDA)23,24, none of these treatments correct the genetic defect at the genomic DNA level. The mdx mouse, which carries a point mutation at exon 23 of the dystrophin gene, has been widely used as a DMD model25. Furthermore, we previously demonstrated that the functional dystrophin expression was restored by in-frame deletion of the genomic DNA covering exons 21, 22 and 23 in skeletal muscles of mdx mice using intramuscular Ad-SpCas9/gRNA delivery9, and in the heart muscles of mdx/utrophin+/- mice using intravenous and intraperitoneal rAAVrh.74-SaCas9/gRNA delivery26.
In this protocol, we describe in detail every step in postnatal cardiac gene editing to restore dystrophin in mdx/utrophin+/- mice using rAAVrh.74-SaCas9/gRNA vectors, from gRNA design to dystrophin analysis in the heart muscle sections.

<table>
	<tbody>
		<tr>
			<td>Alexa Fluor 555 goat anti-rabbit IgG</td>
			<td>Thermo Fisher Scientific</td>
			<td>A-21428</td>
			<td></td>
		</tr>
		<tr>
			<td>Benzonase Nuclease</td>
			<td>Sigma-Aldrich</td>
			<td>E1014</td>
			<td></td>
		</tr>
		<tr>
			<td>Bio Safety Cabinets</td>
			<td>Thermo Fisher Scientific</td>
			<td>1347</td>
			<td>1300 Series A2 Class II, Type A2</td>
		</tr>
		<tr>
			<td>BsaI</td>
			<td>New England BioLabs Inc</td>
			<td>RO535S</td>
			<td></td>
		</tr>
		<tr>
			<td>Competent cells</td>
			<td>Agilent Technologies</td>
			<td>200314</td>
			<td></td>
		</tr>
		<tr>
			<td>Cell culture dishes, 150mm</td>
			<td>Nest Scientific USA</td>
			<td>715001</td>
			<td></td>
		</tr>
		<tr>
			<td>Cryostat</td>
			<td>Leica Biosystems</td>
			<td></td>
			<td>Leica CM3050S</td>
		</tr>
		<tr>
			<td>DMEM</td>
			<td>Thermo Fisher Scientific</td>
			<td>MT10017CV</td>
			<td>Corning cellgro</td>
		</tr>
		<tr>
			<td>Dystrophin antibody</td>
			<td>Spring Bioscience</td>
			<td>E2660</td>
			<td></td>
		</tr>
		<tr>
			<td>Fast-Ion Midi Plasmdi Kits</td>
			<td>IBI Scientific</td>
			<td>IB47111</td>
			<td></td>
		</tr>
		<tr>
			<td>FBS</td>
			<td>Thermo Fisher Scientific</td>
			<td>26-140-079</td>
			<td></td>
		</tr>
		<tr>
			<td>Filter Unit, 0.45&#956;m</td>
			<td>Thermo Fisher Scientific</td>
			<td>166-0045</td>
			<td></td>
		</tr>
		<tr>
			<td>GoTaq Master Mixes</td>
			<td>Promega</td>
			<td>M7122</td>
			<td></td>
		</tr>
		<tr>
			<td>High-speed plasmid mini kit</td>
			<td>IBI Scientific</td>
			<td>IB47102</td>
			<td></td>
		</tr>
		<tr>
			<td>Horse serum</td>
			<td>Abcam</td>
			<td>ab139501</td>
			<td></td>
		</tr>
		<tr>
			<td>Isotemp 2239 Water Bath</td>
			<td>Thermo Fisher Scientific</td>
			<td>15-460-11Q</td>
			<td></td>
		</tr>
		<tr>
			<td>Isotemp Heat Block</td>
			<td>Thermo Fisher Scientific</td>
			<td>11-718</td>
			<td></td>
		</tr>
		<tr>
			<td>Inverted confocal microscope</td>
			<td>Carl Zeiss Microscopy, LLC</td>
			<td></td>
			<td>LSM 780</td>
		</tr>
		<tr>
			<td>LightCycler 480 instrument</td>
			<td>Roche</td>
			<td>5015243001</td>
			<td>LightCycler 480 Instrument II</td>
		</tr>
