Name: preparation of raav9 to overexpress or knockdown genes in mouse hearts
Uploaded: 2016-12-17T13:00:00.000+00:00
Duration: 11 min 11 s
Description: Watch this Scientific Journal Video about Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts at JoVE.com

We thank Dr. Zaffar Haque for careful reading of the manuscript. We thank Drs. Masaharu Kataoka and Gengze Wu for discussions and help. Work in the Wang lab is supported by the American Heart Association, Muscular Dystrophy Association, and NIH (HL085635, HL116919, HL125925).

All described steps were performed under protocols approved by the Biosafety Committee and the Institutional Animal Care and Use Committee of Boston Children&#39;s Hospital. Boston Children&#39;s Hospital has pathogen-free mouse facilities with regulated light/dark cycles and climate control. Veterinary and animal care staff change cages and ensure the health of the mice. The facilities are AAALAC certified and have active Animal Welfare Assurance certification (AAALAC Accreditation Granted on 2/24/1992. Animal Welfare Assurance number: A3303-01). Mice were euthanized by CO2 delivered from a compressed gas source. Tissue samples were collected after confirming that heart rate, movement, and breathing of animals had ceased. Neonatal rodents are resistant to CO2 euthanasia and were euthanized by decapitation using sharp scissors. These methods are consistent with the recommendations of the Panel on Euthanasia of the American Veterinary Medical Association.
1. Generation of rAAV9 Constructs by Cloning a cDNA or shRNA Expression Cassette into the Plasmid Backbone
NOTE: The rAAV9 plasmid, containing the inverted terminal repeats (ITRs) of AAV2, used for gene overexpression has been modified to harbor the chicken TNNT2 promoter (rAAV9.cTNT), which enables cardiomyocyte-specific expression of transduced genes25,26,29. Unique NheI and KpnI sites have been introduced into the plasmid, downstream of the promoter. The cDNA fragments encoding the genes of interest can be cloned into the rAAV9 backbone using these two restriction sites25,26,29. Here, as an example, the rAAV9 vector for overexpression of the GFP gene in mouse hearts was generated. The resulting plasmid contains the cTNT::GFP cassette flanked by two ITR sites (Figure 1). rAAV9.U6::shRNA constructs were used for gene knockdown25. Design shRNAs using online shRNA design servers. rAAV9.U6::shRNA can be generated either by annealing and ligating DNA oligos-containing shRNA sequences into the restriction enzyme-digested rAAV9 vectors harboring the U6 promoter, or by long-range PCR and intra-molecular Gibson assembly-based &#34;seamless&#34; construction30. The resulting plasmid should contain the U6-shRNA cassette flanked by two ITR sites (Figure 2). Here, as an example, the rAAV9.U6::shRNA vector was constructed to knockdown Trbp mRNA (Trbp shRNA sequence: GCAGTGATGGATATGCATCTTCTCGAGAAGATGCATATCCATCACTCG). A scramble shRNA was used as a negative control (CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG).
<ol>
	<li>Clone the cDNA or shRNA expression cassette into the rAAV9 plasmid backbone. Transform the DNA into competent E. Coli cells25. 
	NOTE: Use stbl2 or stbl3 E. coli cells for rAAV9 DNA transformation to minimize undesired ITR recombination.</li>
	<li>Pick up the positive clone from the transformed E. Coli cells. Amplify the culture in 500 ml of Lilly-Barnett medium and extract the rAAV9 plasmid from the bacterial cells25-30. 
	NOTE: Midi/Maxi prep the rAAV9 plasmid to obtain a high amount of DNA (&#62; 100 &#181;g). Before generating the virus, always analyze the sequence integrity of the AAV plasmids by restriction digestion and agarose gel electrophoresis, as previously described (http://www.vvf.uzh.ch/cloningservice/11bpdeletion/itrintegrity.html).&#160;</li>
</ol>
2. Transfection of HEK293 Cells with rAAV9 Plasmids
<ol>
	<li>Prepare 1 &#181;g/&#181;l of linear polyethylenimine (PEI) solution. Dissolve PEI powder in endotoxin-free dH2O that has been heated to 70-80 &#176;C. Aftercooling down to RT, neutralize the solution to pH 7.0 with 1 M HCl. Filter sterilize (0.22 &#181;m) the solution. Aliquot the 1 &#181;g/&#181;l PEI stock solution (1,400 &#181;l/tube) and store the solution at -20 &#176;C.</li>
	<li>Culture HEK293 cells in Dulbecco&#39;s Modified Eagle Medium (DMEM) with 10% Fetal Bovine Serum (FBS) and 1% penicillin/streptomycin. Culture the cells in a 37 &#176;C incubator with 5 &#177; 0.5% carbon dioxide (CO2).</li>
	<li>At day 0, plate HEK293 cells in ten 150-mm dishes 18-20 hr before transfection by splitting &#62; 90% confluent cells in a 1:2 dilution. 
	NOTE: At day 1, the cells should reach 90% confluence.</li>
	<li>At day 1, transfect HEK293 cells with the rAAV9 plasmid (e.g., rAAV9.cTNT::GFP or rAAV6.U6::shRNA constructs), Ad-Helper plasmid, and AAV-Rep/Cap plasmid using PEI25,26,29.
	<ol>
		<li>For 10 dishes of cells at 90% confluence, mix 70 &#181;g of AAV-Rep/Cap plasmid, 70 &#181;g pf rAAV9 plasmid, and 200 &#181;g of Ad-Helper plasmid in a 50-ml centrifuge tube.</li>
		<li>If the cells are less confluent, adjust the DNA amount proportionally. For instance, if the cells are at 75% confluent, reduce the DNA amount proportionally (75/90 of the amount shown in step 2.4.1): mix 70 x 75/90 = 58.3 &#181;g of AAV-Rep/Cap plasmid, 70 x 75/90 = 58.3 &#181;g of rAAV9 plasmid, and 200 x 75/90 = 166.7 &#181;g of Ad-Helper plasmid in a 50-ml centrifuge tube.</li>
