Name: arbovirus infections as screening tools for the identification of viral immunomodulators and host antiviral factors
Uploaded: 2018-09-13T14:30:00.000+00:00
Duration: 6 min 2 s
Description: Watch this Scientific Journal Video about Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors at JoVE.com

D.G. was supported by funding from the University of Texas Southwestern Medical Center&#39;s Endowed Scholars Program. The authors thank Michael Whitt (The University of Tennessee Health Science Center) and Sean Whelan (Harvard Medical School) for the provision of VSV-DsRed and VSV-LUC. The authors also thank Gary Luker (University of Michigan Medical School) for the kind gift of the VACV-FL-GFP strain.

1. General Lymantria dispar (LD652) Cell and Virus Culture
<ol>
	<li>LD652 cell culturing and plating
	<ol>
		<li>To culture L. dispar-derived LD652 cells, maintain a monolayer of cells in a growth medium (Table of Materials) incubated at 27 &#176;C under normal atmosphere. Maintain the cells in 10 cm tissue-culture-treated dishes and passage the cells upon reaching 80% confluency.</li>
		<li>To plate, dislodge adherent LD652 cells from the plate by pipetting the media repeatedly onto the monolayer (these cells do not require trypsinization to dislodge), and dilute the sample in growth media to an approximate density of 1 x 105 cells/mL. Pipette 1 mL of diluted culture/well of a 24-well plate. Seed a minimum of three replicate wells/treatment type for each time point (a maximum of eight treatments/plate).</li>
		<li>Allow the cells to settle for a minimum of 1 h.</li>
	</ol>
	</li>
	<li>Vaccinia virus preparation
	<ol>
		<li>To prepare the stocks of VACV, amplify the virus in HeLa cells20 or African Green Monkey kidney cells (BSC-1 or BSC-40 cells)20,21,22. 
		NOTE: VACV strain Western Reserve (VACV-WR) works well in the assays described here.</li>
		<li>Titrate the VACV strain via plaque assay on BSC-1 or BSC-40 cells20,22. 
		NOTE: All indicated VACV multiplicity of infection (MOI) described here for LD652 cell infections are based on titers obtained from BSC-40 plaque assays.</li>
	</ol>
	</li>
	<li>Vesicular stomatitis virus preparation 
	<ol>
		<li>To prepare VSV stocks, amplify the virus in BHK cells23.</li>
		<li>Titrate VSV by plaque assay on BSC-40 or BHK cell monolayers13,23. 
		NOTE: All VSV MOIs described here for LD652 cell infections are based on titers obtained from BSC-40 plaque assays.</li>
	</ol>
	</li>
</ol>
2. Fluorescence-based VSV Rescue Assay Using Co-infection and Live-cell Imaging
<ol>
	<li>Seeding and infection of LD652 cells 
	<ol>
		<li>Plate 40,000 LD652 cells/well of an 8-well chamber.</li>
		<li>For fluorescence-based live-cell imaging, use VSV strains encoding fluorescent proteins. The experiments presented here use VSV-DsRed17, a recombinant VSV strain that expresses free DsRed protein that is not fused to any other VSV protein. 
		NOTE: VSV infection of LD652 cells is not cytopathic by 96 hpi and, thus, the cell death is not a confounding factor when evaluating VSV replication within this time frame.</li>
		<li>Prepare VSV-DsRed and VACV-FL-GFP in a serum-free media (SFM; Table of Materials) at an MOI of 1 and 25, respectively. 
		NOTE: VACV-FL-GFP is a recombinant VACV strain that expresses a fusion between LUC and GFP24. Using an MOI of 25 or greater for VACV strains ensures that all LD652 cells are infected13. If using a different coinfecting virus, the MOI will have to be determined empirically by the user. Each infection treatment should be set up in duplicate wells and include mock-infected treatments in which only SFM is added to the cells.</li>
		<li>Incubate the cells in 0.2 mL of inoculum for 2 h at 27 &#176;C.</li>
		<li>Wash the cells with 0.5 mL/well of growth media.</li>
		<li>Incubate the cells in 25 &#956;M of cell viability dye (Table of Materials) in growth media for 45 min at 27 &#176;C.</li>
		<li>Aspirate the media and wash the wells 1x with 0.5 mL/well to remove excess dye.</li>
		<li>Maintain the cells in 0.3 mL/well of the growth media.</li>
	</ol>
	</li>
	<li>Live cell image capturing
	<ol>
		<li>Turn on a confocal microscope 30 min in advance and load an 8-well chamber dish. 
		NOTE: LD652 cells can be imaged at room temperatures ranging from 20&#8211;25 &#176;C, but for optimal conditions, the temperature of the room should be adjusted to 27 &#176;C.</li>
		<li>Set up the appropriate excitation/emission settings for each fluorescent marker protein to be imaged, as well as the phase contrast image settings.</li>
		<li>Adjust the laser intensity for each channel. 
		NOTE: This may require running a pilot experiment to determine the range of fluorescent signal intensities observed throughout the time course to be used in the final experiment.</li>
		<li>Using the 10X objective, capture the phase contrast and fluorescence images of each well every 1&#8211;5 h for the duration of the infection up to a desired time point (e.g., 48&#8211;72 hpi). 
		NOTE: It is important to capture multiple fields of view in each well to accurately estimate the infection rates throughout the culture.</li>
	</ol>
	</li>
	<li>Image analysis
	<ol>
		<li>Use image analysis software for automated image analysis of appropriate fluorescent channels (e.g., 405 nm, 488 nm, 568 nm).</li>
		<li>To calculate the percentage of cells that are infected, divide the total number of fluorescent cells indicating VSV infection (e.g., DsRed-positive cells for VSV-DsRed infections) by the total number of viable cells labeled by cell viability dye for each field of view across all treatments.</li>
	</ol>
	</li>
</ol>
3. General Viral Infection Protocol for Luminescence-based VSV Rescue Assays in LD652 Cells
<ol>
	<li>Preparation of inoculum
	<ol>
		<li>30 min prior to the infection, thaw the stocks of VSV-LUC16 (a recombinant VSV strain that expresses free firefly luciferase protein not fused to any other VSV protein). If assaying for VSV-LUC rescue during VACV coinfection, also thaw the VACV-WR virus on ice. 