		<tr>
			<td>Large Capacity Centrifuge</td>
			<td>Thermo Fisher Scientific</td>
			<td>46-910</td>
			<td>Thermo Scientific Sorvall RC 6 Plus</td>
		</tr>
		<tr>
			<td>Microcentrifuge</td>
			<td>Thermo Fisher Scientific</td>
			<td>75002445</td>
			<td>Sorvall Legend Micro 21R</td>
		</tr>
		<tr>
			<td>Nanodrop spectrophotometers</td>
			<td>Thermo Scientific</td>
			<td>ND2000CLAPTOP</td>
			<td>NanoDrop&#8482; 2000/2000c</td>
		</tr>
		<tr>
			<td>Oligos for i20-F</td>
			<td>Integrated DNA Technologies</td>
			<td></td>
			<td>CACCgGGCGTTGAAATTCTCATTAC</td>
		</tr>
		<tr>
			<td>Oligos for i20-R</td>
			<td>Integrated DNA Technologies</td>
			<td></td>
			<td>AAAC GTAATGAGAATTTCAACGCCc;</td>
		</tr>
		<tr>
			<td>Oligos for i23-F</td>
			<td>Integrated DNA Technologies</td>
			<td></td>
			<td>CACCgCACCGATGAGAGGGAAAGGTC</td>
		</tr>
		<tr>
			<td>Oligos for i23-R</td>
			<td>Integrated DNA Technologies</td>
			<td></td>
			<td>GACCTTTCCCTCTCATCGGTGc</td>
		</tr>
		<tr>
			<td>Oligos</td>
			<td>Integrated DNA Technologies</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>OptiPrep Density Gradient Medium</td>
			<td>Sigma-Aldrich</td>
			<td>D1556-250ML</td>
			<td></td>
		</tr>
		<tr>
			<td>OptiMEM</td>
			<td>Thermo Fisher Scientific</td>
			<td>31985070</td>
			<td></td>
		</tr>
		<tr>
			<td>PEG8000</td>
			<td>Sigma-Aldrich</td>
			<td>89510-1kg-F</td>
			<td></td>
		</tr>
		<tr>
			<td>Polyethylenimine</td>
			<td>Polysciences</td>
			<td>23966</td>
			<td></td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>Sigma-Aldrich</td>
			<td>P2308</td>
			<td></td>
		</tr>
		<tr>
			<td>Quick-Seal centrifuge tube</td>
			<td>Beckman Coulter Inc</td>
			<td>342414</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAquick Gel Extraction kit</td>
			<td>Qiagen</td>
			<td>28704</td>
			<td></td>
		</tr>
		<tr>
			<td>Radiant SYBR Green Hi-ROX qPCR Kits</td>
			<td>Alkali Scientific</td>
			<td>QS2005</td>
			<td></td>
		</tr>
		<tr>
			<td>RevertAid RT Reverse Transcription Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>K1691</td>
			<td></td>
		</tr>
		<tr>
			<td>Rotor</td>
			<td>Beckman Coulter Inc</td>
			<td>337922</td>
			<td>Type 70Ti</td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>New England BioLabs Inc</td>
			<td>M0202S</td>
			<td></td>
		</tr>
		<tr>
			<td>Thermal Cycler</td>
			<td>Bio-rad</td>
			<td>1861096</td>
			<td></td>
		</tr>
		<tr>
			<td>TRIzol Reagent</td>
			<td>Thermo Fisher Scientific</td>
			<td>15596026</td>
			<td></td>
		</tr>
		<tr>
			<td>Ultracentrifuge</td>
			<td>Beckman Coulter Inc</td>
			<td>8043-30-1192</td>
			<td>Optima le-80k</td>
		</tr>
		<tr>
			<td>Ultra centrifugal filter unit</td>
			<td>MilliporeSigma</td>
			<td>UFC510096</td>
			<td></td>
		</tr>
		<tr>
			<td>VECTASHIELD Mounting Medium with DAPI</td>
			<td>Vector Laboratories, Inc</td>
			<td>H-1200</td>
			<td></td>
		</tr>
	</tbody>
</table>

adeno-associated virus-mediated delivery of crispr for cardiac gene editing in mice