		<li>Add 49 ml of RT DMEM (without FBS) to the 50-ml tube and mix well.</li>
		<li>Add 1,360 &#181;l of PEI solution to make the PEI:DNA ratio (v/w) be 4:1. Mix well. Incubate at RT for 15 - 30 min.</li>
		<li>Add 5 ml of the mixture prepared in step 2.4.4 to each 150-mm dish (50 ml of the mixture for ten 150-mm dishes).</li>
	</ol>
	</li>
	<li>Culture the cells in a 37 &#176;C incubator with 5 &#177;0.5% CO2 for 60-72 hr.</li>
</ol>
3. Harvest of Transfected HEK293 Cells and Purification of rAAV9 Vectors
<ol>
	<li>Harvest the cells 60-72 hr after transfection. Dislodge and suspend the cells in the dishes by pipetting up and down with the culture medium. Transfer all the cell suspensions to sterile 50-ml tubes.</li>
	<li>Centrifuge the cells at 500 x g for 5 min. Resuspend the cell pellet with 5 ml of PBS in each tube and combine all the cell suspensions into one 50 ml tube.</li>
	<li>Centrifuge the cells at 500 x g for 5 min. Discard the supernatant. At this step, store the cell pellet at -80 &#176;C or immediately purify the AAV from the pellet, as described in steps 3.4-3.15.</li>
	<li>Prepare the lysis buffer: 150 mM NaCl and 20 mM Tris-HCl, pH 8.0. Filter sterilize (0.22 &#181;M). Store the buffer at 4 &#176;C.</li>
	<li>Resuspend the pellet with 10 ml of lysis buffer.</li>
	<li>Freeze the lysate at -80 &#176;C or in the dry ice/ethanol bath, then thaw it at 37 &#176;C. Vortex for 1 min. Freeze and thaw the lysate 3 times.</li>
	<li>Add MgCl2 solution to the thawed lysate (make the final concentration of MgCl2 in the lysate be 1 mM). Add the nuclease to a final concentration of 250 U/ml. Incubate at 37 &#176;C for 15 min to dissolve the DNA/protein aggregation. 
	NOTE: If the DNA/protein aggregation does not get dissolved after nuclease or endonuclease treatment, dounce homogenize the lysates 20 times.</li>
	<li>Centrifuge the sample at 4,800 x g for 20 min at 4 &#176;C. Collect the supernatant.</li>
	<li>Meanwhile, prepare the Iodixanol gradient solution:
	<ol>
		<li>Prepare the 17% of the gradient solution by mixing 5 ml of 10x PBS, 0.05 ml of 1 M MgCl2, 0.125 ml of 1 M KCl, 10 ml of 5 M NaCl, and 12.5 ml ofdensity gradient medium. Adjust the total volume to 50 ml using H2O.</li>
		<li>Prepare the 25% solution by mixing 5 ml of 10x PBS, 0.05 ml of 1 M MgCl2, 0.125 ml of 1 M KCl, 20 ml of density gradient medium, and 0.2 ml of 0.5% (w/v) Phenol Red. Adjust the total volume to 50 ml using H2O.</li>
		<li>Prepare the 40% solution by mixing 5 ml of 10x PBS, 0.05 ml of 1 M MgCl2, 0.125 ml of 1 M KCl, and 33.3 ml of density gradient medium. Adjust the total volume to 50 ml using H2O.</li>
		<li>Prepare the 60% solution by mixing 0.05 ml of 1 M MgCl2, 0.125 ml of 1 M KCl, 50 ml of density gradient medium, and 0.1 ml of 0.5% (w/v) Phenol Red.</li>
	</ol>
	</li>
	<li>With a needle and syringe, load the Iodixanol gradient solution into the polypropylene tube in the order of 5 ml of 17%, 5 ml of 25%, 5 ml of 40% and 5 ml of 60%, starting from the bottom. Load all the lysate obtained from step 3.8 (14-16 ml) on top of the gradient. The gradient, listed from the bottom to top, is 60%, 40%, 25%, 17%, and the lysate layer. Fill the tube with lysis buffer and cover it with the cork.</li>
	<li>Centrifuge at 185,000 x g for 90 min at 16 &#176;C.</li>
	<li>Harvest the viral fraction (40% layer) with a syringe. Insert the needle (21 gauge) into the intersection between the 40% and 60% fractions, only aspirating the 40% layer. 
	NOTE: Avoid aspirating ANY of the 25% layer.</li>
	<li>Mix the viral fraction with sterilized polyoxyethylene-polyoxypropylene block copolymer PBS solution (10% polyoxyethylene-polyoxypropylene block copolymer stock 1:10,000 diluted in PBS) up to a total volume of 15 ml. Load the mixture into the filter tube (cut-off MW = 100 kD). Centrifuge at 2,000 x g for 30 min at 4 &#176;C.</li>
	<li>Discard the solution at the bottom. Refill the filter tube with polyoxyethylene-polyoxypropylene block copolymer PBS solution to a total volume of 15 ml. Centrifuge at 2,000 x g for 20 min at 4 &#176;C. Repeat this step two more times. Collect the purified rAAV9 virus (the fraction above the filter).</li>
	<li>Transfer the purified rAAV9 in the filter tube to 1.7-mL tubes. Aliquot the purified rAAV9 (100 - 400 &#181;l/tube, depending on the volume and titer of the AAV) and store the virus at -80 &#176;C. 
	NOTE: Avoid repeated freeze-thaws.</li>
</ol>
4. Measurement of the Titer of rAAV9
<ol>
	<li>Prepare standard DNA samples.
	<ol>
		<li>Design specific and efficient PCR primers for rAAV9 vectors and optimize the PCR condition. 
		NOTE: The primers used in this study are &#34;Forward: TCGGGATAAAAGCAGTCTGG; Reverse: TCGGACGGAGATACGTGAGT&#34;. The PCR reaction was performed with the following conditions: initial denaturing at 95 &#176;C for 3 min; 35 cycles of 95 &#176;C for 20 sec, 60 &#176;C for 15 sec, and 72 &#176;C for 10 sec; and the final extension at 72 &#176;C for 10 min. However, the optimized primers and PCR conditions are plasmid-specific, as the inset sequence in the rAAV9 vector may affect the specificity and efficiency of PCR31.</li>
		<li>Perform the PCR reaction with the conditions shown in step 4.1.1. Purify the PCR product with a gel extraction kit.</li>
		<li>Measure the concentration of purified DNA using a spectrophotometer. Calculate the concentration in DNA molecular numbers based on the molecular weight/length of the PCR product.
		<ol>