		NOTE: Other viruses (besides VACV-WR) may rescue VSV-LUC during the coinfection, but this will have to be determined empirically by each user.</li>
		<li>Prepare the inoculum by diluting VSV-LUC in the presence or absence of VACV-WR into SFM such that an MOI of 10 and 25, respectively, is achieved when adding a total inoculum volume of 0.2 mL/well.</li>
	</ol>
	</li>
	<li>Infection of the cells
	<ol>
		<li>Aspirate mature LD652 media carefully to avoid disturbing the monolayer and inoculate with 0.2 mL of virus/well. This time is defined as 0 hpi. Add sterile SFM to additional wells to serve as &#8220;mock-infected&#8221; negative control treatments.</li>
		<li>Incubate the cells in inoculum for 2 h at 27 &#176;C.</li>
		<li>At 2 hpi, remove inoculum by aspiration and replace with 1 mL/well LD652 growth media.</li>
		<li>Allow the infection to proceed 24&#8211;72 hpi.</li>
	</ol>
	</li>
</ol>
4. Luciferase Assay
<ol>
	<li>Preparation of cell lysates
	<ol>
		<li>Carefully aspirate the supernatant and add 1 mL of Dulbecco&#39;s phosphate-buffered saline (DPBS)/well.</li>
		<li>Using the plunger of a 1 mL syringe, scrape the cells into DPBS.</li>
		<li>Transfer the cells to a microcentrifuge tube, and centrifuge at 400 x g for 20 min at 4 &#176;C.</li>
		<li>Meanwhile, prepare 1x dilution of 5x reporter lysis buffer (RLB) in sterile H2O.</li>
		<li>Following the centrifugation, aspirate the DPBS without disturbing the cell pellet.</li>
		<li>Resuspend each pellet in 150 &#181;L of 1x RLB.</li>
		<li>Freeze-thaw the samples 1x using a 5-min incubation in a -80 &#176;C freezer followed by a rapid thaw in a room temperature water bath. Store the lysates at -80 &#176;C until ready to analyze.</li>
	</ol>
	</li>
	<li>Luciferase assay
	<ol>
		<li>Thaw the lysates on ice.</li>
		<li>Pipette 20 &#956;L of lysate into a well of a solid black or white 96-well microplate.</li>
		<li>Add 100 &#956;L of luciferase assay reagent to each well.</li>
		<li>Immediately measure the light intensity using a luminometer (appropriate settings for specific luminometers will have to be determined empirically by the user).</li>
	</ol>
	</li>
	<li>Luciferase assay analysis 
	<ol>
		<li>Normalize LU signals for each treatment to LU readings obtained from control treatments (Representative Results). After at least three independent experiments have been performed, the mean LU obtained from each treatment/control group can be analyzed by appropriate statistical tests.</li>
	</ol>
	</li>
</ol>
5. Immunoblot
<ol>
	<li>Use lysates extracted for the LUC assays for SDS-PAGE and subsequent immunoblotting, using appropriate reagents and instrumentation.</li>
</ol>
6. Titer of VSV from LD652 Cell Cultures
<ol>
	<li>Plate LD652 cells according to step 1.1.</li>
	<li>Viral infect the cells according to step 3.</li>
	<li>At desired time points, collect the supernatants into sterile microcentrifuge tubes.</li>
	<li>Pellet the cells using 1,000 x g for 10 min at 4 &#176;C and transfer the supernatants to new tubes.</li>
	<li>Store the supernatants at -80 &#176;C or proceed with titration by plaque assay on BSC-40 cells. 
	NOTE: If titrating VSV from LD652 cell cultures that contained VACV, it is advisable to add 100 &#956;g/mL cytosine arabinoside (AraC) to the BSC-40 culture media within 2 hpi, to prevent residual VACV particles from forming plaques on BSC-40 monolayers13. AraC is a viral DNA polymerase inhibitor that blocks VACV DNA replication25 but does not affect VSV replication.</li>
</ol>
7. Variations of Luminescence-based VSV Rescue Assays in LD652 Cells: RNAi and Plasmid Transfection Experiments
<ol>
	<li>Preparation of dsRNA for RNAi-mediated knockdown of viral or host transcripts
	<ol>
		<li>Design gene-specific primers tailed at the 5&#8217; end with the T7 promoter sequence (TAATACGACTCACTATAGGG) to target either the coinfecting virus (e.g., VACV) or L. dispar mRNA transcripts of interest. These primers should produce a PCR product of 400&#8211;600 bp for effective RNAi-mediated knockdown. See Gammon et al.13 for primer sequences used below to knockdown VACV or L. dispar transcripts by dsRNA-mediated RNAi in LD652 cells. 
		NOTE: L. dispar mRNA transcripts can be identified from published L. dispar transcriptome databases26,27,28.</li>
		<li>Generate a DNA template via RT-PCR (cDNA synthesis: 1 cycle of 50 &#176;C for 30 min; PCR: 40 cycles of 94 &#176;C for 15 s, 50 &#176;C for 30 s, and 68 &#176;C for 45 s each).</li>
		<li>Purify the PCR product using a PCR purification kit.</li>
		<li>Using the purified PCR product as a template, in vitro transcribe and purify dsRNA using an in vitro transcription and purification kit.</li>
	</ol>
	</li>
	<li>Transfection of dsRNA or plasmid DNA into LD652 cells
	<ol>
		<li>Seed 1 x 105 cells/well of a 24-well plate and let the cells settle for at least 1 h.</li>
		<li>For each well to be transfected, dilute 4 &#956;L of transfection reagent into 100 &#956;L of SFM. Incubate for up to 15 min at room temperature. This can be scaled to make a master mix for all transfections to be performed.</li>
		<li>Dilute up to 1 &#956;g of dsRNA or total plasmid DNA with 100 &#956;L of SFM for each well to be transfected. Incubate for up to 15 min at room temperature. 
		NOTE: We have previously found that a transfection of 1 &#956;g of dsRNA/105 LD652 cells is sufficient for &#62;80% knockdown of either viral or host transcripts13, but dsRNA doses needed for modified experimental set-ups/conditions will have to be determined empirically.</li>
		<li>Combine transfection reagent and dsRNA/plasmid DNA dilutions with a 1:1 ratio (e.g., 100 &#956;L of diluted dsRNA is mixed with 100 &#956;L of diluted transfection reagent) and incubate for 20 min at room temperature.</li>