The clustered, regularly interspaced, short, palindromic repeat (CRISPR) system has greatly facilitated genome engineering in both cultured cells and living organisms from a wide variety of species. The CRISPR technology has also been explored as novel therapeutics for a number of human diseases. Proof-of-concept data are highly encouraging as exemplified by recent studies that demonstrate the feasibility and efficacy of gene editing-based therapeutic approach for Duchenne muscular dystrophy (DMD) using a murine model. In particular, intravenous and intraperitoneal injection of the recombinant adeno-associated virus (rAAV) serotype rh.74 (rAAVrh.74) has enabled efficient cardiac delivery of the Staphylococcus aureus CRISPR-associated protein 9 (SaCas9) and two guide RNAs (gRNA) to delete a genomic region with a mutant codon in exon 23 of mouse Dmd gene. This same approach can also be used to knock out the gene-of-interest and study their cardiac function in postnatal mice when the gRNA is designed to target the coding region of the gene. In this protocol, we show in detail how to engineer rAAVrh.74-CRISPR vector and how to achieve highly efficient cardiac delivery in neonatal mice.

The efficacy of the gRNAs to induce the deletion of the target genomic DNA region should be evaluated in cell cultures before packaging into rAAV for in vivo studies. To this end, the gRNAs and SaCas9-expressing constructs were electroporated into C2C12 cells and the genomic DNA was analyzed by PCR with the primers flanking the target sites (Figure 1). A PCR product of ~500 bp indicates successful deletion of the target genomic DNA resulting from gene editing while the control cells should not yield a band due to the large size of the genomic DNA.
Once the efficacy of the gRNAs has been confirmed in cell cultures, they can be packaged into rAAVrh.74 or other serotypes (such as AAV6, 8 or 9, all showing robust cardiac gene delivery) by using the three plasmids co-transfection into AAV293 cells. We found that it is not necessary to make two individual rAAV preparation for the two gRNAs, instead, we mixed the two gRNA constructs in an equal molar ratio and produced a single rAAV preparation. The rAAV viral particles were purified using density gradient ultracentrifugation and the purity was analyzed by SDS-PAGE. The highly purified rAAV preparation would yield only three bands corresponding to the capsid proteins VP1, VP2, and VP3, respectively, on SDS-PAGE as shown in Figure 2.
The purified rAAVrh.74 viral particles were injected into day 1-3 neonates of mdx/utrophin+/- mice via retro-orbital or intraperitoneal injection. We found both methods worked well for cardiac delivery of the rAAVrh.74-CRISPR. The injected mice can be analyzed for dystrophin expression by immunofluorescence staining (Figure 3) at 10 weeks of age.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57560/57560fig1.jpg" /> 
Figure 1: Validation of the gRNAs for SaCas9-mediated gene editing in C2C12 cells. The representative agarose gel electrophoresis showed the PCR products of genomic DNA extracted from electroporated C2C12 with or without SaCas9/gRNAs. The arrow indicates the PCR product resulted from gene editing. Gapdh served as a reference. <a href="/files/ftp_upload/57560/57560fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57560/57560fig2.jpg" /> 
Figure 2: Analysis of rAAVrh.74 particles by SDS-PAGE. Purified rAAVrh.74 viral particles run on SDS-PAGE showed three bands, corresponding to the three capsid proteins of AAV, VP1 (87 kDa), VP2 (72 kDa) and VP3 (62 kDa), respectively. The presence of only these 3 bands indicates the high purity of the rAAV preparation without contaminating other cellular proteins. <a href="/files/ftp_upload/57560/57560fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57560/57560fig3.jpg" /> 
Figure 3: Immunofluorescence staining of the heart sections from mdx/utrophin+/- mice at 10 weeks following AAV-SaCas9/gRNAs treatment. The representative immunofluorescence images showed the expression of dystrophin (red) and caveolin-3 (green) in the heart sections of WT, mdx/utrophin+/- and mdx/utrophin+/- mice treated with 1 x 1012 vg AAV-SaCas9/gRNA systemically. DAPI was used to label the nuclei (blue). Scale bar: 100 &#181;m. <a href="/files/ftp_upload/57560/57560fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Adeno-Associated Virus-Mediated Delivery of CRISPR for Cardiac Gene Editing in Mice at JoVE.com