			<li>Calculate the molecular concentration using the following equation: molecular concentration (DNA molecules or fragments/ml) = 6.23 x 1023 mol-1 x Con. x 10-6/MW. Note: (6.23 x 1023 mol-1 is Avagadro&#39;s Number; Con.: DNA concentration in &#181;g/ml; MW.: molecular weight in g/mol). For instance, if the obtained concentration of the PCR product is 100 &#181;g/ml and its length is 200 bp, the molecular weight of the double-stranded DNA is 2 x 200 x 310 = 124,000 (the average molecular weight of each nucleotide in the single-stranded DNA is about 310 g/mol). The molecular concentration (DNA molecules/ml) = 6.23 X 1023 mol-1 x 100 &#181;g/ml x 10-6 /124,000 g/mol = 5.18 x 1014 DNA molecules/ml.</li>
			<li>Perform a dilution series of the DNA fragment and prepare the standard samples, with concentrations of 1013 molecules/ml, 1012 molecules/ml, 1011 molecules/ml, 1010 molecules/ml, 109 molecules/ml, 108 molecules/ml, and 107 molecules/ml. Use 1 &#181;l of solution for each standard sample for the quantitative PCR (qPCR, in step 4.6).</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Mix 5 &#181;l of purified rAAV9 solution with 5 &#181;l of 10x DNAse buffer, 1 &#181;l of DNAse (10,000 U/ml), and 39 &#181;l of ddH2O. The total volume should be 50 &#181;l.</li>
	<li>Incubate the vial at 37 &#176;C for 30 min to remove residual unpackaged plasmid DNA.</li>
	<li>Inactivate the DNAse at 95 &#176;C for 10 min. Cool down the solution, add 44 &#181;l of H2O, 5 &#181;l of 10x DNAse buffer, and 1 &#181;l of Proteinase K stock (10 mg/ml).</li>
	<li>Incubate the solution at 50 &#176;C for 2 hr. Stop the reaction and inactivate the Proteinase K at 95 &#176;C for 10 min.</li>
	<li>Use 1 &#181;l of the sample for the quantitative PCR (qPCR) assay. Calculate the titer.
	<ol>
		<li>Run quantitative PCR (qPCR) with the primers designed in step 4.1.1 using the samples from step 4.1.4 (standard samples) and from step 4.5 (samples to be measured).
		<ol>
			<li>For each reaction, mix 10 &#181;l of 2x Green master mix (containing Taq polymerase, dNTP mix, buffer, MgCl2, and Green dye), 0.5 &#181;l of forward primer (5 &#181;M), 0.5 &#181;l of reverse primer (5 &#181;M), 8 &#181;l of H2O, and 1 &#181;l of the sample to be measured. Perform qPCR with the following conditions: hold the samples at 50 &#176;C for 2 min and 95 &#176;C for 10 min; perform 40 cycles at 95 &#176;C for 15 sec and at 60 &#176;C for 1 min; for the melt stage, incubate the samples at 95 &#176;C for 30 sec and 60 &#176;C for 15 sec. Generate the standard curve based on the CT numbers of the standard samples (Figure 3).</li>
		</ol>
		</li>
		<li>Calculate the molecular concentration/titer of the AAV sample against the standard curve. The rAAV9 has a single-strand DNA genome, so the molecular concentration will be 2-fold higher than the calculated value (2x power (10, y), Figure 3B). In addition, the titer of the purified rAAV9 will be 20-fold higher than what is obtained from the calculation due to the 1:20 dilution of the virus in DNAse and Proteinase K reactions (5 &#181;l in 100 &#181;l total).</li>
	</ol>
	</li>
</ol>
5. rAAV9 Injection in Neonatal Mice and Gene Expression Assays in the Heart
<ol>
	<li>Prepare rAAV9 working solutions in polyoxyethylene-polyoxypropylene block copolymer PBS solution. Make the virus stock with the titers of 1-7 x 1012 particles/ml. 
	NOTE: Deliver 50-70 &#181;l of rAAV9 solution into each postnatal day 0.5-1.5 mouse by subcutaneous injection. To achieve efficient gene overexpression or knockdown, it is recommended to perform a pilot test for each study to optimize the amount of injected AAV. Use the same amount of rAAV9.cTNT::Luc or rAAV9.U6::scramble controls for each study to minimize the bias. 
	NOTE: We used 1-1.5 x 1011 particles/pup for overexpression and 2.5 - 5 x 1011 particles/pup for knockdown in postnatal day 0.5-1.5 mice).</li>
	<li>Treat neonatal mice with rAAV9 at P0.5-P2.5 by subcutaneous injection.
	<ol>
		<li>Pre-fill a 29G1/2, 0.33 x 12.7 mm insulin syringe with the rAAV9 solution. Be careful to remove air bubbles.</li>
		<li>Hold the&#160;cryo-anesthetized pup in one hand with thumb and forefinger. Prior to injection, swipe the back skin of the pup with a swab stick saturated with 70% isopropyl alcohol to maintain the sterile condition. Insert the syringe needle into the anterior-dorsal subcutis of the animal at an angle of 5 to 10&#176;. Inject 50-70 &#181;l of the rAAV9 solution using the insulin syringe. 
		NOTE: rAAV9 can also be delivered to the mouse via intraperitoneal or intravenous injection26,27. Efficient expression of the delivered genes in the heart can be obtained. However, intraperitoneal injection sometimes may result in leaky expression in the liver. After injection, the condition of the pups was monitored every day.</li>
	</ol>
	</li>
	<li>The level of gene expression in the heart can be monitored with qPCR, immunofluorescence, or western blot (representative results are shown in Figures 4 and 5)25,26. 
	NOTE: Mice were euthanized by CO2 delivered from a compressed gas source. Tissue samples were collected after confirming that heart rate, movement, and breathing of the animals had ceased. Neonatal rodents are resistant to CO2 euthanasia and were euthanized by decapitation using sharp scissors. The method is consistent with the recommendations of the Panel on Euthanasia of the American Veterinary Medical Association.</li>
</ol>