		<li>Meanwhile, wash the wells with 1 mL/well of SFM, and then add 500 &#956;L of SFM to each well.</li>
		<li>Slowly add the transfection reagent dsRNA (or plasmid DNA) mixture dropwise into each well.</li>
		<li>Incubate the transfection reagent with the cells for 5 h.
		<ol>
			<li>For RNAi experiments involving the knockdown of transcripts encoded by a coinfecting virus (e.g., VACV), replace the transfection reagent after the 5-h transfection incubation period with virus inoculum containing VSV-LUC (with or without VACV or another coinfecting virus) (step 3). Subsequently, replace the virus inoculum containing VSV-LUC with complete growth media 2 hpi. LUC assays (step 4) can then be performed on extracted lysates at various time points to determine if the knockdown of coinfecting virus transcripts leads to a loss of VSV-LUC rescue.</li>
			<li>For RNAi experiments involving RNAi of L. dispar transcripts, replace the transfection mix with complete growth media and allow knockdown to ensue for 24 h prior to infection with VSV-LUC (step 4). LUC assays (step 4) can then be performed on extracted lysates at various time points to determine if the knockdown of L. dispar transcripts promotes VSV-LUC rescue.</li>
			<li>For experiments involving transfections of plasmid expression vectors expressing candidate immunomodulators, replace the transfection reagent and allow for protein expression for 24 h prior to the infection with VSV-LUC (step 4). LUC assays (step 4) can then be performed on extracted lysates at various time points to determine if the expression of candidate immunomodulatory proteins promotes VSV-LUC rescue. 
			NOTE: The transfection conditions described here using 1 &#956;g/well of plasmid DNA result in transfection efficiencies of 40&#8211;60%13.</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Nomaguchi, M., Fujita, M., Miyazaki, Y., Adachi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+tropism.">Viral tropism.</a> Frontiers in Microbiology. 3, 281 (2012).</li><li>Werden, S. J., McFadden, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+cell+signaling+in+poxvirus+tropism:+the+case+of+the+M-T5+host+range+protein+of+myxoma+virus.">The role of cell signaling in poxvirus tropism: the case of the M-T5 host range protein of myxoma virus.</a> Biochimica et Biophysica Acta (BBA) - Bioenergetics. 1784 (1), 228-237 (2008).</li><li>McFadden, G., Mohamed, M. R., Rahman, M. M., Bartee, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytokine+determinants+of+viral+tropism.">Cytokine determinants of viral tropism.</a> Nature Reviews: Immunology. 9 (9), 645-655 (2009).</li><li>Silva, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Second-generation+shRNA+libraries+covering+the+mouse+and+human+genomes.">Second-generation shRNA libraries covering the mouse and human genomes.</a> Nature Genetics. 37 (11), 1281-1288 (2005).</li><li>Moffat, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+lentiviral+RNAi+library+for+human+and+mouse+genes+applied+to+an+arrayed+viral+high-content+screen.">A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen.</a> Cell. 124 (6), 1283-1298 (2006).</li><li>Ma, D., Liu, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+Editing+and+Its+Applications+in+Model+Organisms.">Genome Editing and Its Applications in Model Organisms.</a> Genomics Proteomics Bioinformatics. 13 (6), 336-344 (2015).</li><li>Yin, H., Kauffman, K. J., Anderson, D. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delivery+technologies+for+genome+editing.">Delivery technologies for genome editing.</a> Nature Reviews: Drug Discovery. 16 (6), 387-399 (2017).</li><li>Hao, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drosophila+RNAi+screen+identifies+host+genes+important+for+influenza+virus+replication.">Drosophila RNAi screen identifies host genes important for influenza virus replication.</a> Nature. 454 (7206), 890-893 (2008).</li><li>Houzet, L., Jeang, K. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+screening+using+RNA+interference+to+study+host+factors+in+viral+replication+and+pathogenesis.">Genome-wide screening using RNA interference to study host factors in viral replication and pathogenesis.</a> Experimental Biology and Medicine. 236 (8), 962-967 (2011).</li><li>Marceau, C. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+dissection+of+Flaviviridae+host+factors+through+genome-scale+CRISPR+screens.">Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens.</a> Nature. 535 (7610), 159-163 (2016).</li><li>Savidis, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+Zika+Virus+and+Dengue+Virus+Dependency+Factors+using+Functional+Genomics.">Identification of Zika Virus and Dengue Virus Dependency Factors using Functional Genomics.</a> Cell Reports. 16 (1), 232-246 (2016).</li><li>Panda, D., Cherry, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-based+genomic+screening:+elucidating+virus-host+interactions.">Cell-based genomic screening: elucidating virus-host interactions.</a> Current Opinion in Virology. 2 (6), 784-792 (2012).</li><li>Gammon, D. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single+vertebrate+DNA+virus+protein+disarms+invertebrate+immunity+to+RNA+virus+infection.">A single vertebrate DNA virus protein disarms invertebrate immunity to RNA virus infection.</a> Elife. 3, (2014).</li><li>Letchworth, G. J., Rodriguez, L. L., Del cbarrera, ., J, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vesicular+stomatitis.">Vesicular stomatitis.</a> Veterinary Journal. 157 (3), 239-260 (1999).</li><li>Whelan, S. P., Ball, L. A., Barr, J. N., Wertz, G. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+recovery+of+infectious+vesicular+stomatitis+virus+entirely+from+cDNA+clones.">Efficient recovery of infectious vesicular stomatitis virus entirely from cDNA clones.</a> Proceedings of the National Academy of Sciences of the United States of America. 92 (18), 8388-8392 (1995).