D.G. was supported by funding from the University of Texas Southwestern Medical Center&#39;s Endowed Scholars Program. The authors thank Michael Whitt (The University of Tennessee Health Science Center) and Sean Whelan (Harvard Medical School) for the provision of VSV-DsRed and VSV-LUC. The authors also thank Gary Luker (University of Michigan Medical School) for the kind gift of the VACV-FL-GFP strain.

1. General Lymantria dispar (LD652) Cell and Virus Culture
<ol>
	<li>LD652 cell culturing and plating
	<ol>
		<li>To culture L. dispar-derived LD652 cells, maintain a monolayer of cells in a growth medium (Table of Materials) incubated at 27 &#176;C under normal atmosphere. Maintain the cells in 10 cm tissue-culture-treated dishes and passage the cells upon reaching 80% confluency.</li>
		<li>To plate, dislodge adherent LD652 cells from the plate by pipetting the media repeatedly onto the monolayer (these cells do not require trypsinization to dislodge), and dilute the sample in growth media to an approximate density of 1 x 105 cells/mL. Pipette 1 mL of diluted culture/well of a 24-well plate. Seed a minimum of three replicate wells/treatment type for each time point (a maximum of eight treatments/plate).</li>
		<li>Allow the cells to settle for a minimum of 1 h.</li>
	</ol>
	</li>
	<li>Vaccinia virus preparation
	<ol>
		<li>To prepare the stocks of VACV, amplify the virus in HeLa cells20 or African Green Monkey kidney cells (BSC-1 or BSC-40 cells)20,21,22. 
		NOTE: VACV strain Western Reserve (VACV-WR) works well in the assays described here.</li>
		<li>Titrate the VACV strain via plaque assay on BSC-1 or BSC-40 cells20,22. 
		NOTE: All indicated VACV multiplicity of infection (MOI) described here for LD652 cell infections are based on titers obtained from BSC-40 plaque assays.</li>
	</ol>
	</li>
	<li>Vesicular stomatitis virus preparation 
	<ol>
		<li>To prepare VSV stocks, amplify the virus in BHK cells23.</li>
		<li>Titrate VSV by plaque assay on BSC-40 or BHK cell monolayers13,23. 
		NOTE: All VSV MOIs described here for LD652 cell infections are based on titers obtained from BSC-40 plaque assays.</li>
	</ol>
	</li>
</ol>
2. Fluorescence-based VSV Rescue Assay Using Co-infection and Live-cell Imaging
<ol>
	<li>Seeding and infection of LD652 cells 
	<ol>
		<li>Plate 40,000 LD652 cells/well of an 8-well chamber.</li>
		<li>For fluorescence-based live-cell imaging, use VSV strains encoding fluorescent proteins. The experiments presented here use VSV-DsRed17, a recombinant VSV strain that expresses free DsRed protein that is not fused to any other VSV protein. 
		NOTE: VSV infection of LD652 cells is not cytopathic by 96 hpi and, thus, the cell death is not a confounding factor when evaluating VSV replication within this time frame.</li>
		<li>Prepare VSV-DsRed and VACV-FL-GFP in a serum-free media (SFM; Table of Materials) at an MOI of 1 and 25, respectively. 
		NOTE: VACV-FL-GFP is a recombinant VACV strain that expresses a fusion between LUC and GFP24. Using an MOI of 25 or greater for VACV strains ensures that all LD652 cells are infected13. If using a different coinfecting virus, the MOI will have to be determined empirically by the user. Each infection treatment should be set up in duplicate wells and include mock-infected treatments in which only SFM is added to the cells.</li>
		<li>Incubate the cells in 0.2 mL of inoculum for 2 h at 27 &#176;C.</li>
		<li>Wash the cells with 0.5 mL/well of growth media.</li>
		<li>Incubate the cells in 25 &#956;M of cell viability dye (Table of Materials) in growth media for 45 min at 27 &#176;C.</li>
		<li>Aspirate the media and wash the wells 1x with 0.5 mL/well to remove excess dye.</li>
		<li>Maintain the cells in 0.3 mL/well of the growth media.</li>
	</ol>
	</li>
	<li>Live cell image capturing
	<ol>
		<li>Turn on a confocal microscope 30 min in advance and load an 8-well chamber dish. 
		NOTE: LD652 cells can be imaged at room temperatures ranging from 20&#8211;25 &#176;C, but for optimal conditions, the temperature of the room should be adjusted to 27 &#176;C.</li>
		<li>Set up the appropriate excitation/emission settings for each fluorescent marker protein to be imaged, as well as the phase contrast image settings.</li>
		<li>Adjust the laser intensity for each channel. 
		NOTE: This may require running a pilot experiment to determine the range of fluorescent signal intensities observed throughout the time course to be used in the final experiment.</li>
		<li>Using the 10X objective, capture the phase contrast and fluorescence images of each well every 1&#8211;5 h for the duration of the infection up to a desired time point (e.g., 48&#8211;72 hpi). 
		NOTE: It is important to capture multiple fields of view in each well to accurately estimate the infection rates throughout the culture.</li>
	</ol>
	</li>
	<li>Image analysis
	<ol>
		<li>Use image analysis software for automated image analysis of appropriate fluorescent channels (e.g., 405 nm, 488 nm, 568 nm).</li>
		<li>To calculate the percentage of cells that are infected, divide the total number of fluorescent cells indicating VSV infection (e.g., DsRed-positive cells for VSV-DsRed infections) by the total number of viable cells labeled by cell viability dye for each field of view across all treatments.</li>
	</ol>
	</li>
</ol>
3. General Viral Infection Protocol for Luminescence-based VSV Rescue Assays in LD652 Cells
<ol>
	<li>Preparation of inoculum
	<ol>
		<li>30 min prior to the infection, thaw the stocks of VSV-LUC16 (a recombinant VSV strain that expresses free firefly luciferase protein not fused to any other VSV protein). If assaying for VSV-LUC rescue during VACV coinfection, also thaw the VACV-WR virus on ice. 
		NOTE: Other viruses (besides VACV-WR) may rescue VSV-LUC during the coinfection, but this will have to be determined empirically by each user.</li>
		<li>Prepare the inoculum by diluting VSV-LUC in the presence or absence of VACV-WR into SFM such that an MOI of 10 and 25, respectively, is achieved when adding a total inoculum volume of 0.2 mL/well.</li>
	</ol>
	</li>
	<li>Infection of the cells
	<ol>
		<li>Aspirate mature LD652 media carefully to avoid disturbing the monolayer and inoculate with 0.2 mL of virus/well. This time is defined as 0 hpi. Add sterile SFM to additional wells to serve as &#8220;mock-infected&#8221; negative control treatments.</li>
		<li>Incubate the cells in inoculum for 2 h at 27 &#176;C.</li>
		<li>At 2 hpi, remove inoculum by aspiration and replace with 1 mL/well LD652 growth media.</li>
		<li>Allow the infection to proceed 24&#8211;72 hpi.</li>
	</ol>
	</li>
</ol>
4. Luciferase Assay
<ol>
	<li>Preparation of cell lysates
	<ol>
		<li>Carefully aspirate the supernatant and add 1 mL of Dulbecco&#39;s phosphate-buffered saline (DPBS)/well.</li>
		<li>Using the plunger of a 1 mL syringe, scrape the cells into DPBS.</li>
		<li>Transfer the cells to a microcentrifuge tube, and centrifuge at 400 x g for 20 min at 4 &#176;C.</li>
		<li>Meanwhile, prepare 1x dilution of 5x reporter lysis buffer (RLB) in sterile H2O.</li>
		<li>Following the centrifugation, aspirate the DPBS without disturbing the cell pellet.</li>
		<li>Resuspend each pellet in 150 &#181;L of 1x RLB.</li>
		<li>Freeze-thaw the samples 1x using a 5-min incubation in a -80 &#176;C freezer followed by a rapid thaw in a room temperature water bath. Store the lysates at -80 &#176;C until ready to analyze.</li>
	</ol>
	</li>
	<li>Luciferase assay
	<ol>
		<li>Thaw the lysates on ice.</li>
		<li>Pipette 20 &#956;L of lysate into a well of a solid black or white 96-well microplate.</li>
		<li>Add 100 &#956;L of luciferase assay reagent to each well.</li>
		<li>Immediately measure the light intensity using a luminometer (appropriate settings for specific luminometers will have to be determined empirically by the user).</li>