<ol>
	<li>Primrose, S. B., Twyman, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Principles of gene manipulation and genomics. , (2013).</li><li>Doudna, J. A., Charpentier, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+new+frontier+of+genome+engineering+with+CRISPR-Cas9.">The new frontier of genome engineering with CRISPR-Cas9.</a> Science. 346, 1258096 (2014).</li><li>Gaj, T., Gersbach, C. A., Barbas, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ZFN,+TALEN,+and+CRISPR/Cas-based+methods+for+genome+engineering.">ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering.</a> Trends Biotechnol. 31, 397-405 (2013).</li><li>Hsu, P. D., Lander, E. S., Zhang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+applications+of+CRISPR-Cas9+for+genome+engineering.">Development and applications of CRISPR-Cas9 for genome engineering.</a> Cell. 157, 1262-1278 (2014).</li><li>Sander, J. D., Joung, J. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas+systems+for+editing,+regulating+and+targeting+genomes.">CRISPR-Cas systems for editing, regulating and targeting genomes.</a> Nat. Biotechnol. 32, 347-355 (2014).</li><li>Szulc, J., Wiznerowicz, M., Sauvain, M. -. O., Trono, D., Aebischer, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+versatile+tool+for+conditional+gene+expression+and+knockdown.">A versatile tool for conditional gene expression and knockdown.</a> Nat. Methods. 3, 109-116 (2006).</li><li>Nimesh, S., Halappanavar, S., Kaushik, N. K., Kumar, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+Gene+Delivery+Systems.">Advances in Gene Delivery Systems.</a> BioMed Res. Int. 2015, 610342 (2015).</li><li>Kamimura, K., Suda, T., Zhang, G., Liu, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+gene+delivery+systems.">Advances in gene delivery systems.</a> Pharm. Med. 25, 293-306 (2011).</li><li>Thomas, C. E., Ehrhardt, A., Kay, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progress+and+problems+with+the+use+of+viral+vectors+for+gene+therapy.">Progress and problems with the use of viral vectors for gene therapy.</a> Nat. Rev. Genet. 4, 346-358 (2003).</li><li>Giacca, M., Zacchigna, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-mediated+gene+delivery+for+human+gene+therapy.">Virus-mediated gene delivery for human gene therapy.</a> J. Control Release. 161, 377-388 (2012).</li><li>Witlox, M., Lamfers, M., Wuisman, P., Curiel, D., Siegal, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolving+gene+therapy+approaches+for+osteosarcoma+using+viral+vectors:+review.">Evolving gene therapy approaches for osteosarcoma using viral vectors: review.</a> Bone. 40, 797-812 (2007).</li><li>De Miguel, M. P., Cheng, L., Holland, E. C., Federspiel, M. J., Donovan, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+the+c-Kit+signaling+pathway+in+mouse+primordial+germ+cells+by+retroviral-mediated+gene+transfer.">Dissection of the c-Kit signaling pathway in mouse primordial germ cells by retroviral-mediated gene transfer.</a> Proc. Natl. Acad. Sci. USA. 99, 10458-10463 (2002).</li><li>Nagano, M., Shinohara, T., Avarbock, M. R., Brinster, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retrovirus-mediated+gene+delivery+into+male+germ+line+stem+cells.">Retrovirus-mediated gene delivery into male germ line stem cells.</a> FEBS Lett. 475, 7-10 (2000).</li><li>Scharfmann, R., Axelrod, J. H., Verma, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+in+vivo+expression+of+retrovirus-mediated+gene+transfer+in+mouse+fibroblast+implants.">Long-term in vivo expression of retrovirus-mediated gene transfer in mouse fibroblast implants.</a> Proc. Natl. Acad. Sci. USA. 88, 4626-4630 (1991).</li><li>Katz, R. A., Greger, J. G., Skalka, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+cell+cycle+status+on+early+events+in+retroviral+replication.">Effects of cell cycle status on early events in retroviral replication.</a> J. Cell. Biochem. 94, 880-889 (2005).</li><li>Escors, D., Breckpot, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lentiviral+vectors+in+gene+therapy:+their+current+status+and+future+potential.">Lentiviral vectors in gene therapy: their current status and future potential.</a> Arch. Immunol. Ther. Exp. 58, 107-119 (2010).</li><li>M&#225;trai, J., Chuah, M. K., VandenDriessche, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+advances+in+lentiviral+vector+development+and+applications.">Recent advances in lentiviral vector development and applications.</a> Mol. Ther. 18, 477-490 (2010).</li><li>Miyazaki, Y., Miyake, A., Nomaguchi, M., Adachi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+dynamics+of+retroviral+genome+and+the+packaging.">Structural dynamics of retroviral genome and the packaging.</a> Front. Microbiol. 2, 1-9 (2011).</li><li>Douglas, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus-Mediated+Gene+Delivery.">Adenovirus-Mediated Gene Delivery.</a> Gene Delivery to Mammalian Cells: Volume 2: Viral Gene Transfer Techniques. , 3-14 (2004).</li><li>Armend&#225;riz-Borunda, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+first+generation+adenoviral+vectors+for+preclinical+protocols:+amplification,+purification+and+functional+titration.">Production of first generation adenoviral vectors for preclinical protocols: amplification, purification and functional titration.</a> J. Biosci. Bioeng. 112, 415-421 (2011).</li><li>Snyder, R. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adeno-associated+virus-mediated+gene+delivery.">Adeno-associated virus-mediated gene delivery.</a> J Gene Med. 1, 166-175 (1999).</li><li>Samulski, R. J., Muzyczka, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=AAV-mediated+gene+therapy+for+research+and+therapeutic+purposes.">AAV-mediated gene therapy for research and therapeutic purposes.</a> Annu. Rev. Virol. 1, 427-451 (2014).</li><li>Kaplitt, M. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+gene+transfer+in+porcine+myocardium+after+coronary+infusion+of+an+adeno-associated+virus+vector.">Long-term gene transfer in porcine myocardium after coronary infusion of an adeno-associated virus vector.</a> Ann. Thorac. Surg. 62, 1669-1676 (1996).</li><li>Kaspar, B. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Myocardial+gene+transfer+and+long-term+expression+following+intracoronary+delivery+of+adeno-associated+virus.">Myocardial gene transfer and long-term expression following intracoronary delivery of adeno-associated virus.</a> J. Gene. Med. 7, 316-324 (2005).</li><li>Ding, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trbp+regulates+heart+function+through+microRNA-mediated+Sox6+repression.">Trbp regulates heart function through microRNA-mediated Sox6 repression.</a> Nat. Genet. 47, 776-783 (2015).</li><li>Lin, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardiac-specific+YAP+activation+improves+cardiac+function+and+survival+in+an+experimental+murine+MI+model.">Cardiac-specific YAP activation improves cardiac function and survival in an experimental murine MI model.</a> Circ. Res. 115, 354-363 (2014).</li><li>Wahlquist, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+miR-25+improves+cardiac+contractility+in+the+failing+heart.">Inhibition of miR-25 improves cardiac contractility in the failing heart.</a> Nature. 508, 531-535 (2014).</li><li>Carroll, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mouse+model+for+adult+cardiac-specific+gene+deletion+with+CRISPR/Cas9.">A mouse model for adult cardiac-specific gene deletion with CRISPR/Cas9.</a> Proc. Natl. Acad. Sci. USA. 113, 338-343 (2016).</li><li>Jiang, J., Wakimoto, H., Seidman, J., Seidman, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allele-specific+silencing+of+mutant+Myh6+transcripts+in+mice+suppresses+hypertrophic+cardiomyopathy.">Allele-specific silencing of mutant Myh6 transcripts in mice suppresses hypertrophic cardiomyopathy.</a> Science. 342, 111-114 (2013).</li><li>Gibson, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+assembly+of+DNA+molecules+up+to+several+hundred+kilobases.">Enzymatic assembly of DNA molecules up to several hundred kilobases.</a> Nat. Methods. 6, 343-345 (2009).</li><li>Rychlik, W., Spencer, W., Rhoads, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+the+annealing+temperature+for+DNA+amplification+in+vitro.">Optimization of the annealing temperature for DNA amplification in vitro.</a> Nucleic Acids Res. 18, 6409-6412 (1990).</li><li>Allocca, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serotype-dependent+packaging+of+large+genes+in+adeno-associated+viral+vectors+results+in+effective+gene+delivery+in+mice.">Serotype-dependent packaging of large genes in adeno-associated viral vectors results in effective gene delivery in mice.</a> J. Clin. Invest. 118, 1955-1964 (2008).</li><li>Wu, Z., Yang, H., Colosi, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+genome+size+on+AAV+vector+packaging.">Effect of genome size on AAV vector packaging.</a> Mol. Ther. 18, 80-86 (2010).</li><li>Li, J., Sun, W., Wang, B., Xiao, X., Liu, X. -. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+trans-splicing+as+a+means+for+viral+vector-mediated+in+vivo+gene+therapy.">Protein trans-splicing as a means for viral vector-mediated in vivo gene therapy.</a> Hum. Gene Ther. 19, 958-964 (2008).</li><li>Piras, B. A., O'Connor, D. M., French, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systemic+delivery+of+shRNA+by+AAV9+provides+highly+efficient+knockdown+of+ubiquitously+expressed+GFP+in+mouse+heart,+but+not+liver.">Systemic delivery of shRNA by AAV9 provides highly efficient knockdown of ubiquitously expressed GFP in mouse heart, but not liver.</a> PLoS One. 8, e75894 (2013).</li><li>Lovric, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Terminal+differentiation+of+cardiac+and+skeletal+myocytes+induces+permissivity+to+AAV+transduction+by+relieving+inhibition+imposed+by+DNA+damage+response+proteins.">Terminal differentiation of cardiac and skeletal myocytes induces permissivity to AAV transduction by relieving inhibition imposed by DNA damage response proteins.</a> Mol. Ther. 20, 2087-2097 (2012).</li></ol>