</li><li>Cureton, D. K., Massol, R. H., Saffarian, S., Kirchhausen, T. L., Whelan, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vesicular+stomatitis+virus+enters+cells+through+vesicles+incompletely+coated+with+clathrin+that+depend+upon+actin+for+internalization.">Vesicular stomatitis virus enters cells through vesicles incompletely coated with clathrin that depend upon actin for internalization.</a> PLoS Pathogens. 5 (4), e1000394 (2009).</li><li>Duntsch, C. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recombinant+vesicular+stomatitis+virus+vectors+as+oncolytic+agents+in+the+treatment+of+high-grade+gliomas+in+an+organotypic+brain+tissue+slice-glioma+coculture+model.">Recombinant vesicular stomatitis virus vectors as oncolytic agents in the treatment of high-grade gliomas in an organotypic brain tissue slice-glioma coculture model.</a> Journal of Neurosurgery. 100 (6), 1049-1059 (2004).</li><li>Li, Y., Yuan, S., Moyer, R. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+non-permissive+infection+of+insect+(gypsy+moth)+LD-652+cells+by+Vaccinia+virus.">The non-permissive infection of insect (gypsy moth) LD-652 cells by Vaccinia virus.</a> Virology. 248 (1), 74-82 (1998).</li><li>Seet, B. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Poxviruses+and+immune+evasion.">Poxviruses and immune evasion.</a> Annual Review of Immunology. 21, 377-423 (2003).</li><li>Cotter, C. A., Earl, P. L., Wyatt, L. S., Moss, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+Cell+Cultures+and+Vaccinia+Virus+Stocks.">Preparation of Cell Cultures and Vaccinia Virus Stocks.</a> Current Protocols in Microbiology. 39, 11-18 (2015).</li><li>Andrei, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cidofovir+resistance+in+vaccinia+virus+is+linked+to+diminished+virulence+in+mice.">Cidofovir resistance in vaccinia virus is linked to diminished virulence in mice.</a> Journal of Virology. 80 (19), 9391-9401 (2006).</li><li>Dascher, C., VanSlyke, J. K., Thomas, L., Balch, W. E., Thomas, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+recombinant+vaccinia+virus+for+expression+of+small+GTPases.">Preparation of recombinant vaccinia virus for expression of small GTPases.</a> Methods in Enzymology. , 174-188 (1995).</li><li>Martin, A., Rex, E. A., Ishidate, T., Lin, R., Gammon, D. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Infection+of+Caenorhabditis+elegans+with+Vesicular+Stomatitis+Virus+via+Microinjection.">Infection of Caenorhabditis elegans with Vesicular Stomatitis Virus via Microinjection.</a> Bio-Protocol. 7 (22), (2017).</li><li>Luker, K. E., Hutchens, M., Schultz, T., Pekosz, A., Luker, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bioluminescence+imaging+of+vaccinia+virus:+effects+of+interferon+on+viral+replication+and+spread.">Bioluminescence imaging of vaccinia virus: effects of interferon on viral replication and spread.</a> Virology. 341 (2), 284-300 (2005).</li><li>Rozelle, D. K., Filone, C. M., Dower, K., Connor, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaccinia+reporter+viruses+for+quantifying+viral+function+at+all+stages+of+gene+expression.">Vaccinia reporter viruses for quantifying viral function at all stages of gene expression.</a> Journal of Visualizes Experiments. (87), e51522 (2014).</li><li>Cao, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+the+transcriptome+of+the+Asian+gypsy+moth+Lymantria+dispar+identifies+numerous+transcripts+associated+with+insecticide+resistance.">Characterization of the transcriptome of the Asian gypsy moth Lymantria dispar identifies numerous transcripts associated with insecticide resistance.</a> Pesticide Biochemistry and Physiology. 119, 54-61 (2015).</li><li>Sparks, M. E., Blackburn, M. B., Kuhar, D., Gundersen-Rindal, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptome+of+the+Lymantria+dispar+(gypsy+moth)+larval+midgut+in+response+to+infection+by+Bacillus+thuringiensis.">Transcriptome of the Lymantria dispar (gypsy moth) larval midgut in response to infection by Bacillus thuringiensis.</a> PloS One. 8 (5), e61190 (2013).</li><li>Sparks, M. E., Gundersen-Rindal, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Lymantria+dispar+IPLB-Ld652Y+cell+line+transcriptome+comprises+diverse+virus-associated+transcripts.">The Lymantria dispar IPLB-Ld652Y cell line transcriptome comprises diverse virus-associated transcripts.</a> Viruses. 3 (11), 2339-2350 (2011).</li><li>Lin, G., Li, G., Granados, R. R., Blissard, G. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable+cell+lines+expressing+baculovirus+P35:+resistance+to+apoptosis+and+nutrient+stress,+and+increased+glycoprotein+secretion.">Stable cell lines expressing baculovirus P35: resistance to apoptosis and nutrient stress, and increased glycoprotein secretion.</a> In Vitro Cellular &amp; Developmental Biology - Animal. 37 (5), 293-302 (2001).</li><li>Li, W. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interferon+antagonist+proteins+of+influenza+and+vaccinia+viruses+are+suppressors+of+RNA+silencing.">Interferon antagonist proteins of influenza and vaccinia viruses are suppressors of RNA silencing.</a> Proceedings of the National Academy of Sciences of the United States of America. 101 (5), 1350-1355 (2004).</li><li>Kanost, M. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multifaceted+biological+insights+from+a+draft+genome+sequence+of+the+tobacco+hornworm+moth,+Manduca+sexta.">Multifaceted biological insights from a draft genome sequence of the tobacco hornworm moth, Manduca sexta.</a> Insect Biochemistry and Molecular Biology. 76, 118-147 (2016).</li><li>Paixao, E. S., Teixeira, M. G., Rodrigues, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika,+chikungunya+and+dengue:+the+causes+and+threats+of+new+and+re-emerging+arboviral+diseases.">Zika, chikungunya and dengue: the causes and threats of new and re-emerging arboviral diseases.</a> BMJ Global Health. 3, (2018).</li></ol>