	</ol>
	</li>
	<li>Luciferase assay analysis 
	<ol>
		<li>Normalize LU signals for each treatment to LU readings obtained from control treatments (Representative Results). After at least three independent experiments have been performed, the mean LU obtained from each treatment/control group can be analyzed by appropriate statistical tests.</li>
	</ol>
	</li>
</ol>
5. Immunoblot
<ol>
	<li>Use lysates extracted for the LUC assays for SDS-PAGE and subsequent immunoblotting, using appropriate reagents and instrumentation.</li>
</ol>
6. Titer of VSV from LD652 Cell Cultures
<ol>
	<li>Plate LD652 cells according to step 1.1.</li>
	<li>Viral infect the cells according to step 3.</li>
	<li>At desired time points, collect the supernatants into sterile microcentrifuge tubes.</li>
	<li>Pellet the cells using 1,000 x g for 10 min at 4 &#176;C and transfer the supernatants to new tubes.</li>
	<li>Store the supernatants at -80 &#176;C or proceed with titration by plaque assay on BSC-40 cells. 
	NOTE: If titrating VSV from LD652 cell cultures that contained VACV, it is advisable to add 100 &#956;g/mL cytosine arabinoside (AraC) to the BSC-40 culture media within 2 hpi, to prevent residual VACV particles from forming plaques on BSC-40 monolayers13. AraC is a viral DNA polymerase inhibitor that blocks VACV DNA replication25 but does not affect VSV replication.</li>
</ol>
7. Variations of Luminescence-based VSV Rescue Assays in LD652 Cells: RNAi and Plasmid Transfection Experiments
<ol>
	<li>Preparation of dsRNA for RNAi-mediated knockdown of viral or host transcripts
	<ol>
		<li>Design gene-specific primers tailed at the 5&#8217; end with the T7 promoter sequence (TAATACGACTCACTATAGGG) to target either the coinfecting virus (e.g., VACV) or L. dispar mRNA transcripts of interest. These primers should produce a PCR product of 400&#8211;600 bp for effective RNAi-mediated knockdown. See Gammon et al.13 for primer sequences used below to knockdown VACV or L. dispar transcripts by dsRNA-mediated RNAi in LD652 cells. 
		NOTE: L. dispar mRNA transcripts can be identified from published L. dispar transcriptome databases26,27,28.</li>
		<li>Generate a DNA template via RT-PCR (cDNA synthesis: 1 cycle of 50 &#176;C for 30 min; PCR: 40 cycles of 94 &#176;C for 15 s, 50 &#176;C for 30 s, and 68 &#176;C for 45 s each).</li>
		<li>Purify the PCR product using a PCR purification kit.</li>
		<li>Using the purified PCR product as a template, in vitro transcribe and purify dsRNA using an in vitro transcription and purification kit.</li>
	</ol>
	</li>
	<li>Transfection of dsRNA or plasmid DNA into LD652 cells
	<ol>
		<li>Seed 1 x 105 cells/well of a 24-well plate and let the cells settle for at least 1 h.</li>
		<li>For each well to be transfected, dilute 4 &#956;L of transfection reagent into 100 &#956;L of SFM. Incubate for up to 15 min at room temperature. This can be scaled to make a master mix for all transfections to be performed.</li>
		<li>Dilute up to 1 &#956;g of dsRNA or total plasmid DNA with 100 &#956;L of SFM for each well to be transfected. Incubate for up to 15 min at room temperature. 
		NOTE: We have previously found that a transfection of 1 &#956;g of dsRNA/105 LD652 cells is sufficient for &#62;80% knockdown of either viral or host transcripts13, but dsRNA doses needed for modified experimental set-ups/conditions will have to be determined empirically.</li>
		<li>Combine transfection reagent and dsRNA/plasmid DNA dilutions with a 1:1 ratio (e.g., 100 &#956;L of diluted dsRNA is mixed with 100 &#956;L of diluted transfection reagent) and incubate for 20 min at room temperature.</li>
		<li>Meanwhile, wash the wells with 1 mL/well of SFM, and then add 500 &#956;L of SFM to each well.</li>
		<li>Slowly add the transfection reagent dsRNA (or plasmid DNA) mixture dropwise into each well.</li>
		<li>Incubate the transfection reagent with the cells for 5 h.
		<ol>
			<li>For RNAi experiments involving the knockdown of transcripts encoded by a coinfecting virus (e.g., VACV), replace the transfection reagent after the 5-h transfection incubation period with virus inoculum containing VSV-LUC (with or without VACV or another coinfecting virus) (step 3). Subsequently, replace the virus inoculum containing VSV-LUC with complete growth media 2 hpi. LUC assays (step 4) can then be performed on extracted lysates at various time points to determine if the knockdown of coinfecting virus transcripts leads to a loss of VSV-LUC rescue.</li>
			<li>For RNAi experiments involving RNAi of L. dispar transcripts, replace the transfection mix with complete growth media and allow knockdown to ensue for 24 h prior to infection with VSV-LUC (step 4). LUC assays (step 4) can then be performed on extracted lysates at various time points to determine if the knockdown of L. dispar transcripts promotes VSV-LUC rescue.</li>
			<li>For experiments involving transfections of plasmid expression vectors expressing candidate immunomodulators, replace the transfection reagent and allow for protein expression for 24 h prior to the infection with VSV-LUC (step 4). LUC assays (step 4) can then be performed on extracted lysates at various time points to determine if the expression of candidate immunomodulatory proteins promotes VSV-LUC rescue. 
			NOTE: The transfection conditions described here using 1 &#956;g/well of plasmid DNA result in transfection efficiencies of 40&#8211;60%13.</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Nomaguchi, M., Fujita, M., Miyazaki, Y., Adachi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+tropism.">Viral tropism.</a> Frontiers in Microbiology. 3, 281 (2012).</li><li>Werden, S. J., McFadden, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+cell+signaling+in+poxvirus+tropism:+the+case+of+the+M-T5+host+range+protein+of+myxoma+virus.">The role of cell signaling in poxvirus tropism: the case of the M-T5 host range protein of myxoma virus.</a> Biochimica et Biophysica Acta (BBA) - Bioenergetics. 1784 (1), 228-237 (2008).</li><li>McFadden, G., Mohamed, M. R., Rahman, M. M., Bartee, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytokine+determinants+of+viral+tropism.">Cytokine determinants of viral tropism.</a> Nature Reviews: Immunology. 9 (9), 645-655 (2009).</li><li>Silva, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Second-generation+shRNA+libraries+covering+the+mouse+and+human+genomes.">Second-generation shRNA libraries covering the mouse and human genomes.</a> Nature Genetics. 37 (11), 1281-1288 (2005).</li><li>Moffat, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+lentiviral+RNAi+library+for+human+and+mouse+genes+applied+to+an+arrayed+viral+high-content+screen.">A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen.</a> Cell. 124 (6), 1283-1298 (2006).</li><li>Ma, D., Liu, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+Editing+and+Its+Applications+in+Model+Organisms.">Genome Editing and Its Applications in Model Organisms.</a> Genomics Proteomics Bioinformatics. 13 (6), 336-344 (2015).</li><li>Yin, H., Kauffman, K. J., Anderson, D. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delivery+technologies+for+genome+editing.">Delivery technologies for genome editing.</a> Nature Reviews: Drug Discovery. 16 (6), 387-399 (2017).</li><li>Hao, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drosophila+RNAi+screen+identifies+host+genes+important+for+influenza+virus+replication.">Drosophila RNAi screen identifies host genes important for influenza virus replication.</a> Nature. 454 (7206), 890-893 (2008).</li><li>Houzet, L., Jeang, K. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+screening+using+RNA+interference+to+study+host+factors+in+viral+replication+and+pathogenesis.">Genome-wide screening using RNA interference to study host factors in viral replication and pathogenesis.