Name: arbovirus infections as screening tools for the identification of viral immunomodulators and host antiviral factors
Uploaded: 2018-09-13T14:30:00.000+00:00
Duration: 6 min 2 s
Description: Watch this Scientific Journal Video about Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors at JoVE.com

D.G. University of Texas Southwestern Tıp Merkezi donatılmış akademisyenler programdan fon tarafından desteklenmiştir. Yazar Michael Whitt (Tennessee Üniversitesi Sağlık Bilimleri Merkezi) ve Sean Whelan (Harvard Medical School) VSV-DsRed ve VSV-LUC sağlanması için teşekkür ederiz. Yazarlar ayrıca Gary Luker (Michigan Üniversitesi Tıp Fakültesi) VACV-FL-GFP zorlanma tür hediye için teşekkür ederiz.

1. genel Lymantria dispar (LD652) hücre ile virüs kültür
<ol><li>
LD652 hücre kültürü çalışmalarının ve kaplama
	<ol>
<li>Kültürüne L. dispar-türetilmiş LD652 hücreleri, normal atmosfer altında 27 ° C'de inkübe bir büyüme orta (Tablo reçetesi) hücrelerinin monolayer korumak. 10 cm doku kültürü tedavi edilen yemekleri hücreleri korumak ve % 80 confluency ulaşan üzerine hücreleri geçiş.</li>
		<li>Plaka, plaka yapisan LD652 hücrelerden art arda (Bu hücreler trypsinization çıkarmak için gerekmez) monolayer üzerine medya pipetting tarafından çıkarmak ve örnek 1 x 105 hücre/mL yaklaşık bir yoğunluğunun büyüme medyada sulandırmak için. 1 mL sulandırılmış kültür/iyi bir 24-şey plaka pipet. En az üç Çoğalt kuyu/tedavi türü her zaman noktası (en fazla sekiz tedaviler/plaka) için tohum.</li>
		<li>Hücreleri en az 1 h için yerleşmek için izin verir.</li>
	</ol>
</li>
	<li>
Vaksinia virüs hazırlık
	<ol>
<li>VACV hisse senetleri hazırlamak mı, virüs HeLa içinde yükseltmek için20 hücreleri veya Afrika yeşil maymun böbrek hücreleri (lisans-1 veya BSC-40 hücreleri)20,21,22. Not: Burada açıklanan deneyleri içinde de VACV zorlanma Western Reserve (VACV-WR) çalışır.</li>
		<li>VACV zorlanma ile plak tahlil BSC-1 veya BSC-40 hücreleri20,22titre. Not: Tüm VACV çokluğu enfeksiyon (MOI) hücre enfeksiyonlar titreleri BSC-40 plak deneyleri elde edilen temel alan LD652 için burada açıklanan belirtti.</li>
	</ol>
</li>
	<li>
Vesicular Stomatit virüs hazırlık
	<ol>
<li>VSV stokları hazırlamak için virüs BHK hücreleri23yılında yükseltmek.</li>
		<li>Plak tahlil BSC-40 veya BHK hücre monolayers13,23tarafından VSV titre. Not: Tüm VSV MOIs hücre enfeksiyonlar titreleri BSC-40 plak deneyleri elde edilen temel alan LD652 için burada açıklanan.</li>
	</ol>
</li>
</ol>2. floresans tabanlı VSV kurtarma tahlil Co enfeksiyon ve canlı hücre düşsel kullanma
<ol><li>
Tohum ve enfeksiyon LD652 hücre
	<ol>
<li>40.000 LD652 hücreler/iyi bir 8-şey odasının plaka.</li>
		<li>Floresans tabanlı canlı hücre görüntüsü için VSV suşları floresan protein kodlama kullanmak. Burada sunulan deneyler VSV-DsRed17, diğer VSV protein için erimiş değil ücretsiz DsRed protein ifade eder bir rekombinant VSV yük kullanın. Not: VSV enfeksiyon LD652 hücre tarafından 96 HPI cytopathic değildir ve böylece, hücre ölümü bir karıştırıcı faktör bu zaman dilimi içinde VSV çoğaltma değerlendirirken değil.</li>
		<li>Serum ücretsiz bir medya (SFM; VSV-DsRed ve VACV-FL-GFP hazırlık Tablo malzeme) 1 ve 25, bir MOI, anılan sıraya göre. Not: VACV-FL-GFP LUC ve GFP24arasında bir füzyon ifade eder bir rekombinant VACV yük olduğunu. 25 veya daha büyük bir MOI VACV suşları için kullanarak tüm LD652 hücreleri enfekte13olmasını sağlar. Eğer farklı bir coinfecting virüs istimal, MOI ampirik olarak Kullanıcı tarafından belirlenecektir gerekir. Her enfeksiyon tedavi yinelenen wells ayarlanmalıdır ve sahte enfekte tedavi sadece SFM hücrelere eklenir içerir.</li>
		<li>İnoculum 27 ° C'de 2 h için 0.2 mL hücrelerde kuluçkaya</li>
		<li>Hücreleri 0.5 mL/büyüme ortamının iyi yıkayın.</li>
		<li>Hücre canlılığı boya (Tablo reçetesi) 25 mikron hücrelerde büyüme medya 27 ° C'de 45 dk için kuluçkaya</li>
		<li>Medya Aspire edin ve kuyu 1 yıkama x 0.5 mL/de fazla boya kaldırmak için.</li>
		<li>0.3 mL/de büyüme ortamının hücreleri korumak.</li>
	</ol>
</li>
	<li>
Canlı hücre görüntü yakalama
	<ol>
<li>Bir confocal mikroskop 30 dk önceden açmak ve bir 8-şey odası yemek yükleyin. Not: Oda sıcaklığında 20-25 ° C arasında değişen LD652 hücreleri görüntüsü, ama optimal koşullar için oda sıcaklığını 27 ° C'ye ayarlanması gerektiğini</li>