The authors have nothing to disclose.

Here we have described simple fluorescence- and luminescence-based assays to screen for conditions that rescue VSV replication in restrictive lepidopteran cell cultures. The abortive infection of VSV in lepidopteran cells creates an excellent signal-to-noise ratio when assaying for VSV gene expression. For example, the LU signals detected in lysates from single VSV-LUC infections were ~1,000-fold higher than in mock-infected lysates, yet these signals only changed approximately twofold over a 72-h time course. In contras...

The ability of a virus to productively replicate in a particular host is in part governed by the availability of host cell factors that support viral entry and replication1. The virus-host range can also be dictated by the capacity of a virus to counter cellular antiviral defenses that would otherwise impede viral replication2,3. It is the outcome of these complex virus-host interactions that ultimately decide whether a virus will be able to complete its life cycle in a particular host. Given the potentially pathogenic consequences for the host if viral replication ensues, it is critical to develop experimental strategies to further our understanding of the key virus-host interactions that may tip the balance between abortive and productive infections. Elucidating the molecular features of virus-host interplay will be instrumental in the development of new and alternative antiviral therapeutic strategies.
With the advent of RNA interference (RNAi)4,5 and genome-editing tools (e.g., CRISPR-Cas9, Zinc finger nucleases, TALENs)6,7, it has become experimentally feasible to alter the expression of cellular factors on genome-wide scales and explore the impact of these alterations on virus replication. Indeed, numerous RNAi and genome-editing-based screens have been conducted in invertebrate and vertebrate host cell types that have unveiled new facets of virus-host interactions8,9,10,11,12. These screens typically employ viruses encoding reporters, such as firefly luciferase (LUC) or fluorescent proteins (e.g., GFP, DsRed), that provide convenient means of quantitatively assessing viral gene expression as a readout for viral replication9,12. This strategy allows researchers to identify host factors that either promote or antagonize viral replication as evidenced by increases or decreases, respectively, in viral reporter signals9,12. However, in the vast majority of cases, these screens have been conducted using viruses that are well-adapted to the host cell type in which they are being studied. While this strategy can be important for understanding coevolutionary relationships between viral pathogens and their natural hosts, it does pose fundamental concerns regarding their use in uncovering host antiviral factors. In these cases, an enhancement in virus reporter signal upon RNAi knockdown is being looked for, or the inactivation of a cellular factor that normally impedes viral replication. First, if a virus is already able to robustly replicate in the host cell being examined under control conditions, the dynamic range of the screen (i.e., the ability to distinguish between background and enhanced viral reporter signals) may be limited. Second, this issue is further compounded by the situations in which the virus is well-adapted to the host cell and effective at countering host defense pathways that are being targeted in the screen.
Due to the above concerns regarding traditional virus-host interaction screening methods, we developed a new paradigm for studying virus-host interactions that exploit naturally abortive arbovirus infections in lepidopteran insect cells. This strategy derives from an observation that the well-studied human arbovirus, VSV, undergoes an abortive infection in cells derived from the gypsy moth (L. dispar)13. VSV is naturally transmitted by dipteran insects (i.e., sand flies) to mammalian hosts, and has been shown experimentally to infect a wide range of invertebrate and vertebrate hosts both in cell culture and in vivo14. The 11-kb negative-sense single-stranded RNA genome of VSV encodes five subgenomic mRNAs that are each translated into the proteins that make up the enveloped virion. However, VSV reverse genetic systems have allowed for the creation of replication-competent strains encoding LUC or fluorescent proteins, in addition to the five natural VSV gene products15,16,17. Because these reporter proteins are not incorporated into the VSV virion, they provide a convenient readout for VSV gene expression that occurs post-entry. Using VSV strains encoding GFP or LUC, we have previously shown that VSV gene expression is severely restricted upon the entry of LD652 cells and that VSV titers do not increase by 72 hours post-infection (hpi). In contrast, the coinfection of LD652 cells with VSV and the mammalian poxvirus, vaccinia virus (VACV), leads to logarithmic increases in both VSV gene expression and titers by this time point. VACV undergoes early gene expression, DNA replication, and late gene expression in LD652 cell infections, but the VACV replication cycle is ultimately abortive due to incomplete virion morphogenesis18. The large ~192-kb DNA genome of VACV encodes &#62; 200 proteins, many of which display immunomodulatory properties that promote viral replication through the suppression of host immune responses19. Therefore, we hypothesized that the &#34;rescue&#34; of VSV replication in LD652 cells by VACV coinfection was likely mediated by VACV immunomodulators that inhibited L. dispar responses normally restricting VSV replication. In support of this, the treatment of LD652 cells with the host RNA polymerase II inhibitor actinomycin D also rescues VSV replication in LD652 cells, indicating that the transcription-dependent host responses block VSV replication post-entry13.
The above observations suggest that the naturally restrictive nature of LD652 cells to VSV infection may provide a relatively low background when screening for the conditions that enhance VSV-encoded reporter signals (i.e., those that inhibit host antiviral defenses). Here, we provide the methods for using fluorescence or LUC-based assays to screen for conditions that relieve VSV restriction in lepidopteran cells. First, we show how these assays can be used to identify virally encoded immunomodulatory factors that break VSV restriction during either coinfection experiments or through ectopic expression of candidate viral factors. As an example, we illustrate how we used these screening techniques to identify poxvirus-encoded A51R proteins as a new family of immunomodulatory factors that rescue VSV replication in the absence of other poxvirus factors13. Second, we illustrate how RNAi screening in restrictive VSV-LD652 cell infections can be used to directly identify eukaryotic host factors involved in arbovirus restriction13.

<table><tbody><tr><td>6-well tissue culture plates</td><td>CELLTREAT</td><td>229106</td><td></td></tr><tr><td>24-well tissue culture plates</td><td>CELLTREAT</td><td>229124</td><td></td></tr><tr><td>10 cm tissue culture dishes</td><td>Corning</td><td>C430167</td><td></td></tr><tr><td>Grace&amp;rsquo;s Insect Medium</td><td>Sigma</td><td>G8142</td><td></td></tr><tr><td>EX-CELL 420</td><td>Sigma</td><td>14420C</td><td></td></tr><tr><td>Fetal Bovine Serum - Optima</td><td>Atlanta Biologicals</td><td>S12450</td><td></td></tr><tr><td>Growth medium</td><td></td><td></td><td>1:1 mixture of Grace&#039;s Insect Medium and EX-Cell 420 Serum-Free Medium also containing 1% antibiotic-antimycotic solution and 10% Fetal bovine serum</td></tr><tr><td>Antibiotic-Antimycotic Solution (100&amp;times;)</td><td>Sigma</td><td>A5955</td><td></td></tr><tr><td>Dulbecco&amp;rsquo;s Phosphate Buffered Saline (DPBS)</td><td>Sigma</td><td>D8662</td><td></td></tr><tr><td>Serum Free Media (SFM)</td><td>Thermo Fisher</td><td>10902096</td><td></td></tr><tr><td>Cytosine arabinoside</td><td>Sigma</td><td>C1768</td><td></td></tr><tr><td>Transfection reagent</td><td>Thermo Fisher</td><td>10362100</td><td></td></tr><tr><td>Corning cellgro DMSO (Dimethyl Sulfoxide)</td><td>Corning</td><td>25950CQC</td><td></td></tr><tr><td>Reporter lysis buffer 5x</td><td>Promega</td><td>E3971</td><td></td></tr><tr><td>Luciferase Assay Reagent</td><td>Promega</td><td>E1483</td><td></td></tr><tr><td>96-Well Microplates</td><td>Corning</td><td>3915</td><td></td></tr><tr><td>Mouse anti-FLAG antibody</td><td>Wako</td><td>014-22383</td><td></td></tr><tr><td>Rabbit anti-firefly luciferase antibody</td><td>Abcam</td><td>ab21176</td><td></td></tr><tr><td>Mouse anti-actin antibody</td><td>Sigma</td><td>A2066</td><td></td></tr><tr><td>Mouse anti-VSV M</td><td>N/A</td><td>N/A</td><td>Dr. John Connor (Boston University)</td></tr><tr><td>Mouse anti-VACV I3L</td><td>N/A</td><td>N/A</td><td>Dr. David Evans (University of Alberta)</td></tr><tr><td>8-well Chambered dish</td><td>Lab-Tek II</td><td>155409</td><td></td></tr><tr><td>Cell viability dye</td><td>Thermo Fisher</td><td>C12881</td><td></td></tr><tr><td>FLUOstar microplate reader</td><td>BMG Labtech</td><td>FLUOstar</td><td></td></tr><tr><td>Confocal microscope</td><td>Olympus</td><td>FV10i-LIV</td><td></td></tr><tr><td>Image analysis software</td><td>Olympus</td><td>v1.18</td><td>cellSens software</td></tr><tr><td>Eppendorf 5702 ventilated centrifuge</td><td>Eppendorf</td><td>22628102</td><td></td></tr><tr><td>Odyssey Fc Infrared Imaging System</td><td>Li-COR Biosciences</td><td>Odyssey Fc</td><td></td></tr><tr><td>LD652 cells</td><td>N/A</td><td>N/A</td><td>Dr. Basil Arif (Natural Resources Canada)</td></tr><tr><td>BSC-40 cells</td><td>ATCC</td><td>CRL-2761</td><td></td></tr><tr><td>BHK cells</td><td>ATCC</td><td>CCL-10</td><td></td></tr><tr><td>HeLa cells</td><td>ATCC</td><td>CCL-2</td><td></td></tr><tr><td>BSC-1 cells</td><td>ATCC</td><td>CCL-26</td><td></td></tr><tr><td>&lt;em&gt;in vitro&lt;/em&gt; transcription and purification kit</td><td>Thermo Fisher</td><td>AM1626</td><td></td></tr><tr><td>PCR purification kit</td><td>Qiagen</td><td>28104</td><td></td></tr></tbody></table>