</a> Experimental Biology and Medicine. 236 (8), 962-967 (2011).</li><li>Marceau, C. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+dissection+of+Flaviviridae+host+factors+through+genome-scale+CRISPR+screens.">Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens.</a> Nature. 535 (7610), 159-163 (2016).</li><li>Savidis, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+Zika+Virus+and+Dengue+Virus+Dependency+Factors+using+Functional+Genomics.">Identification of Zika Virus and Dengue Virus Dependency Factors using Functional Genomics.</a> Cell Reports. 16 (1), 232-246 (2016).</li><li>Panda, D., Cherry, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-based+genomic+screening:+elucidating+virus-host+interactions.">Cell-based genomic screening: elucidating virus-host interactions.</a> Current Opinion in Virology. 2 (6), 784-792 (2012).</li><li>Gammon, D. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single+vertebrate+DNA+virus+protein+disarms+invertebrate+immunity+to+RNA+virus+infection.">A single vertebrate DNA virus protein disarms invertebrate immunity to RNA virus infection.</a> Elife. 3, (2014).</li><li>Letchworth, G. J., Rodriguez, L. L., Del cbarrera, ., J, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vesicular+stomatitis.">Vesicular stomatitis.</a> Veterinary Journal. 157 (3), 239-260 (1999).</li><li>Whelan, S. P., Ball, L. A., Barr, J. N., Wertz, G. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+recovery+of+infectious+vesicular+stomatitis+virus+entirely+from+cDNA+clones.">Efficient recovery of infectious vesicular stomatitis virus entirely from cDNA clones.</a> Proceedings of the National Academy of Sciences of the United States of America. 92 (18), 8388-8392 (1995).</li><li>Cureton, D. K., Massol, R. H., Saffarian, S., Kirchhausen, T. L., Whelan, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vesicular+stomatitis+virus+enters+cells+through+vesicles+incompletely+coated+with+clathrin+that+depend+upon+actin+for+internalization.">Vesicular stomatitis virus enters cells through vesicles incompletely coated with clathrin that depend upon actin for internalization.</a> PLoS Pathogens. 5 (4), e1000394 (2009).</li><li>Duntsch, C. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recombinant+vesicular+stomatitis+virus+vectors+as+oncolytic+agents+in+the+treatment+of+high-grade+gliomas+in+an+organotypic+brain+tissue+slice-glioma+coculture+model.">Recombinant vesicular stomatitis virus vectors as oncolytic agents in the treatment of high-grade gliomas in an organotypic brain tissue slice-glioma coculture model.</a> Journal of Neurosurgery. 100 (6), 1049-1059 (2004).</li><li>Li, Y., Yuan, S., Moyer, R. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+non-permissive+infection+of+insect+(gypsy+moth)+LD-652+cells+by+Vaccinia+virus.">The non-permissive infection of insect (gypsy moth) LD-652 cells by Vaccinia virus.</a> Virology. 248 (1), 74-82 (1998).</li><li>Seet, B. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Poxviruses+and+immune+evasion.">Poxviruses and immune evasion.</a> Annual Review of Immunology. 21, 377-423 (2003).</li><li>Cotter, C. A., Earl, P. L., Wyatt, L. S., Moss, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+Cell+Cultures+and+Vaccinia+Virus+Stocks.">Preparation of Cell Cultures and Vaccinia Virus Stocks.</a> Current Protocols in Microbiology. 39, 11-18 (2015).</li><li>Andrei, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cidofovir+resistance+in+vaccinia+virus+is+linked+to+diminished+virulence+in+mice.">Cidofovir resistance in vaccinia virus is linked to diminished virulence in mice.</a> Journal of Virology. 80 (19), 9391-9401 (2006).</li><li>Dascher, C., VanSlyke, J. K., Thomas, L., Balch, W. E., Thomas, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+recombinant+vaccinia+virus+for+expression+of+small+GTPases.">Preparation of recombinant vaccinia virus for expression of small GTPases.</a> Methods in Enzymology. , 174-188 (1995).</li><li>Martin, A., Rex, E. A., Ishidate, T., Lin, R., Gammon, D. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Infection+of+Caenorhabditis+elegans+with+Vesicular+Stomatitis+Virus+via+Microinjection.">Infection of Caenorhabditis elegans with Vesicular Stomatitis Virus via Microinjection.</a> Bio-Protocol. 7 (22), (2017).</li><li>Luker, K. E., Hutchens, M., Schultz, T., Pekosz, A., Luker, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bioluminescence+imaging+of+vaccinia+virus:+effects+of+interferon+on+viral+replication+and+spread.">Bioluminescence imaging of vaccinia virus: effects of interferon on viral replication and spread.</a> Virology. 341 (2), 284-300 (2005).</li><li>Rozelle, D. K., Filone, C. M., Dower, K., Connor, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaccinia+reporter+viruses+for+quantifying+viral+function+at+all+stages+of+gene+expression.">Vaccinia reporter viruses for quantifying viral function at all stages of gene expression.</a> Journal of Visualizes Experiments. (87), e51522 (2014).</li><li>Cao, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+the+transcriptome+of+the+Asian+gypsy+moth+Lymantria+dispar+identifies+numerous+transcripts+associated+with+insecticide+resistance.">Characterization of the transcriptome of the Asian gypsy moth Lymantria dispar identifies numerous transcripts associated with insecticide resistance.</a> Pesticide Biochemistry and Physiology. 119, 54-61 (2015).</li><li>Sparks, M. E., Blackburn, M. B., Kuhar, D., Gundersen-Rindal, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptome+of+the+Lymantria+dispar+(gypsy+moth)+larval+midgut+in+response+to+infection+by+Bacillus+thuringiensis.">Transcriptome of the Lymantria dispar (gypsy moth) larval midgut in response to infection by Bacillus thuringiensis.</a> PloS One. 8 (5), e61190 (2013).</li><li>Sparks, M. E., Gundersen-Rindal, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Lymantria+dispar+IPLB-Ld652Y+cell+line+transcriptome+comprises+diverse+virus-associated+transcripts.">The Lymantria dispar IPLB-Ld652Y cell line transcriptome comprises diverse virus-associated transcripts.</a> Viruses. 3 (11), 2339-2350 (2011).</li><li>Lin, G., Li, G., Granados, R. R., Blissard, G. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable+cell+lines+expressing+baculovirus+P35:+resistance+to+apoptosis+and+nutrient+stress,+and+increased+glycoprotein+secretion.">Stable cell lines expressing baculovirus P35: resistance to apoptosis and nutrient stress, and increased glycoprotein secretion.</a> In Vitro Cellular &amp; Developmental Biology - Animal. 37 (5), 293-302 (2001).</li><li>Li, W. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interferon+antagonist+proteins+of+influenza+and+vaccinia+viruses+are+suppressors+of+RNA+silencing.">Interferon antagonist proteins of influenza and vaccinia viruses are suppressors of RNA silencing.</a> Proceedings of the National Academy of Sciences of the United States of America. 101 (5), 1350-1355 (2004).</li><li>Kanost, M. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multifaceted+biological+insights+from+a+draft+genome+sequence+of+the+tobacco+hornworm+moth,+Manduca+sexta.">Multifaceted biological insights from a draft genome sequence of the tobacco hornworm moth, Manduca sexta.</a> Insect Biochemistry and Molecular Biology. 76, 118-147 (2016).</li><li>Paixao, E. S., Teixeira, M. G., Rodrigues, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika,+chikungunya+and+dengue:+the+causes+and+threats+of+new+and+re-emerging+arboviral+diseases.">Zika, chikungunya and dengue: the causes and threats of new and re-emerging arboviral diseases.</a> BMJ Global Health. 3, (2018).</li></ol>