The authors have nothing to disclose.

It is important to minimize undesired ITR recombination during plasmid construction. Before generating the virus, one must always monitor the ITR integrity of the AAV plasmids by using restriction digestion and agarose gel electrophoresis. It is impossible to obtain 100% intact plasmids, but the recombination ratio should be minimized as much as possible. Less than 20% is acceptable for successful rAAV9 packaging. Of note, culturing the bacteria at lower temperature (30 &#176;C) with a lower shaking speed (180-200 rpm) c...

A correction was made to the Authors section in: <a href="http://www.jove.com/video/54787">Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts</a>.
One of the authors names and affiliation was corrected from:
Jian-Ming Jiang3,4 
3 Department of Genetics, Harvard Medical School 
4 Howard Hughes Medical Institute
to:
Jianming Jiang5 
5 Department of Biochemistry, Yong Loo Lin School of Medicine, National University of Singapore

A correction was made to the Authors section in: <a href="http://www.jove.com/video/54787">Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts</a>.

Erratum: Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts

Controlling expression or activity of specific genes in various biological systems has become a valuable strategy in the study of gene function1. A direct means of accomplishing this goal is to manipulate nucleotide sequences and generate mutant alleles. Although making precise, targeted changes to the genome of living cells is still a time-consuming and labor-intensive practice, the development of the powerful TALEN and Crispr/Cas9 tools has opened a new era of genome editing2-5. A more routine laboratory method for gene manipulation has focused on the introduction of genetic materials (DNAs and RNAs containing coding sequences or siRNAs/shRNAs) into the cells to express or knockdown the gene(s) of interest1,6.
In many cases, the major bottleneck for gene manipulation is the delivery of DNA, RNA, or protein into the cells. With regard to in vitro studies, efficient transfection systems have been established in many cultured cell lines. However, in the mouse model in particular, in vivo gene delivery is more challenging. There are a series of extra- and intracellular barriers that need to be bypassed in order to achieve efficient cellular uptake of the exogenous reagents. Additional obstacles include the rapid clearance and the short duration of the delivered materials7,8. One strategy to circumvent these issues is to use viral vectors as &#34;carriers&#34; or &#34;vehicles&#34; for in vivo gene delivery. The naturally-evolved transduction properties of viruses allow the efficient delivery of a gene of interest into cells7,9,10. Numerous types of viral vectors have been developed and enable flexible in vivo gene manipulation in different cell types and organs in mice.
The most commonly-used viral systems include Retrovirus, Lentivirus, Adenovirus, and Adeno-associated virus (AAV)11. Retroviruses are single-stranded RNA viruses and can introduce their genetic material to the host cell genome in a stable manner during mitotic division, providing the potential for lifelong expression of the transduced genes in the target cells and organs12-14. However, many types of retroviruses only infect dividing cells, and their efficacy in non-dividing cells is very low15. This limits their utility for gene delivery. Lentivirus is a genus of the Retroviridae family. Different from other retroviruses, Lentivirus can infect both dividing and non-dividing cells and has been widely used for gene transfer into post-mitotic and highly-differentiated cells16. The life cycle of Lentivirus also involves the integration of vector DNA into the host genome. Thus, Lentivirus-mediated gene delivery enables stable and long-duration expression of the transduced genetic elements16-18. However, this feature may represent a double-edged sword in the use of these viruses to manipulate gene expression, as integration of vector DNA may lead to insertional mutagenesis in the host cells and can cause artefactual effects. Adenovirus is another widely-used gene delivery system. Unlike retroviruses and lentiviruses, Adenoviruses are non-integrated and do not interfere with the genomic integrity of host cells8,10,11,19. In addition, Adenoviruses can transfect DNA into many cell types, and infection is not dependent upon active cell division19. Another important characteristic of Adenoviruses is the ease of vector purification, as the viral vectors have the ability to be replicated19,20. However, the major caveat of this system is that Adenovirus infection can trigger strong immune responses in target cells and organs19, restricting its use in many investigations, particularly in gene therapy studies.
Compared with these different types of viral vectors, recombinant Adeno-associated virus (rAAV) appears to be the ideal gene delivery system21,22. It exhibits minimal immunogenicity and pathogenicity23,24. In addition, rAAV infects a broad range of cell types, including both dividing and non-dividing cells. In most cases, rAAV does not integrate into host genomes; thus, the risk of undesired genetic or genomic changes in the target cells is low22.
Recently, rAAV systems have been successfully used for the in vivo delivery of DNA encoding proteins, miRNAs, shRNAs, and Crispr-gRNAs into mouse cardiac muscle23,25-29. This methodology has facilitated fundamental investigations and gene therapy studies in the field of cardiovascular research. Here, the detailed procedure to generate rAAV9 vectors that efficiently overexpress or knockdown the genes of interest in mouse hearts was described. The protocol provides a simple and effective method of manipulating cardiac gene expression in murine experimental models.

<table><tbody><tr><td>Polyethylenimine, Linear (MW 25,000)</td><td>Polysciences, Inc.&amp;nbsp;</td><td>#23966-2</td><td></td></tr><tr><td>Tube, Polypropylene, 36.2 ml, 25 x 87 mm, (qty. 56)</td><td>Beckman Coulter, Inc</td><td># 362183</td><td></td></tr><tr><td>Nuclease, ultrapure</td><td>SIGMA</td><td>#E8263-25KU</td><td></td></tr><tr><td>Density Gradient Medium(Iodixanol)</td><td>SIGMA</td><td>#D1556-250ML</td><td></td></tr><tr><td>Centrifugal Filter Unit with Ultracel-100 membrane</td><td>EMD Millipore Corporation</td><td>#UFC910008</td><td></td></tr><tr><td>Laboratory pipetting needle with 90&amp;deg; blunt ends,gauge 14, L 6 in., nickel plated hub</td><td>SIGMA</td><td>#CAD7942-12EA</td><td></td></tr><tr><td>Poloxamer 188 solution (Pluronic&amp;reg; F-68 solution)</td><td>SIGMA</td><td>P5556-100ML</td><td></td></tr><tr><td>Proteinase K</td><td>SIGMA</td><td>3115828001</td><td></td></tr><tr><td>DNase I</td><td>Roche</td><td>10104159001</td><td></td></tr><tr><td>Centrifuge machine</td><td>Thermo Scientific</td><td>75004260</td><td></td></tr><tr><td>Centrifuge System</td><td>Beckman Coulter</td><td>363118</td><td></td></tr><tr><td>Ultracentrifuge</td><td>Beckman Coulter</td><td></td><td></td></tr><tr><td>DMEM medium</td><td>Fisher Scientific</td><td>SH30243FS</td><td></td></tr><tr><td>Fetal Bovine Serum&amp;nbsp;</td><td>Atlanta Biologicals&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;</td><td>S11150</td><td></td></tr><tr><td>rAAV9 vector</td><td>Penn Vector Core</td><td>P1967</td><td></td></tr></tbody></table>