arbovirus infections as screening tools for the identification of viral immunomodulators and host antiviral factors

RNA interference- and genome editing-based screening platforms have been widely used to identify host cell factors that restrict virus replication. However, these screens are typically conducted in cells that are naturally permissive to the viral pathogen under study. Therefore, the robust replication of viruses in control conditions may limit the dynamic range of these screens. Furthermore, these screens may be unable to easily identify cellular defense pathways that restrict virus replication if the virus is well-adapted to the host and capable of countering antiviral defenses. In this article, we describe a new paradigm for exploring virus-host interactions through the use of screens that center on naturally abortive infections by arboviruses such as vesicular stomatitis virus (VSV). Despite the ability of VSV to replicate in a wide range of dipteran insect and mammalian hosts, VSV undergoes a post-entry, abortive infection in a variety of cell lines derived from lepidopteran insects, such as the gypsy moth (Lymantria dispar). However, these abortive VSV infections can be &#34;rescued&#34; when host cell antiviral defenses are compromised. We describe how VSV strains encoding convenient reporter genes and restrictive L. dispar cell lines can be paired to set-up screens to identify host factors involved in arbovirus restriction. Furthermore, we also show the utility of these screening tools in the identification of virally encoded factors that rescue VSV replication during coinfection or through ectopic expression, including those encoded by mammalian viruses. The natural restriction of VSV replication in L. dispar cells provides a high signal-to-noise ratio when screening for the conditions that promote VSV rescue, thus enabling the use of simplistic luminescence- and fluorescence-based assays to monitor the changes in VSV replication. These methodologies are valuable for understanding the interplay between host antiviral responses and viral immune evasion factors.

As an example of live-cell imaging applications to monitor VSV rescue upon VACV coinfection, LD652 cells were plated in an 8-well chambered dish and then mock-infected or infected with VSV-DsRed (MOI = 1) in the presence or absence of VACV-FL-GFP (MOI = 25). Because VSV-DsRed expresses DsRed as a free protein and is not fused to structural VSV proteins (Figure 1A), it is only detected after VSV entry and gene expression initiates. All cells were then labeled ...

Watch this Scientific Journal Video about Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors at JoVE.com

Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors

Here, we present the protocols to identify 1) virus-encoded immunomodulators that promote arbovirus replication and 2) eukaryotic host factors that restrict arbovirus replication. These fluorescence- and luminescence-based methods allow researchers to rapidly obtain quantitative readouts of arbovirus replication in simplistic assays with low signal-to-noise ratios.

RNA interference- and genome editing-based screening platforms have been widely used to identify host cell factors that restrict virus replication. ...

arbovirus-infections-as-screening-tools-for-identification-viral

Research

JoVE Journal

Immunology and Infection

6.8K Views.  University of Texas Southwestern Medical Center. Here, we present the protocols to identify 1) virus-encoded immunomodulators that promote arbovirus replication and 2) eukaryotic host factors that restrict arbovirus replication. These fluorescence- and luminescence-based methods allow researchers to rapidly obtain quantitative readouts of arbovirus replication in simplistic assays with low signal-to-noise ratios.

Video: Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Viral pathogens represent a significant public health threat; not only can viruses cause natural epidemics of human disease, but their potential use in bioterrorism is also a concern. A better understanding of the cellular factors that impact infection would facilitate the development of much-needed therapeutics. Recent advances in RNA interference (RNAi) technology coupled with complete genome sequencing of several organisms has led to the optimization of genome-wide, cell-based loss-of-function screens. Drosophila cells are particularly amenable to genome-scale screens because of the ease and efficiency of RNAi in this system 1. Importantly, a wide variety of viruses can infect Drosophila cells, including a number of mammalian viruses of medical and agricultural importance 2,3,4. Previous RNAi screens in Drosophila have identified host factors that are required for various steps in virus infection including entry, translation and RNA replication 5. Moreover, many of the cellular factors required for viral replication in Drosophila cell culture are also limiting in human cells infected with these viruses 4,6,7,8, 9. Therefore, the identification of host factors co-opted during viral infection presents novel targets for antiviral therapeutics. Here we present a generalized protocol for a high-throughput RNAi screen to identify cellular factors involved in viral infection, using vaccinia virus as an example.

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Novel host factors involved in viral infection can be identified through cell-based genome-wide loss of function RNAi screening. A Drosophila cell culture model is particularly amenable to this approach due to the ease and efficiency of RNAi. Here we demonstrate this technique using vaccinia virus as an example.

Viral pathogens represent a significant public health threat; not only can viruses cause natural epidemics of human disease, but their potential use in ...