The authors have nothing to disclose.

Here we have described simple fluorescence- and luminescence-based assays to screen for conditions that rescue VSV replication in restrictive lepidopteran cell cultures. The abortive infection of VSV in lepidopteran cells creates an excellent signal-to-noise ratio when assaying for VSV gene expression. For example, the LU signals detected in lysates from single VSV-LUC infections were ~1,000-fold higher than in mock-infected lysates, yet these signals only changed approximately twofold over a 72-h time course. In contras...

The ability of a virus to productively replicate in a particular host is in part governed by the availability of host cell factors that support viral entry and replication1. The virus-host range can also be dictated by the capacity of a virus to counter cellular antiviral defenses that would otherwise impede viral replication2,3. It is the outcome of these complex virus-host interactions that ultimately decide whether a virus will be able to complete its life cycle in a particular host. Given the potentially pathogenic consequences for the host if viral replication ensues, it is critical to develop experimental strategies to further our understanding of the key virus-host interactions that may tip the balance between abortive and productive infections. Elucidating the molecular features of virus-host interplay will be instrumental in the development of new and alternative antiviral therapeutic strategies.
With the advent of RNA interference (RNAi)4,5 and genome-editing tools (e.g., CRISPR-Cas9, Zinc finger nucleases, TALENs)6,7, it has become experimentally feasible to alter the expression of cellular factors on genome-wide scales and explore the impact of these alterations on virus replication. Indeed, numerous RNAi and genome-editing-based screens have been conducted in invertebrate and vertebrate host cell types that have unveiled new facets of virus-host interactions8,9,10,11,12. These screens typically employ viruses encoding reporters, such as firefly luciferase (LUC) or fluorescent proteins (e.g., GFP, DsRed), that provide convenient means of quantitatively assessing viral gene expression as a readout for viral replication9,12. This strategy allows researchers to identify host factors that either promote or antagonize viral replication as evidenced by increases or decreases, respectively, in viral reporter signals9,12. However, in the vast majority of cases, these screens have been conducted using viruses that are well-adapted to the host cell type in which they are being studied. While this strategy can be important for understanding coevolutionary relationships between viral pathogens and their natural hosts, it does pose fundamental concerns regarding their use in uncovering host antiviral factors. In these cases, an enhancement in virus reporter signal upon RNAi knockdown is being looked for, or the inactivation of a cellular factor that normally impedes viral replication. First, if a virus is already able to robustly replicate in the host cell being examined under control conditions, the dynamic range of the screen (i.e., the ability to distinguish between background and enhanced viral reporter signals) may be limited. Second, this issue is further compounded by the situations in which the virus is well-adapted to the host cell and effective at countering host defense pathways that are being targeted in the screen.
Due to the above concerns regarding traditional virus-host interaction screening methods, we developed a new paradigm for studying virus-host interactions that exploit naturally abortive arbovirus infections in lepidopteran insect cells. This strategy derives from an observation that the well-studied human arbovirus, VSV, undergoes an abortive infection in cells derived from the gypsy moth (L. dispar)13. VSV is naturally transmitted by dipteran insects (i.e., sand flies) to mammalian hosts, and has been shown experimentally to infect a wide range of invertebrate and vertebrate hosts both in cell culture and in vivo14. The 11-kb negative-sense single-stranded RNA genome of VSV encodes five subgenomic mRNAs that are each translated into the proteins that make up the enveloped virion. However, VSV reverse genetic systems have allowed for the creation of replication-competent strains encoding LUC or fluorescent proteins, in addition to the five natural VSV gene products15,16,17. Because these reporter proteins are not incorporated into the VSV virion, they provide a convenient readout for VSV gene expression that occurs post-entry. Using VSV strains encoding GFP or LUC, we have previously shown that VSV gene expression is severely restricted upon the entry of LD652 cells and that VSV titers do not increase by 72 hours post-infection (hpi). In contrast, the coinfection of LD652 cells with VSV and the mammalian poxvirus, vaccinia virus (VACV), leads to logarithmic increases in both VSV gene expression and titers by this time point. VACV undergoes early gene expression, DNA replication, and late gene expression in LD652 cell infections, but the VACV replication cycle is ultimately abortive due to incomplete virion morphogenesis18. The large ~192-kb DNA genome of VACV encodes &#62; 200 proteins, many of which display immunomodulatory properties that promote viral replication through the suppression of host immune responses19. Therefore, we hypothesized that the &#34;rescue&#34; of VSV replication in LD652 cells by VACV coinfection was likely mediated by VACV immunomodulators that inhibited L. dispar responses normally restricting VSV replication. In support of this, the treatment of LD652 cells with the host RNA polymerase II inhibitor actinomycin D also rescues VSV replication in LD652 cells, indicating that the transcription-dependent host responses block VSV replication post-entry13.