Adeno-Associated Virus-Mediated Delivery of CRISPR for Cardiac Gene Editing in Mice

Here we provide a detailed protocol to carry out in vivo cardiac gene editing in mice using recombinant Adeno-Associated Virus(rAAV)-mediated delivery of CRISPR. This protocol offers a promising therapeutic strategy to treat dystrophic cardiomyopathy in Duchenne muscular dystrophy and can be used to generate cardiac-specific knockout in postnatal mice.

The clustered, regularly interspaced, short, palindromic repeat (CRISPR) system has greatly facilitated genome engineering in both cultured cells and ...

adeno-associated-virus-mediated-delivery-crispr-for-cardiac-gene

Nanyang Technological University

Research

JoVE Journal

Medicine

8.1K Views.  Ohio State University Wexner Medical Center. Here we provide a detailed protocol to carry out in vivo cardiac gene editing in mice using recombinant Adeno-Associated Virus(rAAV)-mediated delivery of CRISPR. This protocol offers a promising therapeutic strategy to treat dystrophic cardiomyopathy in Duchenne muscular dystrophy and can be used to generate cardiac-specific knockout in postnatal mice.

Video: Adeno-Associated Virus-Mediated Delivery of CRISPR for Cardiac Gene Editing in Mice

High-Efficiency Transduction of Liver Cancer Cells by Recombinant Adeno-Associated Virus Serotype 3 Vectors

Recombinant vectors based on a non-pathogenic human parvovirus, the adeno-associated virus 2 (AAV2) have been developed, and are currently in use in a number of gene therapy clinical trials. More recently, a number of additional AAV serotypes have also been isolated, which have been shown to exhibit selective tissue-tropism in various small and large animal models1. Of the 10 most commonly used AAV serotypes, AAV3 is by far the least efficient in transducing cells and tissues in vitro as well as in vivo.
However, in our recently published studies, we have documented that AAV3 vectors transduce human liver cancer - hepatoblastoma (HB) and hepatocellular carcinoma (HCC) - cell lines extremely efficiently because AAV3 utilizes human hepatocyte growth factor receptor as a cellular co-receptor for binding and entry in these cells2,3.
In this article, we describe the steps required to achieve high-efficiency transduction of human liver cancer cells by recombinant AAV3 vectors carrying a reporter gene. The use of recombinant AAV3 vectors carrying a therapeutic gene may eventually lead to the potential gene therapy of liver cancers in humans.

In this article, we describe the identification of the adeno-associated virus serotype 3 (AAV3) as the most efficient vector for targeting human liver cancer cells.

Recombinant vectors based on a non-pathogenic human parvovirus, the adeno-associated virus 2 (AAV2) have been developed, and are currently in use in a ...

Establishment and Propagation of Human Retinoblastoma Tumors in Immune Deficient Mice

Culturing retinoblastoma tumor cells in defined stem cell media gives rise to primary tumorspheres that can be grown and maintained for only a limited time. These cultured tumorspheres may exhibit markedly different cellular phenotypes when compared to the original tumors. Demonstration that cultured cells have the capability of forming new tumors is important to ensure that cultured cells model the biology of the original tumor. 
Here we present a protocol for propagating human retinoblastoma tumors in vivo using Rag2-/- immune deficient mice. Cultured human retinoblastoma tumorspheres of low passage or cells obtained from freshly harvested human retinoblastoma tumors injected directly into the vitreous cavity of murine eyes form tumors within 2-4 weeks. These tumors can be harvested and either further passaged into murine eyes in vivo or grown as tumorspheres in vitro. Propagation has been successfully carried out for at least three passages thus establishing a continuing source of human retinoblastoma tissue for further experimentation. 
Wesley S. Bond and Lalita Wadhwa are co-first authors.