		<li>Yansıması için uygun uyarma/emisyon ayarları her floresan marker protein için hem de faz kontrast görüntü ayarlarını ayarlayın.</li>
		<li>Her kanal için lazer yoğunluğunu ayarlayın. Not: Bu son deneyde kullanılacak saat ders boyunca gözlenen floresan sinyal yoğunluklarda aralığını belirlemek için bir pilot deneme gerçekleştirme gerektirebilir.</li>
		<li>10 X objektif kullanarak istediğiniz zaman noktaya kadar enfeksiyon süresince her şey her 1 – 5 h faz kontrast ve floresan görüntülerini yakalamak (Örn., 48-72 HPI). Not: Enfeksiyon oranları kültür boyunca doğru bir şekilde tahmin etmek için her iyi görünümünde birden çok alan yakalamak önemlidir.</li>
	</ol>
</li>
	<li>
Görüntü Analizi
	<ol>
<li>Görüntü analiz yazılımı uygun floresan kanalları otomatik görüntü analizi için kullanın (Örn., 405 nm, 488 nm, 568 nm).</li>
		<li>Enfekte hücreleri yüzdesini hesaplamak için floresan hücreleri VSV enfeksiyon gösteren toplam sayısına bölün (e.g., DsRed-pozitif hücreler VSV-DsRed enfeksiyonlar için) tarafından hücre canlılığı boya için etiketli hücrelerin toplam sayısına göre tüm tedaviler arasında her alanı elde edersiniz.</li>
	</ol>
</li>
</ol>3. genel Viral enfeksiyon Protokolü VSV ışıldama tabanlı kurtarma deneyleri LD652 hücrelerdeki için
<ol><li>
İnoculum hazırlanması
	<ol>
<li>30 enfeksiyon önce tezcan stokları VSV-LUC16 (bir rekombinant VSV zorlanma ücretsiz ateş böceği luciferase protein diğer VSV protein için erimiş değil o ifade eder). VSV-LUC kurtarmak için VACV coinfection sırasında raporlaması, ayrıca VACV-WR virüs buz çözme. Not: Diğer virüsler (yanında VACV-WR) VSV-LUC coinfection sırasında kurtarmak, ancak bu ampirik olarak her kullanıcı tarafından belirlenecektir gerekir.</li>
		<li>Öyle ki bir MOI 10 ve 25, sırasıyla, 0.2 mL toplam inoculum hacmi ekleyerek elde edilir varlığı veya yokluğu VACV-WR SFM içine VSV-LUC sulandrarak inoculum hazırlamak/iyi.</li>
	</ol>
</li>
	<li>
Enfeksiyon hücreleri
	<ol>
<li>Dikkatle monolayer rahatsız edici önlemek için olgun LD652 medya Aspire edin ve virüs/iyi 0.2 mL ile aşılamak. Bu sefer 0 HPI tanımlanır. Steril SFM "sahte-enfekte" negatif kontrol tedaviler hizmet etmek için ek wells ekleyin.</li>
		<li>İnoculum 27 ° C'de 2 h için hücrelerde kuluçkaya</li>
		<li>2 HPI, at inoculum aspirasyon tarafından kaldırmak ve 1 mL ile değiştirmek/LD652 büyüme medya iyi.</li>
		<li>Enfeksiyon 24-72 HPI devam etmek izin verir.</li>
	</ol>
</li>
</ol>4. luciferase tahlil
<ol><li>
Hücre lysates hazırlanması
	<ol>
<li>Dikkatle süpernatant Aspire edin ve Dulbecco'nın fosfat tamponlu tuz çözeltisi (DPBS) 1 mL ekleyin / iyi.</li>
		<li>1 mL şırınga pistonu kullanarak, hücreleri DPBS kazı.</li>
		<li>Microcentrifuge tüp ve 4 ° C'de 20 dk 400 x g , santrifüj hücreleri transfer</li>
		<li>Bu arada, 5 gazeteci lizis arabellek (RLB) steril H2o x 1 x seyreltme hazırlamak</li>
		<li>Santrifüjü hücre Pelet bozmadan DPBS Aspire edin.</li>
		<li>Her pelet 1 150 µL içinde resuspend x RLB.</li>
		<li>Donma-çözülme oda sıcaklığında su banyosu içinde hızlı bir çözülme ardından bir-80 ° C dondurucu bir dakika 5 kuluçka kullanarak x örnekleri 1. -80 ° C'de lysates analiz etmek için hazır kadar saklayın.</li>
	</ol>
</li>
	<li>
Luciferase tahlil
	<ol>
<li>Lysates buz çözme.</li>
		<li>Bir katı siyah ya da beyaz 96-şey Mikroplaka bir kuyuya lysate, 20 μL pipet.</li>
		<li>Luciferase tahlil reaktif 100 μL her şey için ekleyin.</li>
		<li>Hemen bir luminometer kullanarak ışık yoğunluğunu ölçmek (belirli Luminometreler için uygun ayarları Kullanıcı tarafından ampirik olarak belirlenecek olacak).</li>
	</ol>
</li>
	<li>
Luciferase tahlil analiz
	<ol>
<li>LU sinyalleri kontrol tedavisi (Temsilcisi sonuçları) elde edilen LU okumalar her tedavi için normalleştirmek. En az üç bağımsız deneyler gerçekleştirdikten sonra LU her tedavi/kontrol grubundan elde edilen ortalama uygun istatistiksel testler tarafından çözümlenebilir.</li>
	</ol>
</li>
</ol>5. Immunoblot
<ol><li>SDS-sayfa ve uygun reaktifler ve Araçları'nı kullanarak sonraki immunoblotting için LUC deneyleri için çıkarılan lysates kullanın.</li>
</ol>6. LD652 hücre kültürlerden VSV titresi
<ol><li>LD652 hücreleri adım 1.1 göre plaka.</li>
	<li>Viral enfekte hücreleri göre adım 3.</li>
	<li>İstenen saat noktalarda supernatants steril microcentrifuge tüpler içine toplamak.</li>
	<li>4 ° C'de 10 dakika 1000 x g kullanarak hücreleri cips ve supernatants yeni tüpler için transfer.</li>