preparation of raav9 to overexpress or knockdown genes in mouse hearts

Controlling the expression or activity of specific genes through the myocardial delivery of genetic materials in murine models permits the investigation of gene functions. Their therapeutic potential in the heart can also be determined. There are limited approaches for in vivo molecular intervention in the mouse heart. Recombinant adeno-associated virus (rAAV)-based genome engineering has been utilized as an essential tool for in vivo cardiac gene manipulation. The specific advantages of this technology include high efficiency, high specificity, low genomic integration rate, minimal immunogenicity, and minimal pathogenicity. Here, a detailed procedure to construct, package, and purify the rAAV9 vectors is described. Subcutaneous injection of rAAV9 into neonatal pups results in robust expression or efficient knockdown of the gene(s) of interest in the mouse heart, but not in the liver and other tissues. Using the cardiac-specific TnnT2 promoter, high expression of GFP gene in the heart was obtained. Additionally, target mRNA was inhibited in the heart when a rAAV9-U6-shRNA was utilized. Working knowledge of rAAV9 technology may be useful for cardiovascular investigations.

The strategies for rAAV9 construction of rAAV9.cTNT::GFP or rAAV9.U6::shRNA plasmids are shown in Figures 1 and 2, respectively. As the examples, the rAAV9 vector was generated to overexpress the GFP gene in mouse hearts. The resulting plasmid contains the cTNT::GFP cassette flanked by two ITR sites (Figure 1). The rAAV9.U6::shRNA vector was constructed to knockdown Trbp mRNA (Figure 2)
<p class="jove_content" fo:keep...

Watch this Scientific Journal Video about Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts at JoVE.com

Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts

In this manuscript, a method to prepare recombinant adeno-associated virus 9 (rAAV9) vectors to manipulate gene expression in the mouse heart is described.

Controlling the expression or activity of specific genes through the myocardial delivery of genetic materials in murine models permits the investigation ...

preparation-of-raav9-to-overexpress-or-knockdown-genes-in-mouse-hearts

Research

JoVE Journal

Genetics

12.7K Views.  Boston Children's Hospital. In this manuscript, a method to prepare recombinant adeno-associated virus 9 (rAAV9) vectors to manipulate gene expression in the mouse heart is described. 

Video: Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts

Delivery of Modified mRNA in a Myocardial Infarction Mouse Model

Myocardial infarction (MI) is a leading cause of morbidity and mortality in the Western world. In the past decade, gene therapy has become a promising treatment option for heart disease, owing to its efficiency and exceptional therapeutic effects. In an effort to repair the damaged tissue post-MI, various studies have employed DNA-based or viral gene therapy but have faced considerable hurdles due to the poor and uncontrolled expression of the delivered genes, edema, arrhythmia, and cardiac hypertrophy. Synthetic modified mRNA (modRNA) presents a novel gene therapy approach that offers high, transient, safe, nonimmunogenic, and controlled mRNA delivery to the heart tissue without any risk of genomic integration. Due to these remarkable characteristics combined with its bell-shaped pharmacokinetics in the heart, modRNA has become an attractive approach for the treatment of heart disease. However, to increase its effectiveness in vivo, a consistent and reliable delivery method needs to be followed. Hence, to maximize modRNA delivery efficiency and yield consistency in modRNA use for in vivo applications, an optimized method of preparation and delivery of modRNA intracardiac injection in a mouse MI model is presented. This protocol will make modRNA delivery more accessible for basic and translational research.

This protocol presents a simple and coherent way to transiently upregulate a gene of interest using modRNA after myocardial infarction in mice.

Myocardial infarction (MI) is a leading cause of morbidity and mortality in the Western world. In the past decade, gene therapy has become a promising ...

Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging

Cardiac myocytes isolated from adult hearts are widely accepted as a model somewhere half way between embryonic and neonatal muscle cells on one side and a working heart on the other. Thus, cardiomyocytes serve as good models for cardiac cellular physiology and pathophysiology, for pharmaceutical investigations as well as for the exploration of transgenic animal models. Here we describe a method of isolating the cells from the heart. Furthermore we show how a genetic manipulation on cardiac myocytes can be performed without breeding a transgenic animal: This is the combination of long term culture (1 week) and adenoviral gene transfer. The latter one is described from the construction of the virus to the transduction of the cells. It can be used for the expression of genetically encoded biosensors (GEBs), fluorescent fusion proteins, but also for protein over expression and down regulation, e.g. using RNAi. Here we provide an example for the expression of a fusion protein staining a subcellular structure (Golgi). Such protein expression can be visualized by confocal imaging of z-stacks for a 3D-reconstruction of subcellular structures. The protocol comprises state-of-the-art in cell culture, molecular biology and biophysics and thus provides an approach for exploring new horizons in cellular cardiology.

Adult cardiac myocytes are primary cells that can be isolated from animal hearts and cultured for several days. Within this culture period adenoviral gene transfer can be used to express genetically encoded biosensors (GEBs) or fluorescent fusion proteins. Both approaches allow cellular investigations by means of confocal microscopy.

Cardiac myocytes isolated from adult hearts are widely accepted as a model somewhere half way between embryonic and neonatal muscle cells on one side and ...

Biology

Electroporation-Based Transgenesis of Cardiac Cells in Mouse Hearts

An Efficient Transgenesis Approach for Gene Delivery in the Mouse Embryonic Heart

The mammalian heart is a complex organ formed during development via highly diverse populations of progenitor cells. The origin, timing of recruitment, and fate of these progenitors are vital for the proper development of this organ. The molecular mechanisms that govern the morphogenesis of the heart are essential for understanding the pathogenesis of congenital heart diseases and embryonic cardiac regeneration. Classical approaches to investigate these mechanisms employed the generation of transgenic mice to assess the function of specific genes during cardiac development. However, mouse transgenesis is a complex, time-consuming process that often cannot be performed to assess the role of specific genes during heart development. To address this, we have developed a protocol for efficient electroporation and culture of mouse embryonic hearts, enabling transient transgenesis to rapidly assess the effect of gain- or loss-of-function of genes involved in cardiac development. Using this methodology, we successfully overexpressed Meis1 in the embryonic heart, with a preference for epicardial cell transfection, demonstrating the capabilities of the technique.

Author Spotlight: Cardiac Cell Transgenesis for Rapid Gene Screening

This protocol presents a detailed methodological framework for electroporation-based transgenesis of cardiac cells in developing mouse hearts. The video assets provided here will facilitate learning of this versatile technique.

The mammalian heart is a complex organ formed during development via highly diverse populations of progenitor cells. The origin, timing of recruitment, ...