A method is described to propagate human retinoblastoma tumors in mice. Tumor cells are directly injected into the eyes of immune deficient mice. Secondary tumors have been successfully established using both cells directly harvested from human tumors and cultured tumorspheres.

Culturing retinoblastoma tumor cells in defined stem cell media gives rise to primary tumorspheres that can be grown and maintained for only a limited ...

Cardiac Stress Test Induced by Dobutamine and Monitored by Cardiac Catheterization in Mice

Dobutamine is a &beta;-adrenergic agonist with an affinity higher for receptor expressed in the heart (&beta;1) than for receptors expressed in the arteries (&beta;2). When systemically administered, it increases cardiac demand. Thus, dobutamine unmasks abnormal rhythm or ischemic areas potentially at risk of infarction. 
Monitoring of heart function during a cardiac stress test can be performed by either ecocardiography or cardiac catheterization. The latter is an invasive but more accurate and informative technique that the former.
Cardiac stress test induced by dobutamine and monitored by cardiac catheterization accomplished as described here allows, in a single experiment, the measurement of the following hemodynamic parameters: heart rate (HR), systolic pressure, diastolic pressure, end-diastolic pressure, maximal positive pressure development (dP/dtmax) and maximal negative pressure development (dP/dtmin), at baseline conditions and under increasing doses of dobutamine.
As expected, in normal mice we observed a dobutamine dose-related increase in HR, dP/dtmax and dP/dtmin. Moreover, at the highest dose tested (12 ng/g/min) the cardiac decompensation of high fat diet-induced obese mice was unmasked.

We describe the protocol to perform a cardiac stress test induced by dobutamine and monitored by cardiac catheterization in normal mice. Also we show its application to unmask subclinical cardiac disease in high fat diet-induced obese mice.

Dobutamine is a &beta;-adrenergic agonist with an affinity higher for receptor expressed in the heart (&beta;1) than for receptors expressed in the ...

An Orthotopic Bladder Cancer Model for Gene Delivery Studies

Bladder cancer is the second most common cancer of the urogenital tract and novel therapeutic approaches that can reduce recurrence and progression are needed. The tumor microenvironment can significantly influence tumor development and therapy response. It is therefore often desirable to grow tumor cells in the organ from which they originated. This protocol describes an orthotopic model of bladder cancer, in which MB49 murine bladder carcinoma cells are instilled into the bladder via catheterization. Successful tumor cell implantation in this model requires disruption of the protective glycosaminoglycan layer, which can be accomplished by physical or chemical means. In our protocol the bladder is treated with trypsin prior to cell instillation. Catheterization of the bladder can also be used to deliver therapeutics once the tumors are established. This protocol describes the delivery of an adenoviral construct that expresses a luciferase reporter gene. While our protocol has been optimized for short-term studies and focuses on gene delivery, the methodology of mouse bladder catheterization has broad applications.

Implantation of cancer cells into the organ of origin can serve as a useful preclinical model to evaluate novel therapies. MB49 bladder carcinoma cells can be grown within the bladder following intravesical instillation. This protocol demonstrates catheterization of the mouse bladder for the purpose of tumor implantation and adenoviral delivery.

Bladder cancer is the second most common cancer of the urogenital tract and novel therapeutic approaches that can reduce recurrence and progression are ...

Bile Duct Ligation in Mice: Induction of Inflammatory Liver Injury and Fibrosis by Obstructive Cholestasis

In most vertebrates, the liver produces bile that is necessary to emulsify absorbed fats and enable the digestion of lipids in the small intestine as well as to excrete bilirubin and other metabolic products. In the liver, the experimental obstruction of the extrahepatic biliary system initiates a complex cascade of pathological events that leads to cholestasis and inflammation resulting in a strong fibrotic reaction originating from the periportal fields. Therefore, surgical ligation of the common bile duct has become the most commonly used model to induce obstructive cholestatic injury in rodents and to study the molecular and cellular events that underlie these pathophysiological mechanisms induced by inappropriate bile flow. In recent years, different surgical techniques have been described that either allow reconnection or reanastomosis after bile duct ligation (BDL), e.g., partial BDL, or other microsurgical methods for specific research questions. However, the most frequently used model is the complete obstruction of the common bile duct that induces a strong fibrotic response after 21 to 28 days. The mortality rate can be high due to infectious complications or technical inaccuracies. Here we provide a detailed surgical procedure for the BDL model in mice that induce a highly reproducible fibrotic response in accordance to the 3R rule for animal welfare postulated by Russel and Burch in 1959.