	<li>Supernatants-80 ° C'de depolayın veya plak tahlil BSC-40 hücreleri tarafından titrasyon ile devam edin. Not: VACV bulunan LD652 hücre kültürleri VSV titrating Eğer 2 HPI BSC-40 monolayers13tarihinde plaklar artık VACV parçacıklar önleyebilirsiniz, BSC-40 kültür ortamlara 100 μg/mL sitozin arabinoside (araç) eklemek için tavsiye edilir. Araç VACV DNA çoğaltma25 engeller, ancak VSV çoğaltmayı etkilemez bir viral DNA polimeraz engelleyici olduğunu.</li>
</ol>7. ışıldama tabanlı VSV varyasyonları kurtarmak LD652 hücrelerdeki deneyleri: RNAi ve plazmid Transfection deneyleri
<ol><li>
RNAi aracılı nakavt, viral dsRNA hazırlanması veya ana transkript
	<ol>
<li>Tasarım gene özgü astar kuyruklu T7 organizatörü sıra (TAATACGACTCACTATAGGG) ya da hedef ile 5' sonunda coinfecting virüs (Örneğin, VACV) veya L. dispar mRNA transkript ilgi. Bu astar 400-600 bp etkili RNAi aracılı nakavt için PCR ürünü üretmek gerekir. Tavla ve ark. görmek 13 astar serileri için aşağıda devirme VACV veya L. dispar için transkript dsRNA-aracılı RNAi LD652 hücrelerdeki tarafından kullanılır. Not: L. dispar mRNA transkript üzerinden tanımlanabilir L. dispar transcriptome veritabanları26,27,28yayınlandı.</li>
		<li>Bir DNA şablon üzerinden RT-PCR oluşturmak (cDNA sentezi: 1 50 ° C çevriminde 30 dk; PCR: 94 ° c 40 devredir 15 s, 30 50 ° C s ve 68 ° C 45 için s her).</li>
		<li>PCR arıtma seti kullanarak PCR ürünü arındırmak.</li>
		<li>Arıtılmış PCR ürünü bir şablon olarak kullanıp, içinde vitro uyarlamak ve vitro transkripsiyon ve arıtma seti kullanarak dsRNA arındırmak.</li>
	</ol>
</li>
	<li>
Transfection dsRNA veya plazmid DNA LD652 hücre içine
	<ol>
<li>Tohum 1 x 105 hücreleri/bir 24-şey tabak iyi ve en az 1 h için yerleşmek hücreleri izin.</li>
		<li>Her şey transfected için transfection reaktif 4 μL SFM 100 μL oranında seyreltin. En fazla 15 dakika oda sıcaklığında kuluçkaya. Bunun yapılması tüm transfections için ana bir karışımını yapmak için ölçeklenebilir.</li>
		<li>Transfected için SFM her şey için 100 μL ile dsRNA veya toplam plazmid DNA 1 μg kadar sulandırmak. En fazla 15 dakika oda sıcaklığında kuluçkaya. Not: Biz daha önce 1 μg dsRNA/105 LD652 hücre transfection için yeterli olduğunu bulduk > % 80'i devirme ya da viral veya ev sahipliği transkript13, dsRNA doz ama deneysel değişiklik için set ups/koşullar zorunda kalacak ampirik olarak kararlı olmak.</li>
		<li>Transfection reaktif ve dsRNA/plazmid DNA dilutions 1:1 oran ile birleştirmek (Örneğin, seyreltilmiş dsRNA 100 μL karıştırılır ile seyreltilmiş transfection reaktif 100 μL) ve oda sıcaklığında 20 dk için kuluçkaya.</li>
		<li>Bu arada, kuyu 1 mL/SFM, iyi yıkama ve her şey için SFM 500 μL ekleyin.</li>
		<li>Yavaş yavaş transfection reaktif dsRNA (veya plazmid DNA) eklemek karışımı her kuyuya dropwise.</li>
		<li>5 h için hücreler transfection reaktif kuluçkaya.<ol>
<li>RNAi için (Örneğin, VACV), coinfecting bir virüs tarafından kodlanmış transkript nakavt içeren deneyler yerine transfection reaktif 5-h transfection kuluçka süresinden sonra virüs inoculum VSV-LUC içeren (veya VACV olmadan veya başka bir coinfecting virüs) (adım 3). Daha sonra VSV-LUC tam büyüme medya 2 HPI ile içeren virüs inoculum değiştirin. LUC deneyleri (adım 4) o zaman hulâsa lysates virüs transkript coinfecting nakavt VSV-LUC kurtarma bir kaybına neden Eğer belirlemek için çeşitli zaman noktalarda gerçekleştirilebilir.</li>
			<li>RNAi deneyler, RNAi L. dispar transkript içeren için tam büyüme ortamı ile transfection mix değiştirin ve nakavt VSV-LUC (adım 4) ile enfeksiyon önce 24 h için doğmak izin verir. LUC deneyleri (adım 4) o zaman hulâsa lysates L. dispar transkript nakavt VSV-LUC kurtarma teşvik Eğer belirlemek için çeşitli zaman noktalarda gerçekleştirilebilir.</li>
			<li>Plazmid ifade vektörlerin aday immunomodulators ifade transfections içeren deneyler için transfection reaktif değiştirin ve protein ifade VSV-LUC (adım 4) ile enfeksiyon önce 24 h için izin vermek. LUC deneyleri (adım 4) o zaman hulâsa lysates Ifade aday immunomodulatory proteinlerin VSV-LUC kurtarma teşvik olup olmadığını belirlemek için çeşitli zaman noktalarda gerçekleştirilebilir. Not: burada 1 μg/iyi plazmid DNA sonucu 40-%6013transfection verimliliği kullanılarak açıklanmıştır transfection koşulları.</li>
		</ol>
</li>
	</ol>
</li>
</ol>