Developmental Biology

Adeno-Associated Virus-Mediated Delivery of CRISPR for Cardiac Gene Editing in Mice

The clustered, regularly interspaced, short, palindromic repeat (CRISPR) system has greatly facilitated genome engineering in both cultured cells and living organisms from a wide variety of species. The CRISPR technology has also been explored as novel therapeutics for a number of human diseases. Proof-of-concept data are highly encouraging as exemplified by recent studies that demonstrate the feasibility and efficacy of gene editing-based therapeutic approach for Duchenne muscular dystrophy (DMD) using a murine model. In particular, intravenous and intraperitoneal injection of the recombinant adeno-associated virus (rAAV) serotype rh.74 (rAAVrh.74) has enabled efficient cardiac delivery of the Staphylococcus aureus CRISPR-associated protein 9 (SaCas9) and two guide RNAs (gRNA) to delete a genomic region with a mutant codon in exon 23 of mouse Dmd gene. This same approach can also be used to knock out the gene-of-interest and study their cardiac function in postnatal mice when the gRNA is designed to target the coding region of the gene. In this protocol, we show in detail how to engineer rAAVrh.74-CRISPR vector and how to achieve highly efficient cardiac delivery in neonatal mice.

Here we provide a detailed protocol to carry out in vivo cardiac gene editing in mice using recombinant Adeno-Associated Virus(rAAV)-mediated delivery of CRISPR. This protocol offers a promising therapeutic strategy to treat dystrophic cardiomyopathy in Duchenne muscular dystrophy and can be used to generate cardiac-specific knockout in postnatal mice.

The clustered, regularly interspaced, short, palindromic repeat (CRISPR) system has greatly facilitated genome engineering in both cultured cells and ...

Medicine

Cell Labeling and Injection in Developing Embryonic Mouse Hearts

Testing the fate of embryonic or pluripotent stem cell-derivatives in in vitro protocols has led to controversial outcomes that do not necessarily reflect their in vivo potential. Preferably, these cells should be placed in a proper embryonic environment in order to acquire their definite phenotype. Furthermore, cell lineage tracing studies in the mouse after labeling cells with dyes or retroviral vectors has remained mostly limited to early stage mouse embryos with still poorly developed organs. To overcome these limitations, we designed standard and ultrasound-mediated microinjection protocols to inject various agents in targeted regions of the heart in mouse embryos at E9.5 and later stages of development. &#160;Embryonic explant or embryos are then cultured or left to further develop in utero. These agents include fluorescent dyes, virus, shRNAs, or stem cell-derived progenitor cells. Our approaches allow for preservation of the function of the organ while monitoring migration and fate of labeled and/or injected cells. These technologies can be extended to other organs and will be very helpful to address key biological questions in biology of development.

We describe a series of methods to inject dyes, DNA vectors, virus, and cells in order to monitor both cell fate and phenotype of endogenous and grafted cells derived from embryonic or pluripotent cells within mouse embryos at embryonic day (E)9.5 and later stages of development.

Testing the fate of embryonic or pluripotent stem cell-derivatives in in vitro protocols has led to controversial outcomes that do not necessarily reflect ...

In vitro Assessment of Cardiac Reprogramming by Measuring Cardiac Specific Calcium Flux with a GCaMP3 Reporter

Cardiac reprogramming has become a potentially promising therapy to repair a damaged heart. By introducing multiple transcription factors, including Mef2c, Gata4, Tbx5 (MGT), fibroblasts can be reprogrammed into induced cardiomyocytes (iCMs). These iCMs, when generated in situ in an infarcted heart, integrate electrically and mechanically with the surrounding myocardium, leading to a reduction in scar size and an improvement in heart function. Because of the relatively low reprogramming efficiency, purity, and quality of the iCMs, characterization of iCMs remains a challenge. The currently used methods in this field, including flow cytometry, immunocytochemistry, and qPCR, mainly focus on cardiac-specific gene and protein expression but not on the functional maturation of iCMs. Triggered by action potentials, the opening of voltage-gated calcium channels in cardiomyocytes leads to a rapid influx of calcium into the cell. Therefore, quantifying the rate of calcium influx is a promising method to evaluate cardiomyocyte function. Here, the protocol introduces a method to evaluate iCM function by calcium (Ca2+) flux. An &#945;MHC-Cre/Rosa26A-Flox-Stop-Flox-GCaMP3 mouse strain was established by crossing Tg(Myh6-cre)1Jmk/J (referred to as Myh6-Cre below) with Gt(ROSA)26Sortm38(CAG-GCaMP3)Hze/J (referred to as Rosa26A-Flox-Stop-Flox-GCaMP3 below) mice. Neonatal cardiac fibroblasts (NCFs) from P0-P2 neonatal mice were isolated and cultured in vitro, and a polycistronic construction of MGT was introduced to NCFs, which led to their reprogramming to iCMs. Because only successfully reprogrammed iCMs will express GCaMP3 reporter, the functional maturation of iCMs can be visually assessed by Ca2+ flux with fluorescence microscopy. Compared with un-reprogrammed NCFs, NCF-iCMs showed significant calcium transient flux and spontaneous contraction, similar to CMs. This protocol describes in detail the mouse strain establishment, isolation and selection of neonatal mice hearts, NCF isolation, production of retrovirus for cardiac reprogramming, iCM induction, the evaluation of iCM Ca2+ flux using our reporter line, and related statistical analysis and data presentation. It is expected that the methods described here will provide a valuable platform to assess the functional maturation of iCMs for cardiac reprogramming studies.

We describe here, the establishment and application of an Tg(Myh6-cre)1Jmk/J /Gt(ROSA)26Sortm38(CAG-GCaMP3)Hze/J (referred to as &#945;MHC-Cre/Rosa26A-Flox-Stop-Flox-GCaMP3 below) mouse reporter line for cardiac reprogramming assessment. Neonatal cardiac fibroblasts (NCFs) isolated from the mouse strain are converted into induced cardiomyocytes (iCMs), allowing for convenient and efficient evaluation of reprogramming efficiency and functional maturation of iCMs via calcium (Ca2+) flux.

Cardiac reprogramming has become a potentially promising therapy to repair a damaged heart. By introducing multiple transcription factors, including ...

Selective Gene Silencing in the Choroid Plexus

Targeted Knockdown of Genes in the Choroid Plexus

The choroid plexus (ChP) serves as a critical gateway for immune cell infiltration into the central nervous system (CNS) under both physiological and pathological conditions. Recent research has shown that regulating ChP activity may offer protection against CNS disorders. However, studying the biological function of the ChP without affecting other brain regions is challenging due to its delicate structure. This study presents a novel method for gene knockdown in ChP tissue using adeno-associated viruses (AAVs) or cyclization recombination enzyme (Cre) recombinase protein consisting of TAT sequence (CRE-TAT). The results demonstrate that after injecting AAV or CRE-TAT into the lateral ventricle, the fluorescence was exclusively concentrated in the ChP. Using this approach, the study successfully knocked down the adenosine A2A receptor (A2AR) in the ChP using RNA interference (RNAi) or Cre/locus of X-overP1 (Cre/LoxP) systems, and showed that this knockdown could alleviate the pathology of experimental autoimmune encephalomyelitis (EAE). This technique may have important implications for future research on the ChP's role in CNS disorders.