Using a Pan-Viral Microarray Assay (Virochip) to Screen Clinical Samples for Viral Pathogens

The diagnosis of viral causes of many infectious diseases is difficult due to the inherent sequence diversity of viruses as well as the ongoing emergence of novel viral pathogens, such as SARS coronavirus and 2009 pandemic H1N1 influenza virus, that are not detectable by traditional methods. To address these challenges, we have previously developed and validated a pan-viral microarray platform called the Virochip with the capacity to detect all known viruses as well as novel variants on the basis of conserved sequence homology1. Using the Virochip, we have identified the full spectrum of viruses associated with respiratory infections, including cases of unexplained critical illness in hospitalized patients, with a sensitivity equivalent to or superior to conventional clinical testing2-5. The Virochip has also been used to identify novel viruses, including the SARS coronavirus6,7, a novel rhinovirus clade5, XMRV (a retrovirus linked to prostate cancer)8, avian bornavirus (the cause of a wasting disease in parrots)9, and a novel cardiovirus in children with respiratory and diarrheal illness10. The current version of the Virochip has been ported to an Agilent microarray platform and consists of ~36,000 probes derived from over ~1,500 viruses in GenBank as of December of 2009. Here we demonstrate the steps involved in processing a Virochip assay from start to finish (~24 hour turnaround time), including sample nucleic acid extraction, PCR amplification using random primers, fluorescent dye incorporation, and microarray hybridization, scanning, and analysis.

Using a Pan-Viral Microarray Assay Virochip to Screen Clinical Samples for Viral Pathogens

The Virochip is a pan-viral microarray designed to simultaneously detect all known viruses as well as novel viruses on the basis of conserved sequence homology. Here we demonstrate how to run a Virochip assay to analyze clinical samples for the presence of both known and unknown viruses.

The diagnosis of viral causes of many infectious diseases is difficult due to the inherent sequence diversity of viruses as well as the ongoing emergence ...

Genome-wide RNAi Screening to Identify Host Factors That Modulate Oncolytic Virus Therapy

High-throughput genome-wide RNAi (RNA interference) screening technology has been widely used for discovering host factors that impact&#160;virus replication. Here we present the application of this technology to uncovering host targets that specifically modulate the replication of Maraba virus, an oncolytic rhabdovirus, and vaccinia virus with the goal of enhancing therapy. While the protocol has been tested for use with oncolytic Maraba virus and oncolytic vaccinia virus, this approach is applicable to other oncolytic viruses and can also be utilized for identifying host targets that modulate virus replication in mammalian cells in general. This protocol describes the development and validation of an assay for high-throughput RNAi screening in mammalian cells, the key considerations and preparation steps important for conducting a primary high-throughput RNAi screen, and a step-by-step guide for conducting a primary high-throughput RNAi screen; in addition, it broadly outlines the methods for conducting secondary screen validation and tertiary validation studies. The benefit of high-throughput RNAi screening is that it allows one to catalogue, in an extensive and unbiased fashion, host factors that modulate any aspect of virus replication for which one can develop an in vitro assay such as infectivity, burst size, and cytotoxicity. It has the power to uncover biotherapeutic targets unforeseen based on current knowledge.

Here we describe a protocol for employing high-throughput RNAi screening to uncover host targets that can be manipulated to enhance oncolytic virus therapy, specifically rhabodvirus and vaccinia virus therapy, but it can be readily adapted to other oncolytic virus platforms or for discovering host genes that modulate virus replication generally.

High-throughput genome-wide RNAi (RNA interference) screening technology has been widely used for discovering host factors that impact&#160;virus ...

Cancer Research

Assays for the Identification of Novel Antivirals against Bluetongue Virus

To identify potential antivirals against BTV, we have developed, optimized and validated three assays presented here. The CPE-based assay was the first assay developed to evaluate whether a compound showed any antiviral efficacy and have been used to screen large compound library. Meanwhile, cytotoxicity of antivirals could also be evaluated using the CPE-based assay. The dose-response assay was designed to determine the range of efficacy for the selected antiviral, i.e. 50% inhibitory concentration (IC50) or effective concentration (EC50), as well as its range of cytotoxicity (CC50). The ToA assay was employed for the initial MoA study to determine the underlying mechanism of the novel antivirals during BTV viral lifecycle or the possible effect on host cellular machinery. These assays are vital for the evaluation of antiviral efficacy in cell culture system, and have been used for our recent researches leading to the identification of a number of novel antivirals against BTV.

Three assays, including the cytopathic effect (CPE)-based assay, dose-response assay and Time-of-Addition (ToA) assay have been developed, optimized, validated and utilized to identify novel antivirals against Bluetongue virus (BTV), as well as to determine the possible Mechanism-of-Action (MoA) for newly identified antivirals.

To identify potential antivirals against BTV, we have  developed, optimized and validated three assays presented here. The CPE-based  assay was the first ...

High-throughput Screening for Broad-spectrum Chemical Inhibitors of RNA Viruses

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat because of increased worldwide exchanges and human populations penetrating more and more natural ecosystems. A good example of such an emerging situation is chikungunya virus epidemics of 2005-2006 in the Indian Ocean. Recent progresses in our understanding of cellular pathways controlling viral replication suggest that compounds targeting host cell functions, rather than the virus itself, could inhibit a large panel of RNA viruses. Some broad-spectrum antiviral compounds have been identified with host target-oriented assays. However, measuring the inhibition of viral replication in cell cultures using reduction of cytopathic effects as a readout still represents a paramount screening strategy. Such functional screens have been greatly improved by the development of recombinant viruses expressing reporter enzymes capable of bioluminescence such as luciferase. In the present report, we detail a high-throughput screening pipeline, which combines recombinant measles and chikungunya viruses with cellular viability assays, to identify compounds with a broad-spectrum antiviral profile.

In vitro assays to measure virus replication have been greatly improved by the development of recombinant RNA viruses expressing luciferase or other enzymes capable of bioluminescence. Here we detail a high-throughput screening pipeline that combines such recombinant strains of measles and chikungunya viruses to isolate broad-spectrum antivirals from chemical libraries.

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat ...

Vaccinia Reporter Viruses for Quantifying Viral Function at All Stages of Gene Expression

Poxviruses are a family of double stranded DNA viruses that include active human pathogens such as monkeypox, molluscum contagiousum, and Contagalo virus. The family also includes the smallpox virus, Variola. Due to the complexity of poxvirus replication, many questions still remain regarding their gene expression strategy. In this article we describe the conceptualization and usage of recombinant vaccinia viruses that enable real-time measurement of single and multiple stages of viral gene expression in a high-throughput format. This is enabled through the use of spectrally distinct fluorescent proteins as reporters for each of three stages of viral replication. These viruses provide a high signal-to-noise ratio while retaining stage specific expression patterns, enabling plate-based assays and microscopic observations of virus propagation and replication. These tools have uses for antiviral discovery, studies of the virus-host interaction, and evolutionary biology.