The above observations suggest that the naturally restrictive nature of LD652 cells to VSV infection may provide a relatively low background when screening for the conditions that enhance VSV-encoded reporter signals (i.e., those that inhibit host antiviral defenses). Here, we provide the methods for using fluorescence or LUC-based assays to screen for conditions that relieve VSV restriction in lepidopteran cells. First, we show how these assays can be used to identify virally encoded immunomodulatory factors that break VSV restriction during either coinfection experiments or through ectopic expression of candidate viral factors. As an example, we illustrate how we used these screening techniques to identify poxvirus-encoded A51R proteins as a new family of immunomodulatory factors that rescue VSV replication in the absence of other poxvirus factors13. Second, we illustrate how RNAi screening in restrictive VSV-LD652 cell infections can be used to directly identify eukaryotic host factors involved in arbovirus restriction13.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>6-well tissue culture plates</td>
			<td>CELLTREAT</td>
			<td>229106</td>
			<td></td>
		</tr>
		<tr>
			<td>24-well tissue culture plates</td>
			<td>CELLTREAT</td>
			<td>229124</td>
			<td></td>
		</tr>
		<tr>
			<td>10 cm tissue culture dishes</td>
			<td>Corning</td>
			<td>C430167</td>
			<td></td>
		</tr>
		<tr>
			<td>Grace&#8217;s Insect Medium</td>
			<td>Sigma</td>
			<td>G8142</td>
			<td></td>
		</tr>
		<tr>
			<td>EX-CELL 420</td>
			<td>Sigma</td>
			<td>14420C</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum - Optima</td>
			<td>Atlanta Biologicals</td>
			<td>S12450</td>
			<td></td>
		</tr>
		<tr>
			<td>Growth medium</td>
			<td></td>
			<td></td>
			<td>1:1 mixture of Grace&#39;s Insect Medium and EX-Cell 420 Serum-Free Medium also containing 1 % antibiotic-antimycotic solution and 10 % Fetal bovine serum</td>
		</tr>
		<tr>
			<td>Antibiotic-Antimycotic Solution (100&#215;)</td>
			<td>Sigma</td>
			<td>A5955</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#8217;s Phosphate Buffered Saline (DPBS)</td>
			<td>Sigma</td>
			<td>D8662</td>
			<td></td>
		</tr>
		<tr>
			<td>Serum Free Media (SFM)</td>
			<td>Thermo Fisher</td>
			<td>10902096</td>
			<td></td>
		</tr>
		<tr>
			<td>Cytosine arabinoside</td>
			<td>Sigma</td>
			<td>C1768</td>
			<td></td>
		</tr>
		<tr>
			<td>Transfection reagent</td>
			<td>Thermo Fisher</td>
			<td>10362100</td>
			<td></td>
		</tr>
		<tr>
			<td>Corning cellgro DMSO (Dimethyl Sulfoxide)</td>
			<td>Corning</td>
			<td>25950CQC</td>
			<td></td>
		</tr>
		<tr>
			<td>Reporter lysis buffer 5X</td>
			<td>Promega</td>
			<td>E3971</td>
			<td></td>
		</tr>
		<tr>
			<td>Luciferase Assay Reagent</td>
			<td>Promega</td>
			<td>E1483</td>
			<td></td>
		</tr>
		<tr>
			<td>96-Well Microplates</td>
			<td>Corning</td>
			<td>3915</td>
			<td></td>
		</tr>
		<tr>
			<td>Mouse anti-FLAG antibody</td>
			<td>Wako</td>
			<td>014-22383</td>
			<td></td>
		</tr>
		<tr>
			<td>Rabbit anti-firefly luciferase antibody</td>
			<td>Abcam</td>
			<td>ab21176</td>
			<td></td>
		</tr>
		<tr>
			<td>Mouse anti-actin antibody</td>
			<td>Sigma</td>
			<td>A2066</td>
			<td></td>
		</tr>
		<tr>
			<td>Mouse anti-VSV M</td>
			<td>N/A</td>
			<td>N/A</td>
			<td>Dr. John Connor (Boston University)</td>
		</tr>
		<tr>
			<td>Mouse anti-VACV I3L</td>
			<td>N/A</td>
			<td>N/A</td>
			<td>Dr. David Evans (University of Alberta)</td>
		</tr>
		<tr>
			<td>8-well Chambered dish</td>
			<td>Lab-Tek II</td>
			<td>155409</td>
			<td></td>
		</tr>
		<tr>
			<td>Cell viability dye</td>
			<td>Thermo Fisher</td>
			<td>C12881</td>
			<td></td>
		</tr>
		<tr>
			<td>FLUOstar microplate reader</td>
			<td>BMG Labtech</td>
			<td>FLUOstar</td>
			<td></td>
		</tr>
		<tr>
			<td>Confocal microscope</td>
			<td>Olympus</td>
			<td>FV10i-LIV</td>
			<td></td>
		</tr>
		<tr>
			<td>Image analysis software</td>
			<td>Olympus</td>
			<td>v1.18</td>
			<td>cellSens software</td>
		</tr>
		<tr>
			<td>Eppendorf 5702 ventilated centrifuge</td>
			<td>Eppendorf</td>
			<td>22628102</td>
			<td></td>
		</tr>
		<tr>
			<td>Odyssey Fc Infrared Imaging System</td>
			<td>Li-COR Biosciences</td>
			<td>Odyssey Fc</td>
			<td></td>
		</tr>
		<tr>
			<td>LD652 cells</td>
			<td>N/A</td>
			<td>N/A</td>
			<td>Dr. Basil Arif (Natural Resources Canada)</td>
		</tr>
		<tr>
			<td>BSC-40 cells</td>
			<td>ATCC</td>
			<td>CRL-2761</td>
			<td></td>
		</tr>
		<tr>
			<td>BHK cells</td>
			<td>ATCC</td>
			<td>CCL-10</td>
			<td></td>
		</tr>
		<tr>
			<td>HeLa cells</td>
			<td>ATCC</td>
			<td>CCL-2</td>
			<td></td>
		</tr>
		<tr>
			<td>BSC-1 cells</td>
			<td>ATCC</td>
			<td>CCL-26</td>
			<td></td>
		</tr>
		<tr>
			<td>in vitro transcription and purification kit</td>
			<td>Thermo Fisher</td>
			<td>AM1626</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR purification kit</td>
			<td>Qiagen</td>
			<td>28104</td>
			<td></td>
		</tr>
	</tbody>
</table>

arbovirus infections as screening tools for the identification of viral immunomodulators and host antiviral factors