<ol>
	<li>Nomaguchi, M., Fujita, M., Miyazaki, Y., Adachi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+tropism.">Viral tropism.</a> Frontiers in Microbiology. 3, 281 (2012).</li><li>Werden, S. J., McFadden, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+cell+signaling+in+poxvirus+tropism:+the+case+of+the+M-T5+host+range+protein+of+myxoma+virus.">The role of cell signaling in poxvirus tropism: the case of the M-T5 host range protein of myxoma virus.</a> Biochimica et Biophysica Acta (BBA) - Bioenergetics. 1784 (1), 228-237 (2008).</li><li>McFadden, G., Mohamed, M. R., Rahman, M. M., Bartee, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytokine+determinants+of+viral+tropism.">Cytokine determinants of viral tropism.</a> Nature Reviews: Immunology. 9 (9), 645-655 (2009).</li><li>Silva, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Second-generation+shRNA+libraries+covering+the+mouse+and+human+genomes.">Second-generation shRNA libraries covering the mouse and human genomes.</a> Nature Genetics. 37 (11), 1281-1288 (2005).</li><li>Moffat, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+lentiviral+RNAi+library+for+human+and+mouse+genes+applied+to+an+arrayed+viral+high-content+screen.">A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen.</a> Cell. 124 (6), 1283-1298 (2006).</li><li>Ma, D., Liu, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+Editing+and+Its+Applications+in+Model+Organisms.">Genome Editing and Its Applications in Model Organisms.</a> Genomics Proteomics Bioinformatics. 13 (6), 336-344 (2015).</li><li>Yin, H., Kauffman, K. J., Anderson, D. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delivery+technologies+for+genome+editing.">Delivery technologies for genome editing.</a> Nature Reviews: Drug Discovery. 16 (6), 387-399 (2017).</li><li>Hao, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drosophila+RNAi+screen+identifies+host+genes+important+for+influenza+virus+replication.">Drosophila RNAi screen identifies host genes important for influenza virus replication.</a> Nature. 454 (7206), 890-893 (2008).</li><li>Houzet, L., Jeang, K. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+screening+using+RNA+interference+to+study+host+factors+in+viral+replication+and+pathogenesis.">Genome-wide screening using RNA interference to study host factors in viral replication and pathogenesis.</a> Experimental Biology and Medicine. 236 (8), 962-967 (2011).</li><li>Marceau, C. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+dissection+of+Flaviviridae+host+factors+through+genome-scale+CRISPR+screens.">Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens.</a> Nature. 535 (7610), 159-163 (2016).</li><li>Savidis, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+Zika+Virus+and+Dengue+Virus+Dependency+Factors+using+Functional+Genomics.">Identification of Zika Virus and Dengue Virus Dependency Factors using Functional Genomics.</a> Cell Reports. 16 (1), 232-246 (2016).</li><li>Panda, D., Cherry, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-based+genomic+screening:+elucidating+virus-host+interactions.">Cell-based genomic screening: elucidating virus-host interactions.</a> Current Opinion in Virology. 2 (6), 784-792 (2012).</li><li>Gammon, D. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single+vertebrate+DNA+virus+protein+disarms+invertebrate+immunity+to+RNA+virus+infection.">A single vertebrate DNA virus protein disarms invertebrate immunity to RNA virus infection.</a> Elife. 3, (2014).</li><li>Letchworth, G. J., Rodriguez, L. L., Del cbarrera, ., J, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vesicular+stomatitis.">Vesicular stomatitis.</a> Veterinary Journal. 157 (3), 239-260 (1999).</li><li>Whelan, S. P., Ball, L. A., Barr, J. N., Wertz, G. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+recovery+of+infectious+vesicular+stomatitis+virus+entirely+from+cDNA+clones.">Efficient recovery of infectious vesicular stomatitis virus entirely from cDNA clones.</a> Proceedings of the National Academy of Sciences of the United States of America. 92 (18), 8388-8392 (1995).</li><li>Cureton, D. K., Massol, R. H., Saffarian, S., Kirchhausen, T. L., Whelan, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vesicular+stomatitis+virus+enters+cells+through+vesicles+incompletely+coated+with+clathrin+that+depend+upon+actin+for+internalization.">Vesicular stomatitis virus enters cells through vesicles incompletely coated with clathrin that depend upon actin for internalization.</a> PLoS Pathogens. 5 (4), e1000394 (2009).</li><li>Duntsch, C. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recombinant+vesicular+stomatitis+virus+vectors+as+oncolytic+agents+in+the+treatment+of+high-grade+gliomas+in+an+organotypic+brain+tissue+slice-glioma+coculture+model.">Recombinant vesicular stomatitis virus vectors as oncolytic agents in the treatment of high-grade gliomas in an organotypic brain tissue slice-glioma coculture model.</a> Journal of Neurosurgery. 100 (6), 1049-1059 (2004).</li><li>Li, Y., Yuan, S., Moyer, R. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+non-permissive+infection+of+insect+(gypsy+moth)+LD-652+cells+by+Vaccinia+virus.">The non-permissive infection of insect (gypsy moth) LD-652 cells by Vaccinia virus.</a> Virology. 248 (1), 74-82 (1998).</li><li>Seet, B. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Poxviruses+and+immune+evasion.">Poxviruses and immune evasion.</a> Annual Review of Immunology. 21, 377-423 (2003).</li><li>Cotter, C. A., Earl, P. L., Wyatt, L. S., Moss, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+Cell+Cultures+and+Vaccinia+Virus+Stocks.">Preparation of Cell Cultures and Vaccinia Virus Stocks.</a> Current Protocols in Microbiology. 39, 11-18 (2015).</li><li>Andrei, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cidofovir+resistance+in+vaccinia+virus+is+linked+to+diminished+virulence+in+mice.">Cidofovir resistance in vaccinia virus is linked to diminished virulence in mice.</a> Journal of Virology. 80 (19), 9391-9401 (2006).</li><li>Dascher, C., VanSlyke, J. K., Thomas, L., Balch, W. E., Thomas, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+recombinant+vaccinia+virus+for+expression+of+small+GTPases.">Preparation of recombinant vaccinia virus for expression of small GTPases.</a> Methods in Enzymology. , 174-188 (1995).</li><li>Martin, A., Rex, E. A., Ishidate, T., Lin, R., Gammon, D. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Infection+of+Caenorhabditis+elegans+with+Vesicular+Stomatitis+Virus+via+Microinjection.">Infection of Caenorhabditis elegans with Vesicular Stomatitis Virus via Microinjection.</a> Bio-Protocol. 7 (22), (2017).</li><li>Luker, K. E., Hutchens, M., Schultz, T., Pekosz, A., Luker, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bioluminescence+imaging+of+vaccinia+virus:+effects+of+interferon+on+viral+replication+and+spread.">Bioluminescence imaging of vaccinia virus: effects of interferon on viral replication and spread.</a> Virology. 341 (2), 284-300 (2005).</li><li>Rozelle, D. K., Filone, C. M., Dower, K., Connor, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaccinia+reporter+viruses+for+quantifying+viral+function+at+all+stages+of+gene+expression.">Vaccinia reporter viruses for quantifying viral function at all stages of gene expression.</a> Journal of Visualizes Experiments. (87), e51522 (2014).</li><li>Cao, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+the+transcriptome+of+the+Asian+gypsy+moth+Lymantria+dispar+identifies+numerous+transcripts+associated+with+insecticide+resistance.">Characterization of the transcriptome of the Asian gypsy moth Lymantria dispar identifies numerous transcripts associated with insecticide resistance.</a> Pesticide Biochemistry and Physiology. 119, 54-61 (2015).</li><li>Sparks, M. E., Blackburn, M. B., Kuhar, D., Gundersen-Rindal, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptome+of+the+Lymantria+dispar+(gypsy+moth)+larval+midgut+in+response+to+infection+by+Bacillus+thuringiensis.">Transcriptome of the Lymantria dispar (gypsy moth) larval midgut in response to infection by Bacillus thuringiensis.</a> PloS One. 8 (5), e61190 (2013).</li><li>Sparks, M. E., Gundersen-Rindal, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Lymantria+dispar+IPLB-Ld652Y+cell+line+transcriptome+comprises+diverse+virus-associated+transcripts.">The Lymantria dispar IPLB-Ld652Y cell line transcriptome comprises diverse virus-associated transcripts.</a> Viruses. 3 (11), 2339-2350 (2011).</li><li>Lin, G., Li, G., Granados, R. R., Blissard, G. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable+cell+lines+expressing+baculovirus+P35:+resistance+to+apoptosis+and+nutrient+stress,+and+increased+glycoprotein+secretion.">Stable cell lines expressing baculovirus P35: resistance to apoptosis and nutrient stress, and increased glycoprotein secretion.</a> In Vitro Cellular &amp; Developmental Biology - Animal. 37 (5), 293-302 (2001).</li><li>Li, W. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interferon+antagonist+proteins+of+influenza+and+vaccinia+viruses+are+suppressors+of+RNA+silencing.">Interferon antagonist proteins of influenza and vaccinia viruses are suppressors of RNA silencing.</a> Proceedings of the National Academy of Sciences of the United States of America. 101 (5), 1350-1355 (2004).</li><li>Kanost, M. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multifaceted+biological+insights+from+a+draft+genome+sequence+of+the+tobacco+hornworm+moth,+Manduca+sexta.">Multifaceted biological insights from a draft genome sequence of the tobacco hornworm moth, Manduca sexta.</a> Insect Biochemistry and Molecular Biology. 76, 118-147 (2016).</li><li>Paixao, E. S., Teixeira, M. G., Rodrigues, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika,+chikungunya+and+dengue:+the+causes+and+threats+of+new+and+re-emerging+arboviral+diseases.">Zika, chikungunya and dengue: the causes and threats of new and re-emerging arboviral diseases.</a> BMJ Global Health. 3, (2018).</li></ol>