Disruption of bile flow results in severe inflammatory cholestatic liver injury with a characteristic time-dependent sequence of morphological alterations. Here we present a protocol for the surgical ligation of the common bile duct in mice that allows to induce a strong fibrotic response after 21 to 28 days.

In most vertebrates, the liver produces bile that is necessary to emulsify absorbed fats and enable the digestion of lipids in the small intestine as well ...

Using Adeno-associated Virus as a Tool to Study Retinal Barriers in Disease

M&#252;ller cells are the principal glial cells of the retina. Their end-feet form the limits of the retina at the outer and inner limiting membranes (ILM), and in conjunction with astrocytes, pericytes and endothelial cells they establish the blood-retinal barrier (BRB). BRB limits material transport between the bloodstream and the retina while the ILM acts as a basement membrane that defines histologically the border between the retina and the vitreous cavity. Labeling M&#252;ller cells is particularly relevant to study the physical state of the retinal barriers, as these cells are an integral part of the BRB and ILM. Both BRB and ILM are frequently altered in retinal disease and are responsible for disease symptoms.
There are several well-established methods to study the integrity of the BRB, such as the Evans blue assay or fluorescein angiography. However these methods do not provide information on the extent of BRB permeability to larger molecules, in nanometer range. Furthermore, they do not provide information on the state of other retinal barriers such as the ILM. To study BRB permeability alongside retinal ILM, we used an AAV based method that provides information on permeability of BRB to larger molecules while indicating the state of the ILM and extracellular matrix proteins in disease states. Two AAV variants are useful for such study: AAV5 and ShH10. AAV5&#160;has a natural tropism for photoreceptors but it cannot get across to the outer retina when administered into the vitreous when the ILM is intact (i.e., in wild-type retinas). ShH10 has a strong tropism towards glial cells and will selectively label M&#252;ller glia in both healthy and diseased retinas. ShH10 provides more efficient gene delivery in retinas where ILM is compromised. These viral tools coupled with immunohistochemistry and blood-DNA analysis shed light onto the state of retinal barriers in disease.

To investigate the blood-retinal barrier permeability and the inner limiting membrane integrity in animal models of retinal disease, we used several adeno-associated virus (AAV) variants as tools to label retinal neurons and glia. Virus mediated reporter gene expression is then used as an indicator of retinal barrier permeability.

M&#252;ller cells are the principal glial cells of the retina. Their end-feet form the limits of the retina at the outer and inner limiting membranes ...

Development of an Alpha-synuclein Based Rat Model for Parkinson's Disease via Stereotactic Injection of a Recombinant Adeno-associated Viral Vector

In order to study the molecular pathways of Parkinson&#39;s disease (PD) and to develop novel therapeutic strategies, scientific investigators rely on animal models. The identification of PD-associated genes has led to the development of genetic PD models. Most transgenic &#945;-SYN mouse models develop gradual &#945;-SYN pathology but fail to display clear dopaminergic cell loss and dopamine-dependent behavioral deficits. This hurdle was overcome by direct targeting of the substantia nigra with viral vectors overexpressing PD-associated genes. Local gene delivery using viral vectors provides an attractive way to express transgenes in the central nervous system. Specific brain regions can be targeted (e.g. the substantia nigra), expression can be induced in the adult setting and high expression levels can be achieved. Further, different vector systems based on various viruses can be used. The protocol outlines all crucial steps to perform a viral vector injection in the substantia nigra of the rat to develop a viral vector-based alpha-synuclein animal model for Parkinson&#39;s disease.

This manuscript describes how viral vector-mediated local gene delivery provides an attractive way to express transgenes in the central nervous system. The protocol outlines all crucial steps to perform a viral vector injection in the substantia nigra of the rat to develop a viral vector-based animal model for Parkinson's disease.