RNA interference- and genome editing-based screening platforms have been widely used to identify host cell factors that restrict virus replication. However, these screens are typically conducted in cells that are naturally permissive to the viral pathogen under study. Therefore, the robust replication of viruses in control conditions may limit the dynamic range of these screens. Furthermore, these screens may be unable to easily identify cellular defense pathways that restrict virus replication if the virus is well-adapted to the host and capable of countering antiviral defenses. In this article, we describe a new paradigm for exploring virus-host interactions through the use of screens that center on naturally abortive infections by arboviruses such as vesicular stomatitis virus (VSV). Despite the ability of VSV to replicate in a wide range of dipteran insect and mammalian hosts, VSV undergoes a post-entry, abortive infection in a variety of cell lines derived from lepidopteran insects, such as the gypsy moth (Lymantria dispar). However, these abortive VSV infections can be &#34;rescued&#34; when host cell antiviral defenses are compromised. We describe how VSV strains encoding convenient reporter genes and restrictive L. dispar cell lines can be paired to set-up screens to identify host factors involved in arbovirus restriction. Furthermore, we also show the utility of these screening tools in the identification of virally encoded factors that rescue VSV replication during coinfection or through ectopic expression, including those encoded by mammalian viruses. The natural restriction of VSV replication in L. dispar cells provides a high signal-to-noise ratio when screening for the conditions that promote VSV rescue, thus enabling the use of simplistic luminescence- and fluorescence-based assays to monitor the changes in VSV replication. These methodologies are valuable for understanding the interplay between host antiviral responses and viral immune evasion factors.

As an example of live-cell imaging applications to monitor VSV rescue upon VACV coinfection, LD652 cells were plated in an 8-well chambered dish and then mock-infected or infected with VSV-DsRed (MOI = 1) in the presence or absence of VACV-FL-GFP (MOI = 25). Because VSV-DsRed expresses DsRed as a free protein and is not fused to structural VSV proteins (Figure 1A), it is only detected after VSV entry and gene expression initiates. All cells were then labeled ...

Watch this Scientific Journal Video about Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors at JoVE.com

Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors

Here, we present the protocols to identify 1) virus-encoded immunomodulators that promote arbovirus replication and 2) eukaryotic host factors that restrict arbovirus replication. These fluorescence- and luminescence-based methods allow researchers to rapidly obtain quantitative readouts of arbovirus replication in simplistic assays with low signal-to-noise ratios.

RNA interference- and genome editing-based screening platforms have been widely used to identify host cell factors that restrict virus replication. ...

arbovirus-infections-as-screening-tools-for-identification-viral

Research

JoVE Journal

Immunology and Infection

6.8K Views.  University of Texas Southwestern Medical Center. Here, we present the protocols to identify 1) virus-encoded immunomodulators that promote arbovirus replication and 2) eukaryotic host factors that restrict arbovirus replication. These fluorescence- and luminescence-based methods allow researchers to rapidly obtain quantitative readouts of arbovirus replication in simplistic assays with low signal-to-noise ratios.

Video: Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Viral pathogens represent a significant public health threat; not only can viruses cause natural epidemics of human disease, but their potential use in bioterrorism is also a concern. A better understanding of the cellular factors that impact infection would facilitate the development of much-needed therapeutics. Recent advances in RNA interference (RNAi) technology coupled with complete genome sequencing of several organisms has led to the optimization of genome-wide, cell-based loss-of-function screens. Drosophila cells are particularly amenable to genome-scale screens because of the ease and efficiency of RNAi in this system 1. Importantly, a wide variety of viruses can infect Drosophila cells, including a number of mammalian viruses of medical and agricultural importance 2,3,4. Previous RNAi screens in Drosophila have identified host factors that are required for various steps in virus infection including entry, translation and RNA replication 5. Moreover, many of the cellular factors required for viral replication in Drosophila cell culture are also limiting in human cells infected with these viruses 4,6,7,8, 9. Therefore, the identification of host factors co-opted during viral infection presents novel targets for antiviral therapeutics. Here we present a generalized protocol for a high-throughput RNAi screen to identify cellular factors involved in viral infection, using vaccinia virus as an example.

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Novel host factors involved in viral infection can be identified through cell-based genome-wide loss of function RNAi screening. A Drosophila cell culture model is particularly amenable to this approach due to the ease and efficiency of RNAi. Here we demonstrate this technique using vaccinia virus as an example.

Viral pathogens represent a significant public health threat; not only can viruses cause natural epidemics of human disease, but their potential use in ...

Introducing Shear Stress in the Study of Bacterial Adhesion

During bacterial infections a sequence of interactions occur between the pathogen and its host. Bacterial adhesion to the host cell surface is often the initial and determining step of the pathogenesis. Although experimentally adhesion is mostly studied in static conditions adhesion actually takes place in the presence of flowing liquid. First encounters between bacteria and their host often occur at the mucosal level, mouth, lung, gut, eye, etc. where mucus flows along the surface of epithelial cells. Later in infection, pathogens occasionally access the blood circulation causing life-threatening illnesses such as septicemia, sepsis and meningitis. A defining feature of these infections is the ability of these pathogens to interact with endothelial cells in presence of circulating blood. The presence of flowing liquid, mucus or blood for instance, determines adhesion because it generates a mechanical force on the pathogen. To characterize the effect of flowing liquid one usually refers to the notion of shear stress, which is the tangential force exerted per unit area by a fluid moving near a stationary wall, expressed in dynes/cm2. Intensities of shear stress vary widely according to the different vessels type, size, organ, location etc. (0-100 dynes/cm2). Circulation in capillaries can reach very low shear stress values and even temporarily stop during periods ranging between a few seconds to several minutes 1. On the other end of the spectrum shear stress in arterioles can reach 100 dynes/cm2 2. The impact of shear stress on different biological processes has been clearly demonstrated as for instance during the interaction of leukocytes with the endothelium 3. To take into account this mechanical parameter in the process of bacterial adhesion we took advantage of an experimental procedure based on the use of a disposable flow chamber 4. Host cells are grown in the flow chamber and fluorescent bacteria are introduced in the flow controlled by a syringe pump. We initially focused our investigations on the bacterial pathogen Neisseria meningitidis, a Gram-negative bacterium responsible for septicemia and meningitis. The procedure described here allowed us to study the impact of shear stress on the ability of the bacteria to: adhere to cells 1, to proliferate on the cell surface 5and to detach to colonize new sites 6 (Figure 1). Complementary technical information can be found in reference 7. Shear stress values presented here were chosen based on our previous experience1 and to represent values found in the literature. The protocol should be applicable to a wide range of pathogens with specific adjustments depending on the objectives of the study.

During the infection process, a key step is the adhesion of pathogens with host cells. In most instances this adhesion step occurs in the presence of mechanical stress generated by flowing liquid. We describe a technique that introduces shear stress as an important parameter in the study of bacterial adhesion.

During bacterial infections a sequence of interactions occur between the pathogen and its host. Bacterial adhesion to the host cell surface is often the ...