Yazarlar ifşa gerek yok.

Burada basit floresan ışıma-temelli ve deneyleri VSV çoğaltma kısıtlayıcı Lepidoptera hücre kültürlerinde kurtarmak koşulları için ekran anlatmıştık. Mükemmel bir sinyal-gürültü oranı VSV gen ekspresyonu için raporlaması VSV Lepidoptera hücrelerdeki abes enfeksiyon oluşturur. Örneğin, lysates--dan tek VSV-LUC hastalık tespit LU sinyalleri edildi ~ 1000 kat daha fazla daha yüksek lysates, sahte enfekte içinde bu sinyalleri sadece yaklaşık iki kat 72-h saat boyunca değişti. henüz. Buna ...

Bir virüs verimli belirli bir ana çoğaltmak yeteneği kısmen destek viral giriş ve çoğaltma1konak hücre faktörler kullanılabilirlik tarafından yönetilmektedir. Aksi takdirde viral çoğaltma2,3engel olur sayaç hücresel antiviral savunma için bir virüs kapasitesi tarafından virüs ana bilgisayar aralığı da dikte. Sonuçta bir virüs yaşam döngüsünün belirli bir ana içinde tamamlamak mümkün olacak olup olmadığını karar bu karmaşık virüs-ana etkileşimler sonucu olur. Eğer viral çoğaltma ensues ana bilgisayara ilişkin potansiyel patojenik sonuçları göz önüne alındığında, bu abes ve üretken arasındaki dengeyi ipucu anahtar virüs-ana etkileşimler anlayışımız daha fazla için deneysel stratejiler geliştirmek için önemlidir enfeksiyonlar. Virüs ana bilgisayar etkileşimi moleküler özelliklerinin elucidating yeni ve alternatif antiviral tedavi stratejilerinin geliştirilmesi vesile olacaktır.
RNA müdahale (RNAi)4,ve advent ile5 ve genom düzenleme araçları (Örn., CRISPR-Cas9, çinko parmak nükleaz, TALENs)6,7, değiştirmek için deneysel olarak mümkün olmuştur hücresel genom çapında faktörlere ifade ölçekler ve virüs çoğaltma hakkında bu değişiklikleri etkisini keşfedin. Gerçekten de, çok sayıda RNAi ve ekranlar genom-düzenleme-tabanlı virüs-ana etkileşimler8,9,10, yeni esaslarını açıkladı omurgasız ve omurgalı konak hücre tiplerinde yapılmıştır 11 , 12. bu ekranlar genellikle gazetecilere, ateş böceği luciferase (LUC) veya floresan proteinler gibi kodlama virüs istihdam (Örn., GFP, DsRed), bir okuma olarak viral gen ekspresyonu kantitatif değerlendirilmesi uygun aracı sağlayan viral çoğaltma9,12. Bu strateji araştırmacılar ya teşvik veya viral çoğaltma tarafından artar ya da azalır, sırasıyla kanıtlandığı düşman,9,12viral muhabiri sinyalleri ana faktörleri belirlemek için sağlar. Ancak, büyük çoğu durumda, bu ekranlar hangi onlar incelendiği ana hücre tipi iyi adapte virüs kullanılarak yapılmıştır. Bu strateji viral patojenler ve onların doğal ana bilgisayarlar arasında coevolutionary ilişkiler anlamak için önemli olabilir de, açığa çıkarmak ana bilgisayar antiviral faktörleri onların kullanımı ile ilgili temel sorunları teşkil etmez. Bu gibi durumlarda, bir donanım virüs muhabir olarak sinyal RNAi nakavt için baktı ediliyor veya viral çoğaltma normalde engellemektedir hücresel bir faktör inactivation. İlk olarak, bir virüs zaten sağlam kontrol koşullar altında incelenmektedir ana bilgisayar hücredeki çoğaltmak mümkün ise (Örneğin, arka plan ve gelişmiş viral muhabir sinyalleri arasında ayrım yapmak yeteneği) ekranın dinamik alan sınırlı olabilir. İkinci olarak, bu sorun daha fazla virüs iyi adapte konak hücre ve içinde belgili tanımlık perde hedef alınmaktadır konak savunma yolları ortaya koydu, etkili olduğu durumlar tarafından bileşik olduğunu.
Eleme yöntemleri geleneksel virüs-ana bilgisayar etkileşimi ile ilgili yukarıdaki kaygıları nedeniyle doğal olarak başarısız Abdovirüs enfeksiyonlar Lepidoptera böcek hücrelerinde yararlanmak virüs-ana etkileşimler çalışmak için yeni bir paradigma geliştirdik. Bu strateji iyi okudu insan Abdovirüs, VSV, gypsy moth (L. dispar)13türetilmiş hücrelerdeki abes bir enfeksiyon uğrar bir gözlem türetilmiştir. VSV doğal memeli ana dipteran böcekler (yani, kum sinekleri) tarafından iletilir ve deneysel olarak geniş bir omurgasız bulaştırmak için gösterilmiştir ve omurgalı konaklarda her iki14kültür ve in vivohücre. 11-kb olumsuz anlamda tek iplikçikli RNA genomu VSV her saran virion kadar yapmak proteinler çevriliyor beş subgenomic mRNA'ların kodlar. Ancak, VSV ters genetik sistemler çoğaltma yetkili suşları LUC veya floresan proteinler, ek olarak beş doğal VSV gen ürünleri15,16,17kodlama yaratılması için izin. Bu muhabir proteinler VSV virion dahil değil çünkü onlar sonrası giriş oluşur VSV gen ekspresyonu için uygun bir okuma sağlar. VSV suşları GFP veya LUC kodlama kullanarak, biz daha önce VSV gen ekspresyonu ciddi LD652 hücreleri girişte sınırlıdır ve VSV titreleri 72 saat sonrası enfeksiyon (HPI) artırmayın göstermiştir. Buna ek olarak, LD652 hücreleri VSV ve memeli poxvirus, vaksinia virüs (VACV), coinfection VSV gen ekspresyonu ve titreleri Logaritmik artar bu zaman noktası tarafından yol açar. VACV erken gen ekspresyonu, DNA ikileşmesi ve geç gen ekspresyonu LD652 hücre enfeksiyonlar geçer ama VACV çoğaltma döngüsü nedeniyle eksik virion morfogenetik18sonuçta başarısız. Büyük ~ 192 kb DNA genom VACV, bunların çoğu viral çoğaltma ana bilgisayar bağışıklık yanıtı19bastırılması yoluyla teşvik immunomodulatory özelliklerini görüntülemek > 200 protein kodlayan. Bu nedenle, biz bu VACV coinfection tarafından LD652 hücrelerdeki VSV çoğaltma "kurtarma" büyük olasılıkla L. dispar yanıt normalde VSV çoğaltma sınırlama inhibe VACV immunomodulators tarafından aracılı olan. Bu destek, ana bilgisayar RNA polimeraz II inhibitörü actinomycin D LD652 hücrelerle tedavi de LD652 hücrelerde transkripsiyon-bağımlı ana bilgisayar yanıt VSV çoğaltma sonrası giriş13blok gösteren VSV çoğaltma kurtarır.
Yukarıdaki gözlemleri VSV enfeksiyona LD652 hücrelerin doğal olarak kısıtlayıcı doğa nispeten düşük bir arka plan ne zaman muhabir VSV kodlu sinyalleri (yani, bu ana bilgisayar inhibe geliştirmek koşulları için eleme sağlayabilir öneririm Antiviral savunma). Burada, floresan veya LUC tabanlı deneyleri ekrana VSV kısıtlama Lepidoptera hücrelerdeki rahatlatmak koşulları için kullanma yöntemleri sağlamak. İlk olarak, bu deneyleri VSV kısıtlama aday viral etkenler ektopik ifade veya her iki coinfection deneyler sırasında break virally kodlanmış immunomodulatory faktörleri belirlemek için nasıl kullanılabileceğini göstermektedir. Örnek olarak, biz nasıl biz bu tarama teknikleri poxvirus kodlanmış A51R protein diğer poxvirus faktörler13yokluğunda VSV çoğaltma kurtarmak immunomodulatory faktörler yeni bir aile tanımlamak için kullanılan göstermektedir. İkinci olarak, RNAi kısıtlayıcı VSV-LD652 hücre enfeksiyonları eleme doğrudan ökaryotik ana faktörler Abdovirüs kısıtlama13' te katılan tanımlamak için nasıl kullanılabileceğini göstermektedir.