Author Spotlight: Insights and Innovations in Gene Expression Manipulation Techniques for Choroid Plexus Research 

Here, we describe a method to selectively alter gene expressions in the choroid plexus while avoiding any impact in other brain areas.

The choroid plexus (ChP) serves as a critical gateway for immune cell infiltration into the central nervous system (CNS) under both physiological and ...

Neuroscience

A Simple and Efficient Method for In Vivo Cardiac-specific Gene Manipulation by Intramyocardial Injection in Mice

Gene manipulation specifically in the heart significantly potentiate the investigation of cardiac disease pathomechanisms and their therapeutic potential. In vivo cardiac-specific gene delivery is commonly achieved by either systemic or local delivery. Systemic injection via tail vein is easy and efficient in manipulating cardiac gene expression by using recombinant adeno-associated virus 9 (AAV9). However, this method requires a relatively high amount of vector for efficient transduction, and may result in nontarget organ gene transduction. Here, we describe a simple, efficient, and time-saving method of intramyocardial injection for in vivo cardiac-specific gene manipulation in mice. Under anesthesia (without ventilation), the pectoral major and minor muscles were bluntly dissected, and the mouse heart was quickly exposed by manual externalization through a small incision at the fourth intercostal space. Subsequently, adenovirus encoding luciferase (Luc) and vitamin D receptor (VDR), or short hairpin RNA (shRNA) targeting VDR, was injected with a Hamilton syringe into the myocardium. Subsequent in vivo imaging demonstrated that luciferase was successfully overexpressed specifically in the heart. Moreover, Western blot analysis confirmed the successful overexpression or silencing of VDR in the mouse heart. Once mastered, this technique can be used for gene manipulation, as well as injection of cells or other materials such as nanogels in the mouse heart.

A Simple and Efficient Method for In Vivo Cardiac-specific Gene Manipulation by Intramyocardial Injection in Mice

Here we present a protocol for cardiac-specific gene manipulation in mice. Under anesthesia, the mouse hearts were externalized through the fourth intercostal space. Subsequently, adenoviruses encoding specific genes were injected with a syringe into the myocardium, followed by protein expression measurement via in vivo imaging and Western blot analysis.

Gene manipulation specifically in the heart significantly potentiate the investigation of cardiac disease pathomechanisms and their therapeutic potential. ...

Viral Transgene Expression in Rodent Hearts and the Assessment of Cardiac Arrhythmia Risk

Heart disease is the leading cause of morbidity and mortality worldwide. Due to the ease of handling&#160;and abundance of transgenic strains, rodents have become essential models for cardiovascular research. However, spontaneous lethal cardiac arrhythmias that often cause mortality in heart disease patients are rare in rodent models of heart disease. This is primarily due to the species differences in cardiac electrical properties between human&#160;and rodents and poses a challenge to the study of cardiac arrhythmias using rodents. This protocol describes an approach to enable efficient transgene expression in mouse and rat ventricular myocardium using echocardiography-guided intramuscular injections of recombinant virus (adenovirus and adeno-associated virus). This work also outlines a method to enable reliable assessment of cardiac susceptibility to arrhythmias using isolated, Langendorff-perfused mouse and rat hearts with both adrenergic and programmed electrical stimulations. These techniques are critical for studying heart rhythm disorders associated with adverse cardiac remodeling after injuries, such as myocardial infarction.

The present protocol describes methods for transgene expression in rat and mouse hearts by direct intramyocardial injection of the virus under echocardiography guidance. Methods for the assessment of the susceptibility of hearts to ventricular arrhythmias by the programmed electrical stimulation of isolated, Langendorff-perfused hearts are also explained here.

Heart disease is the leading cause of morbidity and mortality worldwide. Due to the ease of handling&#160;and abundance of transgenic strains, rodents ...

Generation of Brown Fat-Specific Knockout Mice Using a Combined Cre-LoxP, CRISPR-Cas9, and Adeno-Associated Virus Single-Guide RNA System

Brown adipose tissue (BAT) is an adipose depot specialized in energy dissipation that can also serve as an endocrine organ via the secretion of bioactive molecules. The creation of BAT-specific knockout mice is one of the most popular approaches for understanding the contribution of a gene of interest to BAT-mediated energy regulation. The conventional gene targeting strategy utilizing the Cre-LoxP system has been the principal approach to generate tissue-specific knockout mice. However, this approach is time-consuming and tedious. Here, we describe a protocol for the rapid and efficient knockout of a gene of interest in BAT using a combined Cre-LoxP, CRISPR-Cas9, and adeno-associated virus (AAV) single-guide RNA (sgRNA) system. The interscapular BAT is located in the deep layer between the muscles. Thus, the BAT must be exposed in order to inject the AAV precisely and directly into the BAT within the visual field. Appropriate surgical handling is crucial to prevent damage to the sympathetic nerves and vessels, such as the Sultzer's vein that connects to the BAT. To minimize tissue damage, there is a critical need to understand the three-dimensional anatomical location of the BAT and the surgical skills required in the technical steps. This protocol highlights the key technical procedures, including the design of sgRNAs targeting the gene of interest, the preparation of AAV-sgRNA particles, and the surgery for the direct microinjection of AAV into both BAT lobes for generating BAT-specific knockout mice, which can be broadly applied to study the biological functions of genes in BAT.

In this protocol, we describe the technical procedures to generate brown adipose tissue (BAT)-specific knockout mice leveraging a combined Cre-LoxP, CRISPR-Cas9, and adeno-associated virus (AAV) single-guide RNA (sgRNA) system. The described steps include the design of the sgRNAs, the preparation of the AAV-sgRNA particles, and the microinjection of AAV into the BAT lobes.

Brown adipose tissue (BAT) is an adipose depot specialized in energy dissipation that can also serve as an endocrine organ via the secretion of bioactive ...

Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

Delivery of Modified mRNA in a Myocardial Infarction Mouse Model

Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging

An Efficient Transgenesis Approach for Gene Delivery in the Mouse Embryonic Heart

Adeno-Associated Virus-Mediated Delivery of CRISPR for Cardiac Gene Editing in Mice

Cell Labeling and Injection in Developing Embryonic Mouse Hearts

In vitro Assessment of Cardiac Reprogramming by Measuring Cardiac Specific Calcium Flux with a GCaMP3 Reporter

Targeted Knockdown of Genes in the Choroid Plexus

A Simple and Efficient Method for In Vivo Cardiac-specific Gene Manipulation by Intramyocardial Injection in Mice

Viral Transgene Expression in Rodent Hearts and the Assessment of Cardiac Arrhythmia Risk

Generation of Brown Fat-Specific Knockout Mice Using a Combined Cre-LoxP, CRISPR-Cas9, and Adeno-Associated Virus Single-Guide RNA System