In order to study the molecular pathways of Parkinson&#39;s disease (PD) and to develop novel therapeutic strategies, scientific investigators rely on ...

Myocardial Infarction in Neonatal Mice, A Model of Cardiac Regeneration

Myocardial infarction induced by coronary artery ligation has been used in many animal models as a tool to study the mechanisms of cardiac repair and regeneration, and to define new targets for therapeutics. For decades, models of complete heart regeneration existed in amphibians and fish, but a mammalian counterpart was not available. The recent discovery of a postnatal window during which mice possess regenerative capabilities has led to the establishment of a mammalian model of cardiac regeneration. A surgical model of mammalian cardiac regeneration in the neonatal mouse is presented herein. Briefly, postnatal day 1 (P1) mice are anesthetized by isoflurane and placed on an ice pad to induce hypothermia. After the chest is opened, and the left anterior descending coronary artery (LAD) is visualized, a suture is placed around the LAD to inflict myocardial ischemia in the left ventricle. The surgical procedure takes 10-15 min. Visualizing the coronary artery is crucial for accurate suture placement and reproducibility. Myocardial infarction and cardiac dysfunction are confirmed by triphenyl-tetrazolium chloride (TTC) staining and echocardiography, respectively. Complete regeneration 21 days post myocardial infarction is verified by histology. This protocol can be used to as a tool to elucidate mechanisms of mammalian cardiac regeneration after myocardial infarction.

This protocol describes a highly reproducible model of cardiac regeneration by surgical induction of myocardial infarction in the left ventricle of postnatal day 1 mice. The method involves induction of hypothermic anesthesia and ligation of the left anterior descending coronary artery.

Myocardial infarction induced by coronary artery ligation has been used in many animal models as a tool to study the mechanisms of cardiac repair and ...

Posterior Semicircular Canal Approach for Inner Ear Gene Delivery in Neonatal Mouse

Inner ear gene therapy offers great promise as a potential treatment for hearing loss and dizziness. One of the critical determinants of the success of inner ear gene therapy is to find a delivery method which results in consistent transduction efficiency of targeted cell types while minimizing hearing loss. In this study, we describe the posterior semicircular canal approach as a viable method for inner ear gene delivery in neonatal mice. We show that gene delivery through the posterior semicircular canal is able to perfuse the entire inner ear. The easy anatomic identification of the posterior semicircular canal, as well as minimal manipulation of the temporal bone required, make this surgical approach an attractive option for inner ear gene delivery.

In this study, we describe the posterior semicircular canal approach as a reliable method for inner ear gene delivery in neonatal mice. We show that gene delivery through the posterior semicircular canal is able to perfuse the entire inner ear.

Inner ear gene therapy offers great promise as a potential treatment for hearing loss and dizziness. One of the critical determinants of the success of ...

Isolation of Atrial Myocytes from Adult Mice

The electrophysiological properties of atrial myocytes importantly affect overall cardiac function. Alterations in the underlying ionic currents responsible for the action potential can cause pro-arrhythmic substrates that underlie arrhythmias, such as atrial fibrillation, which are highly prevalent in many conditions and disease states. Isolating adult mouse atrial cardiomyocytes for use in patch-clamp experiments has greatly advanced our knowledge and understanding of the cellular electrophysiology in the healthy atrial myocardium and in the setting of atrial pathophysiology. In addition, studies using genetic mouse models have elucidated the role of a vast array of proteins in regulating atrial electrophysiology. Here we provide a detailed protocol for the isolation of cardiomyocytes from the atrial appendages of adult mice using a combination of enzymatic digestion and mechanical dissociation of these tissues. This approach consistently and reliably yields isolated atrial cardiomyocytes that can then be used to characterize cellular electrophysiology by measuring action potentials and ionic currents in patch-clamp experiments under a number of experimental conditions.

This protocol is used to isolate single atrial cardiomyocytes from the adult mouse heart using a chunk digestion approach. This approach is used to isolate right or left atrial myocytes that can be used to characterize atrial myocyte electrophysiology in patch-clamp studies.