<table><tbody><tr><td>6-well tissue culture plates</td><td>CELLTREAT</td><td>229106</td><td></td></tr><tr><td>24-well tissue culture plates</td><td>CELLTREAT</td><td>229124</td><td></td></tr><tr><td>10 cm tissue culture dishes</td><td>Corning</td><td>C430167</td><td></td></tr><tr><td>Grace&amp;rsquo;s Insect Medium</td><td>Sigma</td><td>G8142</td><td></td></tr><tr><td>EX-CELL 420</td><td>Sigma</td><td>14420C</td><td></td></tr><tr><td>Fetal Bovine Serum - Optima</td><td>Atlanta Biologicals</td><td>S12450</td><td></td></tr><tr><td>Growth medium</td><td></td><td></td><td>1:1 mixture of Grace&#039;s Insect Medium and EX-Cell 420 Serum-Free Medium also containing 1% antibiotic-antimycotic solution and 10% Fetal bovine serum</td></tr><tr><td>Antibiotic-Antimycotic Solution (100&amp;times;)</td><td>Sigma</td><td>A5955</td><td></td></tr><tr><td>Dulbecco&amp;rsquo;s Phosphate Buffered Saline (DPBS)</td><td>Sigma</td><td>D8662</td><td></td></tr><tr><td>Serum Free Media (SFM)</td><td>Thermo Fisher</td><td>10902096</td><td></td></tr><tr><td>Cytosine arabinoside</td><td>Sigma</td><td>C1768</td><td></td></tr><tr><td>Transfection reagent</td><td>Thermo Fisher</td><td>10362100</td><td></td></tr><tr><td>Corning cellgro DMSO (Dimethyl Sulfoxide)</td><td>Corning</td><td>25950CQC</td><td></td></tr><tr><td>Reporter lysis buffer 5x</td><td>Promega</td><td>E3971</td><td></td></tr><tr><td>Luciferase Assay Reagent</td><td>Promega</td><td>E1483</td><td></td></tr><tr><td>96-Well Microplates</td><td>Corning</td><td>3915</td><td></td></tr><tr><td>Mouse anti-FLAG antibody</td><td>Wako</td><td>014-22383</td><td></td></tr><tr><td>Rabbit anti-firefly luciferase antibody</td><td>Abcam</td><td>ab21176</td><td></td></tr><tr><td>Mouse anti-actin antibody</td><td>Sigma</td><td>A2066</td><td></td></tr><tr><td>Mouse anti-VSV M</td><td>N/A</td><td>N/A</td><td>Dr. John Connor (Boston University)</td></tr><tr><td>Mouse anti-VACV I3L</td><td>N/A</td><td>N/A</td><td>Dr. David Evans (University of Alberta)</td></tr><tr><td>8-well Chambered dish</td><td>Lab-Tek II</td><td>155409</td><td></td></tr><tr><td>Cell viability dye</td><td>Thermo Fisher</td><td>C12881</td><td></td></tr><tr><td>FLUOstar microplate reader</td><td>BMG Labtech</td><td>FLUOstar</td><td></td></tr><tr><td>Confocal microscope</td><td>Olympus</td><td>FV10i-LIV</td><td></td></tr><tr><td>Image analysis software</td><td>Olympus</td><td>v1.18</td><td>cellSens software</td></tr><tr><td>Eppendorf 5702 ventilated centrifuge</td><td>Eppendorf</td><td>22628102</td><td></td></tr><tr><td>Odyssey Fc Infrared Imaging System</td><td>Li-COR Biosciences</td><td>Odyssey Fc</td><td></td></tr><tr><td>LD652 cells</td><td>N/A</td><td>N/A</td><td>Dr. Basil Arif (Natural Resources Canada)</td></tr><tr><td>BSC-40 cells</td><td>ATCC</td><td>CRL-2761</td><td></td></tr><tr><td>BHK cells</td><td>ATCC</td><td>CCL-10</td><td></td></tr><tr><td>HeLa cells</td><td>ATCC</td><td>CCL-2</td><td></td></tr><tr><td>BSC-1 cells</td><td>ATCC</td><td>CCL-26</td><td></td></tr><tr><td>&lt;em&gt;in vitro&lt;/em&gt; transcription and purification kit</td><td>Thermo Fisher</td><td>AM1626</td><td></td></tr><tr><td>PCR purification kit</td><td>Qiagen</td><td>28104</td><td></td></tr></tbody></table>

arbovirus infections as screening tools for the identification of viral immunomodulators and host antiviral factors

RNA müdahale - ve genom düzenleme-tabanlı platformlar tarama virüs çoğaltma kısıtlamak konak hücre faktörleri tanımlamak için yaygın olarak kullanılmaktadır. Ancak, bu ekranlar genellikle viral patojen altında eğitim için doğal olarak keyfi olan hücreler yapılmaktadır. Bu nedenle, virüs denetimi koşullarında güçlü çoğaltma bu ekranlar dinamik aralığını sınırlayabilir. Ayrıca, bu ekranlar virüs çoğaltma virüs iyi adapte ana bilgisayara ve antiviral savunma mücadele yeteneğine ise sınırlandıran hücresel savunma yolları kolayca belirleyemiyor olabilir. Bu makalede, biz arboviruses gibi vesicular Stomatit virüs (VSV) tarafından üzerinde doğal olarak başarısız enfeksiyonlar virüs-ana etkileşimler merkezi ekranlar aracılığıyla keşfetmek için yeni bir paradigma tanımlamak. Çeşitli dipteran böcek ve memeli ev sahibi çoğaltmak yeteneği VSV rağmen VSV Lepidoptera böcekler, gypsy moth (Lymantria dispar) gibi türetilmiş hücre hatları çeşitli sonrası giriş, başarısız bir enfeksiyon uğrar. "Ne zaman konak hücre antiviral Savunma virüs olduğundan Ancak, bunlar abes VSV hastalık kurtarıldı". Biz nasıl VSV kodlama uygun reporter genler ve kısıtlayıcı L. dispar suşları tarif hücre hatları ana faktörler Abdovirüs sınırlama içinde katılan tanımlamak için kurulum ekranları için eşleştirilmiş. Ayrıca, biz de bu tarama araçları yarar VSV çoğaltma veya ektopik ifade memeli virüsler tarafından kodlanmış dahil olmak üzere, coinfection sırasında kurtarma virally kodlanmış faktörler tanımlaması gösterir. L. dispar hücrelerdeki VSV çoğaltma doğal sınırlamasının VSV kurtarma, böylece izlemek için basit ışıma ve floresan tabanlı deneyleri kullanımını teşvik koşulları için eleme yüksek sinyal gürültü oranı sağlar VSV çoğaltma değişiklikleri. Bu metodolojileri ana bilgisayar antiviral yanıt ve viral bağışıklık kaçırma faktörler arasındaki etkileşimi anlamak için değerlidir.

Canlı hücre görüntüleme uygulamaları VSV kurtarma VACV coinfection üzerine izlemek için bir örnek olarak, LD652 hücreleri bir 8-şey odacıklı tabak içinde kaplama ve sahte enfekte veya VSV-DsRed ile enfekte (MOI = 1) varlığı veya yokluğu VACV-FL-GFP (MOI = 25). VSV-DsRed DsRed ücretsiz bir protein olarak ifade eder ve yapısal VSV proteinler (Şekil 1A) erimiş değil çünkü, VSV giriş ve gen ifade başlattıktan sonra sadece algılanır....

Watch this Scientific Journal Video about Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors at JoVE.com

Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors

Burada, Abdovirüs çoğaltma ve Abdovirüs çoğaltma kısıtlamak 2) ökaryotik ana faktörler teşvik 1) virüs kodlanmış immunomodulators tanımlamak için protokolleri mevcut. Floresan ve ışıldama dayalı yöntemlerin araştırmacılar hızla düşük sinyal noise oranları ile basit deneyleri Abdovirüs çoğaltma nicel veriler elde etmek için izin verir.

Araçlar Viral Immunomodulators ve ana bilgisayar Antiviral faktörler tanımlanması için eleme olarak Abdovirüs enfeksiyonlar

RNA interference- and genome editing-based screening platforms have been widely used to identify host cell factors that restrict virus replication. ...

arbovirus-infections-as-screening-tools-for-identification-viral

Research

JoVE Journal

Immunology and Infection

6.8K Görüntüleme.  University of Texas Southwestern Medical Center. Burada, Abdovirüs çoğaltma ve Abdovirüs çoğaltma kısıtlamak 2) ökaryotik ana faktörler teşvik 1) virüs kodlanmış immunomodulators tanımlamak için protokolleri mevcut. Floresan ve ışıldama dayalı yöntemlerin araştırmacılar hızla düşük sinyal noise oranları ile basit deneyleri Abdovirüs çoğaltma nicel veriler elde etmek için izin verir.