We describe the usage of a fluorescent reporter vaccinia virus that enables real-time measurement of viral infectivity and gene expression through the stage-specific expression of spectrally distinct reporter fluorophores. We detail a plate-based method for accurately identifying the stage at which virus replication is affected in response to small molecule inhibition.

Poxviruses are a family of double stranded DNA viruses that include active human pathogens such as monkeypox, molluscum contagiousum, and Contagalo virus. ...

Early Viral Entry Assays for the Identification and Evaluation of Antiviral Compounds

Cell-based systems are useful for discovering antiviral agents. Dissecting the viral life cycle, particularly the early entry stages, allows a mechanistic approach to identify and evaluate antiviral agents that target specific steps of the viral entry. In this report, the methods of examining viral inactivation, viral attachment, and viral entry/fusion as antiviral assays for such purposes are described, using hepatitis C virus as a model. These assays should be useful for discovering novel antagonists/inhibitors to early viral entry and help expand the scope of candidate antiviral agents for further drug development.

Here, we present a protocol that examines specific steps of the viral entry to identify and evaluate novel antiviral agents.

Cell-based systems are useful for discovering antiviral agents. Dissecting the viral life cycle, particularly the early entry stages, allows a mechanistic ...

Isolation and Quantification of Zika Virus from Multiple Organs in a Mouse

The methods being presented demonstrate laboratory procedures for the isolation of organs from Zika virus infected animals and the quantification of viral load. The purpose of the procedure is to quantify viral titers in peripheral and CNS areas of the mouse at different time points post infection or under different experimental conditions to identify virologic and immunological factors that regulate Zika virus infection. The organ isolation procedures demonstrated allow for both focus forming assay quantification and quantitative PCR assessment of viral titers. The rapid organ isolation techniques are designed for the preservation of virus titer. Viral titer quantification by focus forming assay allows for the rapid throughput assessment of Zika virus. The benefit of the focus forming assay is the assessment of infectious virus, the limitation of this assay is the potential for organ toxicity reducing the limit of detection. Viral titer assessment is combined with quantitative PCR, and using a recombinant RNA copy control viral genome copy number within the organ is assessed with low limit of detection. Overall these techniques provide an accurate rapid high throughput method for the analysis of Zika viral titers in the periphery and CNS of Zika virus infected animals and can be applied to the assessment of viral titers in the organs of animals infected with most pathogens, including Dengue virus.

The goal of the protocol is to demonstrate the techniques used to investigate viral disease by isolating and quantifying Zika virus, from multiple organs in a mouse following infection.

The methods being presented demonstrate laboratory procedures for the isolation of organs from Zika virus infected animals and the quantification of viral ...

Use of Viral Entry Assays and Molecular Docking Analysis for the Identification of Antiviral Candidates against Coxsackievirus A16

Antiviral assays that mechanistically examine viral entry are pertinent to discern at which step the evaluated agents are most effective, and allow for the identification of candidate viral entry inhibitors. Here, we present the experimental approaches for the identification of small molecules capable of blocking infection by the non-enveloped coxsackievirus A16 (CVA16) through targeting the virus particles or specific steps in early viral entry. Assays include the time-of-drug-addition analysis, flow cytometry-based viral binding assay, and viral inactivation assay. We also present a molecular docking protocol utilizing virus capsid proteins to predict potential residues targeted by the antiviral compounds. These assays should help in the identification of candidate antiviral agents that act on viral entry. Future directions can explore these possible inhibitors for further drug development.

The goal of the protocol is to illustrate the different assays relating to viral entry that can be used to identify candidate viral entry inhibitors.

Antiviral assays that mechanistically examine viral entry are pertinent to discern at which step the evaluated agents are most effective, and allow for ...

High-Throughput Transcriptome Analysis for Investigating Host-Pathogen Interactions

Pathogens can cause a wide variety of infectious diseases. The biological processes induced by the host in response to infection determine the severity of the disease.&#160;To study such processes, researchers can use high-throughput sequencing techniques (RNA-seq) that measure the dynamic changes of the host transcriptome at different stages of infection, clinical outcomes, or disease severity.This investigation can lead to a better understanding of the diseases, as well as uncovering potential drug targets and treatments. The protocol presented here describes a complete pipeline to analyze RNA-sequencing data from raw reads to functional analysis. The pipeline is divided into five steps: (1) quality control of the data; (2) mapping and annotation of genes; (3) statistical analysis to identify differentially expressed genes and co-expressed genes; (4) determination of the molecular degree of the perturbation of samples; and (5) functional analysis. Step 1 removes technical artifacts that may impact the quality of downstream analyses. In step 2, genes are mapped and annotated according to standard library protocols.&#160;The statistical analysis in step 3 identifies genes that are differentially expressed or co-expressed in infected samples, in comparison with non-infected ones. Sample variability and the presence of potential biological outliers are verified using the molecular degree of perturbation approach in step 4. Finally, the functional analysis in step 5 reveals the pathways associated with the disease phenotype. The presented pipeline aims to support researchers through the RNA-seq data analysis from host-pathogen interaction studies and drive future&#160;in vitro or in vivo experiments, that are essential to understand the molecular mechanism of infections.

The protocol presented here describes a complete pipeline to analyze RNA-sequencing transcriptome data from raw reads to functional analysis, including quality control and preprocessing steps to advanced statistical analytical approaches.

Pathogens can cause a wide variety of infectious diseases. The biological processes induced by the host in response to infection determine the severity of ...

Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Using a Pan-Viral Microarray Assay (Virochip) to Screen Clinical Samples for Viral Pathogens

Genome-wide RNAi Screening to Identify Host Factors That Modulate Oncolytic Virus Therapy

Assays for the Identification of Novel Antivirals against Bluetongue Virus

High-throughput Screening for Broad-spectrum Chemical Inhibitors of RNA Viruses

Vaccinia Reporter Viruses for Quantifying Viral Function at All Stages of Gene Expression

Early Viral Entry Assays for the Identification and Evaluation of Antiviral Compounds

Isolation and Quantification of Zika Virus from Multiple Organs in a Mouse

Use of Viral Entry Assays and Molecular Docking Analysis for the Identification of Antiviral Candidates against Coxsackievirus A16

High-Throughput Transcriptome Analysis for Investigating Host-Pathogen Interactions