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The apical and basolateral surfaces of airway epithelial cells demonstrate directional responses to pathogen exposure in vivo. Thus, ideal in vitro models for examining cellular responses to respiratory pathogens polarize, forming apical and basolateral surfaces. One such model is differentiated normal human bronchial epithelial cells (NHBE). However, this system requires lung tissue samples, expertise isolating and culturing epithelial cells from tissue, and time to generate an air-liquid interface culture.
Calu-3 cells, derived from a human bronchial adenocarcinoma, are an alternative model for examining the response of proximal airway epithelial cells to respiratory insult1, pharmacological compounds2-6, and bacterial7-9 and viral pathogens, including influenza virus, rhinovirus and severe acute respiratory syndrome - associated coronavirus10-14. Recently, we demonstrated that Calu-3 cells are susceptible to respiratory syncytial virus (RSV) infection in a manner consistent with NHBE15,16 . Here, we detail the establishment of a polarized, liquid-covered culture (LCC) of Calu-3 cells, focusing on the technical details of growing and culturing Calu-3 cells, maintaining cells that have been cultured into LCC, and we present the method for performing respiratory virus infection of polarized Calu-3 cells.
To consistently obtain polarized Calu-3 LCC, Calu-3 cells must be carefully subcultured before culturing in Transwell inserts. Calu-3 monolayer cultures should remain below 90% confluence, should be subcultured fewer than 10 times from frozen stock, and should regularly be supplied with fresh medium. Once cultured in Transwells, Calu-3 LCC must be handled with care. Irregular media changes and mechanical or physical disruption of the cell layers or plates negatively impact polarization for several hours or days. Polarization is monitored by evaluating trans-epithelial electrical resistance (TEER) and is verified by evaluating the passive equilibration of sodium fluorescein between the apical and basolateral compartments17,18 . Once TEER plateaus at or above 1,000 &Omega;&times;cm2, Calu-3 LCC are ready to use to examine cellular responses to respiratory pathogens.

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The findings and conclusions in this report are those of the authors and do not necessarily represent the views of the Centers for Disease Control and Prevention.

The  apical and basolateral surfaces of airway epithelial cells demonstrate  directional responses to pathogen exposure in  vivo. Thus, ideal in vitro ...

Using Click Chemistry to Measure the Effect of Viral Infection on Host-Cell RNA Synthesis

Many RNA viruses have evolved the ability to inhibit host cell transcription as a means to circumvent cellular defenses. For the study of these viruses, it is therefore important to have a quick and reliable way of measuring transcriptional activity in infected cells. Traditionally, transcription has been measured either by incorporation of radioactive nucleosides such as 3H-uridine followed by detection via autoradiography or scintillation counting, or incorporation of halogenated uridine analogs such as 5-bromouridine (BrU) followed by detection via immunostaining. The use of radioactive isotopes, however, requires specialized equipment and is not feasible in a number of laboratory settings, while the detection of BrU can be cumbersome and may suffer from low sensitivity.
The recently developed click chemistry, which involves a copper-catalyzed triazole formation from an azide and an alkyne, now provides a rapid and highly sensitive alternative to these two methods. Click chemistry is a two step process in which nascent RNA is first labeled by incorporation of the uridine analog 5-ethynyluridine (EU), followed by detection of the label with a fluorescent azide. These azides are available as several different fluorophores, allowing for a wide range of options for visualization.
This protocol describes a method to measure transcriptional suppression in cells infected with the Rift Valley fever virus (RVFV) strain MP-12 using click chemistry. Concurrently, expression of viral proteins in these cells is determined by classical intracellular immunostaining. Steps 1 through 4 detail a method to visualize transcriptional suppression via fluorescence microscopy, while steps 5 through 8 detail a method to quantify transcriptional suppression via flow cytometry. This protocol is easily adaptable for use with other viruses.

This method describes the use of click chemistry to measure changes in host cell transcription after infection with the Rift Valley fever virus (RVFV) strain MP-12. Results can be visualized qualitatively via fluorescence microscopy or obtained quantitatively through flow cytometry. This method is adaptable for use with other viruses.

Many RNA viruses have evolved the ability to inhibit host cell transcription as a means to circumvent cellular defenses. For the study of these viruses, ...

VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance

Nonhost disease resistance of plants against bacterial pathogens is controlled by complex defense pathways. Understanding this mechanism is important for developing durable disease-resistant plants against wide range of pathogens. Virus-induced gene silencing (VIGS)-based forward genetics screening is a useful approach for identification of plant defense genes imparting nonhost resistance. Tobacco rattle virus (TRV)-based VIGS vector is the most efficient VIGS vector to date and has been efficiently used to silence endogenous target genes in Nicotiana benthamiana.

	In this manuscript, we demonstrate a forward genetics screening approach for silencing of individual clones from a cDNA library in N. benthamiana and assessing the response of gene silenced plants for compromised nonhost resistance against nonhost pathogens, Pseudomonas syringae pv. tomato T1, P. syringae pv. glycinea, and X. campestris pv. vesicatoria. These bacterial pathogens are engineered to express GFPuv protein and their green fluorescing colonies can be seen by naked eye under UV light in the nonhost pathogen inoculated plants if the silenced target gene is involved in imparting nonhost resistance. This facilitates reliable and faster identification of gene silenced plants susceptible to nonhost pathogens. Further, promising candidate gene information can be known by sequencing the plant gene insert in TRV vector. Here we demonstrate the high throughput capability of VIGS-mediated forward genetics to identify genes involved in nonhost resistance. Approximately, 100 cDNAs can be individually silenced in about two to three weeks and their relevance in nonhost resistance against several nonhost bacterial pathogens can be studied in a week thereafter. In this manuscript, we enumerate the detailed steps involved in this screening. VIGS-mediated forward genetics screening approach can be extended not only to identifying genes involved in nonhost resistance but also to studying genes imparting several biotic and abiotic stress tolerances in various plant species.

Virus-induced gene silencing is an useful tool for identifying genes involved in nonhost resistance of plants. We demonstrate the use of bacterial pathogens expressing GFPuv in identifying gene silenced plants susceptible to nonhost pathogens. This approach is easy, fast and facilitates large scale screening and similar protocol can be applied to studying various other plant-microbe interactions.


	Nonhost disease resistance of plants against bacterial pathogens is controlled by complex defense pathways. Understanding this mechanism is important ...

Generation and Multi-phenotypic High-content Screening of Coxiella burnetii Transposon Mutants

Invasion and colonization of host cells by bacterial pathogens depend on the activity of a large number of prokaryotic proteins, defined as virulence factors, which can subvert and manipulate key host functions. The study of host/pathogen interactions is therefore extremely important to understand bacterial infections and develop alternative strategies to counter infectious diseases. This approach however, requires the development of new high-throughput assays for the unbiased, automated identification and characterization of bacterial virulence determinants. Here, we describe a method for the generation of a GFP-tagged mutant library by transposon mutagenesis and the development of high-content screening approaches for the simultaneous identification of multiple transposon-associated phenotypes. Our working model is the intracellular bacterial pathogen Coxiellaburnetii, the etiological agent of the zoonosis Q fever, which is associated with severe outbreaks with a consequent health and economic burden. The obligate intracellular nature of this pathogen has, until recently, severely hampered the identification of bacterial factors involved in host pathogen interactions, making of Coxiella the ideal model for the implementation of high-throughput/high-content approaches.