Video: Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Viral pathogens represent a significant public health threat; not only can viruses cause natural epidemics of human disease, but their potential use in bioterrorism is also a concern. A better understanding of the cellular factors that impact infection would facilitate the development of much-needed therapeutics. Recent advances in RNA interference (RNAi) technology coupled with complete genome sequencing of several organisms has led to the optimization of genome-wide, cell-based loss-of-function screens. Drosophila cells are particularly amenable to genome-scale screens because of the ease and efficiency of RNAi in this system 1. Importantly, a wide variety of viruses can infect Drosophila cells, including a number of mammalian viruses of medical and agricultural importance 2,3,4. Previous RNAi screens in Drosophila have identified host factors that are required for various steps in virus infection including entry, translation and RNA replication 5. Moreover, many of the cellular factors required for viral replication in Drosophila cell culture are also limiting in human cells infected with these viruses 4,6,7,8, 9. Therefore, the identification of host factors co-opted during viral infection presents novel targets for antiviral therapeutics. Here we present a generalized protocol for a high-throughput RNAi screen to identify cellular factors involved in viral infection, using vaccinia virus as an example.

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Novel host factors involved in viral infection can be identified through cell-based genome-wide loss of function RNAi screening. A Drosophila cell culture model is particularly amenable to this approach due to the ease and efficiency of RNAi. Here we demonstrate this technique using vaccinia virus as an example.

RNAi Tarama için ilgilendim Ana Faktörler Vaccinia Virüs Enfeksiyonu Drosophila Hücre

Viral pathogens represent a significant public health threat; not only can viruses cause natural epidemics of human disease, but their potential use in ...

İmmünoloji ve Enfeksiyon

Using a Pan-Viral Microarray Assay (Virochip) to Screen Clinical Samples for Viral Pathogens

The diagnosis of viral causes of many infectious diseases is difficult due to the inherent sequence diversity of viruses as well as the ongoing emergence of novel viral pathogens, such as SARS coronavirus and 2009 pandemic H1N1 influenza virus, that are not detectable by traditional methods. To address these challenges, we have previously developed and validated a pan-viral microarray platform called the Virochip with the capacity to detect all known viruses as well as novel variants on the basis of conserved sequence homology1. Using the Virochip, we have identified the full spectrum of viruses associated with respiratory infections, including cases of unexplained critical illness in hospitalized patients, with a sensitivity equivalent to or superior to conventional clinical testing2-5. The Virochip has also been used to identify novel viruses, including the SARS coronavirus6,7, a novel rhinovirus clade5, XMRV (a retrovirus linked to prostate cancer)8, avian bornavirus (the cause of a wasting disease in parrots)9, and a novel cardiovirus in children with respiratory and diarrheal illness10. The current version of the Virochip has been ported to an Agilent microarray platform and consists of ~36,000 probes derived from over ~1,500 viruses in GenBank as of December of 2009. Here we demonstrate the steps involved in processing a Virochip assay from start to finish (~24 hour turnaround time), including sample nucleic acid extraction, PCR amplification using random primers, fluorescent dye incorporation, and microarray hybridization, scanning, and analysis.

Using a Pan-Viral Microarray Assay Virochip to Screen Clinical Samples for Viral Pathogens

The Virochip is a pan-viral microarray designed to simultaneously detect all known viruses as well as novel viruses on the basis of conserved sequence homology. Here we demonstrate how to run a Virochip assay to analyze clinical samples for the presence of both known and unknown viruses.

Viral Patojenler Klinik Örnekler Ekranına bir Pan-Viral Mikroarray Testi (Virochip)

The diagnosis of viral causes of many infectious diseases is difficult due to the inherent sequence diversity of viruses as well as the ongoing emergence ...

Genome-wide RNAi Screening to Identify Host Factors That Modulate Oncolytic Virus Therapy

High-throughput genome-wide RNAi (RNA interference) screening technology has been widely used for discovering host factors that impact&#160;virus replication. Here we present the application of this technology to uncovering host targets that specifically modulate the replication of Maraba virus, an oncolytic rhabdovirus, and vaccinia virus with the goal of enhancing therapy. While the protocol has been tested for use with oncolytic Maraba virus and oncolytic vaccinia virus, this approach is applicable to other oncolytic viruses and can also be utilized for identifying host targets that modulate virus replication in mammalian cells in general. This protocol describes the development and validation of an assay for high-throughput RNAi screening in mammalian cells, the key considerations and preparation steps important for conducting a primary high-throughput RNAi screen, and a step-by-step guide for conducting a primary high-throughput RNAi screen; in addition, it broadly outlines the methods for conducting secondary screen validation and tertiary validation studies. The benefit of high-throughput RNAi screening is that it allows one to catalogue, in an extensive and unbiased fashion, host factors that modulate any aspect of virus replication for which one can develop an in vitro assay such as infectivity, burst size, and cytotoxicity. It has the power to uncover biotherapeutic targets unforeseen based on current knowledge.

Here we describe a protocol for employing high-throughput RNAi screening to uncover host targets that can be manipulated to enhance oncolytic virus therapy, specifically rhabodvirus and vaccinia virus therapy, but it can be readily adapted to other oncolytic virus platforms or for discovering host genes that modulate virus replication generally.

Tedavi Oncolytic virusu modüle ana faktörleri tanımlamak için genom çapında RNAi tarama

High-throughput genome-wide RNAi (RNA interference) screening technology has been widely used for discovering host factors that impact&#160;virus ...

Kanser Araştırmaları

Assays for the Identification of Novel Antivirals against Bluetongue Virus

To identify potential antivirals against BTV, we have developed, optimized and validated three assays presented here. The CPE-based assay was the first assay developed to evaluate whether a compound showed any antiviral efficacy and have been used to screen large compound library. Meanwhile, cytotoxicity of antivirals could also be evaluated using the CPE-based assay. The dose-response assay was designed to determine the range of efficacy for the selected antiviral, i.e. 50% inhibitory concentration (IC50) or effective concentration (EC50), as well as its range of cytotoxicity (CC50). The ToA assay was employed for the initial MoA study to determine the underlying mechanism of the novel antivirals during BTV viral lifecycle or the possible effect on host cellular machinery. These assays are vital for the evaluation of antiviral efficacy in cell culture system, and have been used for our recent researches leading to the identification of a number of novel antivirals against BTV.

Three assays, including the cytopathic effect (CPE)-based assay, dose-response assay and Time-of-Addition (ToA) assay have been developed, optimized, validated and utilized to identify novel antivirals against Bluetongue virus (BTV), as well as to determine the possible Mechanism-of-Action (MoA) for newly identified antivirals.

Bluetongue Virüs karşı Roman Antiviraller belirlenmesi için Tahliller

To identify potential antivirals against BTV, we have  developed, optimized and validated three assays presented here. The CPE-based  assay was the first ...

High-throughput Screening for Broad-spectrum Chemical Inhibitors of RNA Viruses

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat because of increased worldwide exchanges and human populations penetrating more and more natural ecosystems. A good example of such an emerging situation is chikungunya virus epidemics of 2005-2006 in the Indian Ocean. Recent progresses in our understanding of cellular pathways controlling viral replication suggest that compounds targeting host cell functions, rather than the virus itself, could inhibit a large panel of RNA viruses. Some broad-spectrum antiviral compounds have been identified with host target-oriented assays. However, measuring the inhibition of viral replication in cell cultures using reduction of cytopathic effects as a readout still represents a paramount screening strategy. Such functional screens have been greatly improved by the development of recombinant viruses expressing reporter enzymes capable of bioluminescence such as luciferase. In the present report, we detail a high-throughput screening pipeline, which combines recombinant measles and chikungunya viruses with cellular viability assays, to identify compounds with a broad-spectrum antiviral profile.

In vitro assays to measure virus replication have been greatly improved by the development of recombinant RNA viruses expressing luciferase or other enzymes capable of bioluminescence. Here we detail a high-throughput screening pipeline that combines such recombinant strains of measles and chikungunya viruses to isolate broad-spectrum antivirals from chemical libraries.

RNA Virüslerinin geniş spektrumlu Kimyasal Önleyicileri için yüksek verimli tarama

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat ...

Vaccinia Reporter Viruses for Quantifying Viral Function at All Stages of Gene Expression

Poxviruses are a family of double stranded DNA viruses that include active human pathogens such as monkeypox, molluscum contagiousum, and Contagalo virus. The family also includes the smallpox virus, Variola. Due to the complexity of poxvirus replication, many questions still remain regarding their gene expression strategy. In this article we describe the conceptualization and usage of recombinant vaccinia viruses that enable real-time measurement of single and multiple stages of viral gene expression in a high-throughput format. This is enabled through the use of spectrally distinct fluorescent proteins as reporters for each of three stages of viral replication. These viruses provide a high signal-to-noise ratio while retaining stage specific expression patterns, enabling plate-based assays and microscopic observations of virus propagation and replication. These tools have uses for antiviral discovery, studies of the virus-host interaction, and evolutionary biology.

We describe the usage of a fluorescent reporter vaccinia virus that enables real-time measurement of viral infectivity and gene expression through the stage-specific expression of spectrally distinct reporter fluorophores. We detail a plate-based method for accurately identifying the stage at which virus replication is affected in response to small molecule inhibition.

Gen İfade Tüm Dönemlerinde Viral Fonksiyonu sayısallaştırabilmek için vaksiniya Reporter Virüsler

Poxviruses are a family of double stranded DNA viruses that include active human pathogens such as monkeypox, molluscum contagiousum, and Contagalo virus. ...

Early Viral Entry Assays for the Identification and Evaluation of Antiviral Compounds

Cell-based systems are useful for discovering antiviral agents. Dissecting the viral life cycle, particularly the early entry stages, allows a mechanistic approach to identify and evaluate antiviral agents that target specific steps of the viral entry. In this report, the methods of examining viral inactivation, viral attachment, and viral entry/fusion as antiviral assays for such purposes are described, using hepatitis C virus as a model. These assays should be useful for discovering novel antagonists/inhibitors to early viral entry and help expand the scope of candidate antiviral agents for further drug development.

Here, we present a protocol that examines specific steps of the viral entry to identify and evaluate novel antiviral agents.

Erken Viral Giriş Tespiti için Tahliller ve Antiviral Bileşiklerin Değerlendirilmesi

Cell-based systems are useful for discovering antiviral agents. Dissecting the viral life cycle, particularly the early entry stages, allows a mechanistic ...

Isolation and Quantification of Zika Virus from Multiple Organs in a Mouse

The methods being presented demonstrate laboratory procedures for the isolation of organs from Zika virus infected animals and the quantification of viral load. The purpose of the procedure is to quantify viral titers in peripheral and CNS areas of the mouse at different time points post infection or under different experimental conditions to identify virologic and immunological factors that regulate Zika virus infection. The organ isolation procedures demonstrated allow for both focus forming assay quantification and quantitative PCR assessment of viral titers. The rapid organ isolation techniques are designed for the preservation of virus titer. Viral titer quantification by focus forming assay allows for the rapid throughput assessment of Zika virus. The benefit of the focus forming assay is the assessment of infectious virus, the limitation of this assay is the potential for organ toxicity reducing the limit of detection. Viral titer assessment is combined with quantitative PCR, and using a recombinant RNA copy control viral genome copy number within the organ is assessed with low limit of detection. Overall these techniques provide an accurate rapid high throughput method for the analysis of Zika viral titers in the periphery and CNS of Zika virus infected animals and can be applied to the assessment of viral titers in the organs of animals infected with most pathogens, including Dengue virus.

The goal of the protocol is to demonstrate the techniques used to investigate viral disease by isolating and quantifying Zika virus, from multiple organs in a mouse following infection.

Farede Birden Fazla Organdan Zika Virüsünün İzolasyon ve Nicelikselleştirilmesi

The methods being presented demonstrate laboratory procedures for the isolation of organs from Zika virus infected animals and the quantification of viral ...

Use of Viral Entry Assays and Molecular Docking Analysis for the Identification of Antiviral Candidates against Coxsackievirus A16

Antiviral assays that mechanistically examine viral entry are pertinent to discern at which step the evaluated agents are most effective, and allow for the identification of candidate viral entry inhibitors. Here, we present the experimental approaches for the identification of small molecules capable of blocking infection by the non-enveloped coxsackievirus A16 (CVA16) through targeting the virus particles or specific steps in early viral entry. Assays include the time-of-drug-addition analysis, flow cytometry-based viral binding assay, and viral inactivation assay. We also present a molecular docking protocol utilizing virus capsid proteins to predict potential residues targeted by the antiviral compounds. These assays should help in the identification of candidate antiviral agents that act on viral entry. Future directions can explore these possible inhibitors for further drug development.

The goal of the protocol is to illustrate the different assays relating to viral entry that can be used to identify candidate viral entry inhibitors.

Coxsackievirus 'a karşı antiviral adayların tanımlanması için viral giriş analizinin kullanımı ve moleküler yerleştirme Analizi A16

Antiviral assays that mechanistically examine viral entry are pertinent to discern at which step the evaluated agents are most effective, and allow for ...

High-Throughput Transcriptome Analysis for Investigating Host-Pathogen Interactions

Pathogens can cause a wide variety of infectious diseases. The biological processes induced by the host in response to infection determine the severity of the disease.&#160;To study such processes, researchers can use high-throughput sequencing techniques (RNA-seq) that measure the dynamic changes of the host transcriptome at different stages of infection, clinical outcomes, or disease severity.This investigation can lead to a better understanding of the diseases, as well as uncovering potential drug targets and treatments. The protocol presented here describes a complete pipeline to analyze RNA-sequencing data from raw reads to functional analysis. The pipeline is divided into five steps: (1) quality control of the data; (2) mapping and annotation of genes; (3) statistical analysis to identify differentially expressed genes and co-expressed genes; (4) determination of the molecular degree of the perturbation of samples; and (5) functional analysis. Step 1 removes technical artifacts that may impact the quality of downstream analyses. In step 2, genes are mapped and annotated according to standard library protocols.&#160;The statistical analysis in step 3 identifies genes that are differentially expressed or co-expressed in infected samples, in comparison with non-infected ones. Sample variability and the presence of potential biological outliers are verified using the molecular degree of perturbation approach in step 4. Finally, the functional analysis in step 5 reveals the pathways associated with the disease phenotype. The presented pipeline aims to support researchers through the RNA-seq data analysis from host-pathogen interaction studies and drive future&#160;in vitro or in vivo experiments, that are essential to understand the molecular mechanism of infections.

The protocol presented here describes a complete pipeline to analyze RNA-sequencing transcriptome data from raw reads to functional analysis, including quality control and preprocessing steps to advanced statistical analytical approaches.

Konak-Patojen Etkileşimlerini Araştırmak için Yüksek Verimli Transkriptom Analizi

Pathogens can cause a wide variety of infectious diseases. The biological processes induced by the host in response to infection determine the severity of ...