Generation and Multi-phenotypic High-content Screening of Coxiella burnetii Transposon Mutants

Coxiella burnetii is an obligate intracellular Gram-negative bacterium responsible for the zoonotic disease Q fever. Here we describe methods for the generation of Coxiella fluorescent transposon mutants as well as the automated identification and analysis of the resulting internalization, replication and cytotoxic phenotypes.

Invasion and colonization of host cells by bacterial pathogens depend on the activity of a large number of prokaryotic proteins, defined as virulence ...

Early Viral Entry Assays for the Identification and Evaluation of Antiviral Compounds

Cell-based systems are useful for discovering antiviral agents. Dissecting the viral life cycle, particularly the early entry stages, allows a mechanistic approach to identify and evaluate antiviral agents that target specific steps of the viral entry. In this report, the methods of examining viral inactivation, viral attachment, and viral entry/fusion as antiviral assays for such purposes are described, using hepatitis C virus as a model. These assays should be useful for discovering novel antagonists/inhibitors to early viral entry and help expand the scope of candidate antiviral agents for further drug development.

Here, we present a protocol that examines specific steps of the viral entry to identify and evaluate novel antiviral agents.

Cell-based systems are useful for discovering antiviral agents. Dissecting the viral life cycle, particularly the early entry stages, allows a mechanistic ...

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

Coxiella burnetii, the agent causing Q fever, is an obligate intracellular bacterium. PCR based diagnostic assays have been developed for detecting C. burnetii DNA in cell cultures and clinical samples. PCR requires specialized equipment and extensive end user training, and therefore, it is not suitable for routine work especially in a resource-constrained area. We have developed a loop-mediated isothermal amplification (LAMP) assay to detect the presence of C. burnetii in patient samples. This method is performed at a single temperature around 60 &#176;C in a water bath or heating block. The sensitivity of this LAMP assay is very similar to PCR with a detection limit of about 25 copies per reaction. This report describes the preparation of the reaction using lyophilized reagents and visualization of results using hydroxynaphthol blue (HNB) or a UV lamp with fluorescent intercalating dye in the reaction. The LAMP reagents were lyophilized and stored at room temperature (RT) for one month without loss of detection sensitivity. This LAMP assay is particularly robust because the reaction mixture preparation does not involve complex steps. This method is ideal for use in resource-limited settings where Q fever is endemic.

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

We described here a simple loop-mediated isothermal amplification (LAMP) method using lyophilized reagents for the detection of C. burnetii in patient samples.

Coxiella burnetii, the agent causing Q fever, is an obligate intracellular bacterium. PCR based diagnostic assays have been developed for detecting C. ...

Human Placental and Decidual Organ Cultures to Study Infections at the Maternal-fetal Interface

The placenta shows a large degree of interspecies anatomic variability. To best understand biology and pathophysiology of the human placenta, it is imperative to design experiments using human cells and tissues. An advantage of organ culture is maintenance of three-dimensional (3D) structural organization and extracellular matrix. The goal of the method described here is successful establishment of ex vivo human gestational tissue organ cultures and their healthy culture maintenance for 72-96 hr. The protocol details the immediate processing of research-consented, placental and decidual specimens fresh from the operating suite. These are abundant specimens that would otherwise be discarded. Detailed instructions on the sterile collection of these samples, including morphologic details on how to select appropriate tissues to establish 3D organ cultures, is provided. Placental villous and decidual tissues are microdissected into 2-3 mm3 pieces and placed separately on matrix-lined transwell filters and cultured for several days. Villous and decidual organ cultures are well suited for the study of human host-pathogen interaction. As compared to other model organisms, these human cultures are particularly advantageous to examine mechanism of infection for pathogens that demonstrate variable patterns of host specificity. As an example, we demonstrate infection of placental and decidual organ cultures with the clinically relevant, facultative intracellular bacterial pathogen Listeria monocytogenes.

A simple method to establish primary human placental (villous) and decidual organ cultures is described. Villous and decidual organ cultures are invaluable tools for studying pathogenesis at the human maternal-fetal interface. Infection with the facultative intracellular bacterium Listeria monocytogenes is demonstrated.

The placenta shows a large degree of interspecies anatomic variability. To best understand biology and pathophysiology of the human placenta, it is ...

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

Brucella species are facultative intracellular pathogens that infect animals as their natural hosts. Transmission to humans is most commonly caused by direct contact with infected animals or by ingestion of contaminated food and can lead to severe chronic infections.
Brucella can invade professional and non-professional phagocytic cells and replicates within endoplasmic reticulum (ER)-derived vacuoles. The host factors required for Brucella entry into host cells, avoidance of lysosomal degradation, and replication in the ER-like compartment remain largely unknown. Here we describe two assays to identify host factors involved in Brucella entry and replication in HeLa cells. The protocols describe the use of RNA interference, while alternative screening methods could be applied. The assays are based on the detection of fluorescently labeled bacteria in fluorescently labeled host cells using automated wide-field microscopy. The fluorescent images are analyzed using a standardized image analysis pipeline in CellProfiler which allows single cell-based infection scoring.
In the endpoint assay, intracellular replication is measured two days after infection. This allows bacteria to traffic to their replicative niche where proliferation is initiated around 12 hr after bacterial entry. Brucella which have successfully established an intracellular niche will thus have strongly proliferated inside host cells. Since intracellular bacteria will greatly outnumber individual extracellular or intracellular non-replicative bacteria, a strain constitutively expressing GFP can be used. The strong GFP signal is then used to identify infected cells.
In contrast, for the entry assay it is essential to differentiate between intracellular and extracellular bacteria. Here, a strain encoding for a tetracycline-inducible GFP is used. Induction of GFP with simultaneous inactivation of extracellular bacteria by gentamicin enables the differentiation between intracellular and extracellular bacteria based on the GFP signal, with only intracellular bacteria being able to express GFP. This allows the robust detection of single intracellular bacteria before intracellular proliferation is initiated.

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

Two assays for microscopy-based high-throughput screening of host factors involved in Brucella infection are described. The entry assay detects host factors required for Brucella entry and the endpoint assay those required for intracellular replication. While applicable for alternative approaches, siRNA screening in HeLa cells is used to illustrate the protocols.

Brucella species are facultative intracellular pathogens that infect animals as their natural hosts. Transmission to humans is most commonly caused by ...

Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Introducing Shear Stress in the Study of Bacterial Adhesion

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

Using Click Chemistry to Measure the Effect of Viral Infection on Host-Cell RNA Synthesis

VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance

Generation and Multi-phenotypic High-content Screening of Coxiella burnetii Transposon Mutants

Early Viral Entry Assays for the Identification and Evaluation of Antiviral Compounds

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

Human Placental and Decidual Organ Cultures to Study Infections at the Maternal-fetal Interface

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells