D.G. University of Texas Southwestern Tıp Merkezi donatılmış akademisyenler programdan fon tarafından desteklenmiştir. Yazar Michael Whitt (Tennessee Üniversitesi Sağlık Bilimleri Merkezi) ve Sean Whelan (Harvard Medical School) VSV-DsRed ve VSV-LUC sağlanması için teşekkür ederiz. Yazarlar ayrıca Gary Luker (Michigan Üniversitesi Tıp Fakültesi) VACV-FL-GFP zorlanma tür hediye için teşekkür ederiz.

1. genel Lymantria dispar (LD652) hücre ile virüs kültür
<ol><li>
LD652 hücre kültürü çalışmalarının ve kaplama
	<ol>
<li>Kültürüne L. dispar-türetilmiş LD652 hücreleri, normal atmosfer altında 27 ° C'de inkübe bir büyüme orta (Tablo reçetesi) hücrelerinin monolayer korumak. 10 cm doku kültürü tedavi edilen yemekleri hücreleri korumak ve % 80 confluency ulaşan üzerine hücreleri geçiş.</li>
		<li>Plaka, plaka yapisan LD652 hücrelerden art arda (Bu hücreler trypsinization çıkarmak için gerekmez) monolayer üzerine medya pipetting tarafından çıkarmak ve örnek 1 x 105 hücre/mL yaklaşık bir yoğunluğunun büyüme medyada sulandırmak için. 1 mL sulandırılmış kültür/iyi bir 24-şey plaka pipet. En az üç Çoğalt kuyu/tedavi türü her zaman noktası (en fazla sekiz tedaviler/plaka) için tohum.</li>
		<li>Hücreleri en az 1 h için yerleşmek için izin verir.</li>
	</ol>
</li>
	<li>
Vaksinia virüs hazırlık
	<ol>
<li>VACV hisse senetleri hazırlamak mı, virüs HeLa içinde yükseltmek için20 hücreleri veya Afrika yeşil maymun böbrek hücreleri (lisans-1 veya BSC-40 hücreleri)20,21,22. Not: Burada açıklanan deneyleri içinde de VACV zorlanma Western Reserve (VACV-WR) çalışır.</li>
		<li>VACV zorlanma ile plak tahlil BSC-1 veya BSC-40 hücreleri20,22titre. Not: Tüm VACV çokluğu enfeksiyon (MOI) hücre enfeksiyonlar titreleri BSC-40 plak deneyleri elde edilen temel alan LD652 için burada açıklanan belirtti.</li>
	</ol>
</li>
	<li>
Vesicular Stomatit virüs hazırlık
	<ol>
<li>VSV stokları hazırlamak için virüs BHK hücreleri23yılında yükseltmek.</li>
		<li>Plak tahlil BSC-40 veya BHK hücre monolayers13,23tarafından VSV titre. Not: Tüm VSV MOIs hücre enfeksiyonlar titreleri BSC-40 plak deneyleri elde edilen temel alan LD652 için burada açıklanan.</li>
	</ol>
</li>
</ol>2. floresans tabanlı VSV kurtarma tahlil Co enfeksiyon ve canlı hücre düşsel kullanma
<ol><li>
Tohum ve enfeksiyon LD652 hücre
	<ol>
<li>40.000 LD652 hücreler/iyi bir 8-şey odasının plaka.</li>
		<li>Floresans tabanlı canlı hücre görüntüsü için VSV suşları floresan protein kodlama kullanmak. Burada sunulan deneyler VSV-DsRed17, diğer VSV protein için erimiş değil ücretsiz DsRed protein ifade eder bir rekombinant VSV yük kullanın. Not: VSV enfeksiyon LD652 hücre tarafından 96 HPI cytopathic değildir ve böylece, hücre ölümü bir karıştırıcı faktör bu zaman dilimi içinde VSV çoğaltma değerlendirirken değil.</li>
		<li>Serum ücretsiz bir medya (SFM; VSV-DsRed ve VACV-FL-GFP hazırlık Tablo malzeme) 1 ve 25, bir MOI, anılan sıraya göre. Not: VACV-FL-GFP LUC ve GFP24arasında bir füzyon ifade eder bir rekombinant VACV yük olduğunu. 25 veya daha büyük bir MOI VACV suşları için kullanarak tüm LD652 hücreleri enfekte13olmasını sağlar. Eğer farklı bir coinfecting virüs istimal, MOI ampirik olarak Kullanıcı tarafından belirlenecektir gerekir. Her enfeksiyon tedavi yinelenen wells ayarlanmalıdır ve sahte enfekte tedavi sadece SFM hücrelere eklenir içerir.</li>
		<li>İnoculum 27 ° C'de 2 h için 0.2 mL hücrelerde kuluçkaya</li>
		<li>Hücreleri 0.5 mL/büyüme ortamının iyi yıkayın.</li>
		<li>Hücre canlılığı boya (Tablo reçetesi) 25 mikron hücrelerde büyüme medya 27 ° C'de 45 dk için kuluçkaya</li>
		<li>Medya Aspire edin ve kuyu 1 yıkama x 0.5 mL/de fazla boya kaldırmak için.</li>
		<li>0.3 mL/de büyüme ortamının hücreleri korumak.</li>
	</ol>
</li>
	<li>
Canlı hücre görüntü yakalama
	<ol>
<li>Bir confocal mikroskop 30 dk önceden açmak ve bir 8-şey odası yemek yükleyin. Not: Oda sıcaklığında 20-25 ° C arasında değişen LD652 hücreleri görüntüsü, ama optimal koşullar için oda sıcaklığını 27 ° C'ye ayarlanması gerektiğini</li>
		<li>Yansıması için uygun uyarma/emisyon ayarları her floresan marker protein için hem de faz kontrast görüntü ayarlarını ayarlayın.</li>
		<li>Her kanal için lazer yoğunluğunu ayarlayın. Not: Bu son deneyde kullanılacak saat ders boyunca gözlenen floresan sinyal yoğunluklarda aralığını belirlemek için bir pilot deneme gerçekleştirme gerektirebilir.</li>
		<li>10 X objektif kullanarak istediğiniz zaman noktaya kadar enfeksiyon süresince her şey her 1 – 5 h faz kontrast ve floresan görüntülerini yakalamak (Örn., 48-72 HPI). Not: Enfeksiyon oranları kültür boyunca doğru bir şekilde tahmin etmek için her iyi görünümünde birden çok alan yakalamak önemlidir.</li>
	</ol>
</li>
	<li>
Görüntü Analizi
	<ol>
<li>Görüntü analiz yazılımı uygun floresan kanalları otomatik görüntü analizi için kullanın (Örn., 405 nm, 488 nm, 568 nm).</li>
		<li>Enfekte hücreleri yüzdesini hesaplamak için floresan hücreleri VSV enfeksiyon gösteren toplam sayısına bölün (e.g., DsRed-pozitif hücreler VSV-DsRed enfeksiyonlar için) tarafından hücre canlılığı boya için etiketli hücrelerin toplam sayısına göre tüm tedaviler arasında her alanı elde edersiniz.</li>
	</ol>
</li>
</ol>3. genel Viral enfeksiyon Protokolü VSV ışıldama tabanlı kurtarma deneyleri LD652 hücrelerdeki için
<ol><li>
İnoculum hazırlanması
	<ol>
<li>30 enfeksiyon önce tezcan stokları VSV-LUC16 (bir rekombinant VSV zorlanma ücretsiz ateş böceği luciferase protein diğer VSV protein için erimiş değil o ifade eder). VSV-LUC kurtarmak için VACV coinfection sırasında raporlaması, ayrıca VACV-WR virüs buz çözme. Not: Diğer virüsler (yanında VACV-WR) VSV-LUC coinfection sırasında kurtarmak, ancak bu ampirik olarak her kullanıcı tarafından belirlenecektir gerekir.</li>
		<li>Öyle ki bir MOI 10 ve 25, sırasıyla, 0.2 mL toplam inoculum hacmi ekleyerek elde edilir varlığı veya yokluğu VACV-WR SFM içine VSV-LUC sulandrarak inoculum hazırlamak/iyi.</li>
	</ol>
</li>
	<li>
Enfeksiyon hücreleri
	<ol>
<li>Dikkatle monolayer rahatsız edici önlemek için olgun LD652 medya Aspire edin ve virüs/iyi 0.2 mL ile aşılamak. Bu sefer 0 HPI tanımlanır. Steril SFM "sahte-enfekte" negatif kontrol tedaviler hizmet etmek için ek wells ekleyin.</li>
		<li>İnoculum 27 ° C'de 2 h için hücrelerde kuluçkaya</li>
		<li>2 HPI, at inoculum aspirasyon tarafından kaldırmak ve 1 mL ile değiştirmek/LD652 büyüme medya iyi.</li>
		<li>Enfeksiyon 24-72 HPI devam etmek izin verir.</li>
	</ol>
</li>
</ol>4. luciferase tahlil
<ol><li>
Hücre lysates hazırlanması
	<ol>
<li>Dikkatle süpernatant Aspire edin ve Dulbecco'nın fosfat tamponlu tuz çözeltisi (DPBS) 1 mL ekleyin / iyi.</li>
		<li>1 mL şırınga pistonu kullanarak, hücreleri DPBS kazı.</li>
		<li>Microcentrifuge tüp ve 4 ° C'de 20 dk 400 x g , santrifüj hücreleri transfer</li>
		<li>Bu arada, 5 gazeteci lizis arabellek (RLB) steril H2o x 1 x seyreltme hazırlamak</li>
		<li>Santrifüjü hücre Pelet bozmadan DPBS Aspire edin.</li>
		<li>Her pelet 1 150 µL içinde resuspend x RLB.</li>
		<li>Donma-çözülme oda sıcaklığında su banyosu içinde hızlı bir çözülme ardından bir-80 ° C dondurucu bir dakika 5 kuluçka kullanarak x örnekleri 1. -80 ° C'de lysates analiz etmek için hazır kadar saklayın.</li>
	</ol>
</li>
	<li>
Luciferase tahlil
	<ol>
<li>Lysates buz çözme.</li>
		<li>Bir katı siyah ya da beyaz 96-şey Mikroplaka bir kuyuya lysate, 20 μL pipet.</li>
		<li>Luciferase tahlil reaktif 100 μL her şey için ekleyin.</li>
		<li>Hemen bir luminometer kullanarak ışık yoğunluğunu ölçmek (belirli Luminometreler için uygun ayarları Kullanıcı tarafından ampirik olarak belirlenecek olacak).</li>
	</ol>
</li>
	<li>
Luciferase tahlil analiz
	<ol>
<li>LU sinyalleri kontrol tedavisi (Temsilcisi sonuçları) elde edilen LU okumalar her tedavi için normalleştirmek. En az üç bağımsız deneyler gerçekleştirdikten sonra LU her tedavi/kontrol grubundan elde edilen ortalama uygun istatistiksel testler tarafından çözümlenebilir.</li>
	</ol>
</li>
</ol>5. Immunoblot
<ol><li>SDS-sayfa ve uygun reaktifler ve Araçları'nı kullanarak sonraki immunoblotting için LUC deneyleri için çıkarılan lysates kullanın.</li>
</ol>6. LD652 hücre kültürlerden VSV titresi
<ol><li>LD652 hücreleri adım 1.1 göre plaka.</li>
	<li>Viral enfekte hücreleri göre adım 3.</li>
	<li>İstenen saat noktalarda supernatants steril microcentrifuge tüpler içine toplamak.</li>
	<li>4 ° C'de 10 dakika 1000 x g kullanarak hücreleri cips ve supernatants yeni tüpler için transfer.</li>
	<li>Supernatants-80 ° C'de depolayın veya plak tahlil BSC-40 hücreleri tarafından titrasyon ile devam edin. Not: VACV bulunan LD652 hücre kültürleri VSV titrating Eğer 2 HPI BSC-40 monolayers13tarihinde plaklar artık VACV parçacıklar önleyebilirsiniz, BSC-40 kültür ortamlara 100 μg/mL sitozin arabinoside (araç) eklemek için tavsiye edilir. Araç VACV DNA çoğaltma25 engeller, ancak VSV çoğaltmayı etkilemez bir viral DNA polimeraz engelleyici olduğunu.</li>
</ol>7. ışıldama tabanlı VSV varyasyonları kurtarmak LD652 hücrelerdeki deneyleri: RNAi ve plazmid Transfection deneyleri
<ol><li>
RNAi aracılı nakavt, viral dsRNA hazırlanması veya ana transkript
	<ol>
<li>Tasarım gene özgü astar kuyruklu T7 organizatörü sıra (TAATACGACTCACTATAGGG) ya da hedef ile 5' sonunda coinfecting virüs (Örneğin, VACV) veya L. dispar mRNA transkript ilgi. Bu astar 400-600 bp etkili RNAi aracılı nakavt için PCR ürünü üretmek gerekir. Tavla ve ark. görmek 13 astar serileri için aşağıda devirme VACV veya L. dispar için transkript dsRNA-aracılı RNAi LD652 hücrelerdeki tarafından kullanılır. Not: L. dispar mRNA transkript üzerinden tanımlanabilir L. dispar transcriptome veritabanları26,27,28yayınlandı.</li>
		<li>Bir DNA şablon üzerinden RT-PCR oluşturmak (cDNA sentezi: 1 50 ° C çevriminde 30 dk; PCR: 94 ° c 40 devredir 15 s, 30 50 ° C s ve 68 ° C 45 için s her).</li>
		<li>PCR arıtma seti kullanarak PCR ürünü arındırmak.</li>
		<li>Arıtılmış PCR ürünü bir şablon olarak kullanıp, içinde vitro uyarlamak ve vitro transkripsiyon ve arıtma seti kullanarak dsRNA arındırmak.</li>
	</ol>
</li>
	<li>
Transfection dsRNA veya plazmid DNA LD652 hücre içine
	<ol>
<li>Tohum 1 x 105 hücreleri/bir 24-şey tabak iyi ve en az 1 h için yerleşmek hücreleri izin.</li>
		<li>Her şey transfected için transfection reaktif 4 μL SFM 100 μL oranında seyreltin. En fazla 15 dakika oda sıcaklığında kuluçkaya. Bunun yapılması tüm transfections için ana bir karışımını yapmak için ölçeklenebilir.</li>
		<li>Transfected için SFM her şey için 100 μL ile dsRNA veya toplam plazmid DNA 1 μg kadar sulandırmak. En fazla 15 dakika oda sıcaklığında kuluçkaya. Not: Biz daha önce 1 μg dsRNA/105 LD652 hücre transfection için yeterli olduğunu bulduk > % 80'i devirme ya da viral veya ev sahipliği transkript13, dsRNA doz ama deneysel değişiklik için set ups/koşullar zorunda kalacak ampirik olarak kararlı olmak.</li>
		<li>Transfection reaktif ve dsRNA/plazmid DNA dilutions 1:1 oran ile birleştirmek (Örneğin, seyreltilmiş dsRNA 100 μL karıştırılır ile seyreltilmiş transfection reaktif 100 μL) ve oda sıcaklığında 20 dk için kuluçkaya.</li>
		<li>Bu arada, kuyu 1 mL/SFM, iyi yıkama ve her şey için SFM 500 μL ekleyin.</li>
		<li>Yavaş yavaş transfection reaktif dsRNA (veya plazmid DNA) eklemek karışımı her kuyuya dropwise.</li>
		<li>5 h için hücreler transfection reaktif kuluçkaya.<ol>
<li>RNAi için (Örneğin, VACV), coinfecting bir virüs tarafından kodlanmış transkript nakavt içeren deneyler yerine transfection reaktif 5-h transfection kuluçka süresinden sonra virüs inoculum VSV-LUC içeren (veya VACV olmadan veya başka bir coinfecting virüs) (adım 3). Daha sonra VSV-LUC tam büyüme medya 2 HPI ile içeren virüs inoculum değiştirin. LUC deneyleri (adım 4) o zaman hulâsa lysates virüs transkript coinfecting nakavt VSV-LUC kurtarma bir kaybına neden Eğer belirlemek için çeşitli zaman noktalarda gerçekleştirilebilir.</li>
			<li>RNAi deneyler, RNAi L. dispar transkript içeren için tam büyüme ortamı ile transfection mix değiştirin ve nakavt VSV-LUC (adım 4) ile enfeksiyon önce 24 h için doğmak izin verir. LUC deneyleri (adım 4) o zaman hulâsa lysates L. dispar transkript nakavt VSV-LUC kurtarma teşvik Eğer belirlemek için çeşitli zaman noktalarda gerçekleştirilebilir.</li>
			<li>Plazmid ifade vektörlerin aday immunomodulators ifade transfections içeren deneyler için transfection reaktif değiştirin ve protein ifade VSV-LUC (adım 4) ile enfeksiyon önce 24 h için izin vermek. LUC deneyleri (adım 4) o zaman hulâsa lysates Ifade aday immunomodulatory proteinlerin VSV-LUC kurtarma teşvik olup olmadığını belirlemek için çeşitli zaman noktalarda gerçekleştirilebilir. Not: burada 1 μg/iyi plazmid DNA sonucu 40-%6013transfection verimliliği kullanılarak açıklanmıştır transfection koşulları.</li>
		</ol>
</li>
	</ol>
</li>
</ol>

<ol>
	<li>Nomaguchi, M., Fujita, M., Miyazaki, Y., Adachi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+tropism.">Viral tropism.</a> Frontiers in Microbiology. 3, 281 (2012).</li><li>Werden, S. J., McFadden, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+cell+signaling+in+poxvirus+tropism:+the+case+of+the+M-T5+host+range+protein+of+myxoma+virus.">The role of cell signaling in poxvirus tropism: the case of the M-T5 host range protein of myxoma virus.</a> Biochimica et Biophysica Acta (BBA) - Bioenergetics. 1784 (1), 228-237 (2008).</li><li>McFadden, G., Mohamed, M. R., Rahman, M. M., Bartee, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytokine+determinants+of+viral+tropism.">Cytokine determinants of viral tropism.</a> Nature Reviews: Immunology. 9 (9), 645-655 (2009).</li><li>Silva, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Second-generation+shRNA+libraries+covering+the+mouse+and+human+genomes.">Second-generation shRNA libraries covering the mouse and human genomes.</a> Nature Genetics. 37 (11), 1281-1288 (2005).</li><li>Moffat, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+lentiviral+RNAi+library+for+human+and+mouse+genes+applied+to+an+arrayed+viral+high-content+screen.">A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen.</a> Cell. 124 (6), 1283-1298 (2006).</li><li>Ma, D., Liu, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+Editing+and+Its+Applications+in+Model+Organisms.">Genome Editing and Its Applications in Model Organisms.</a> Genomics Proteomics Bioinformatics. 13 (6), 336-344 (2015).</li><li>Yin, H., Kauffman, K. J., Anderson, D. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delivery+technologies+for+genome+editing.">Delivery technologies for genome editing.</a> Nature Reviews: Drug Discovery. 16 (6), 387-399 (2017).</li><li>Hao, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drosophila+RNAi+screen+identifies+host+genes+important+for+influenza+virus+replication.">Drosophila RNAi screen identifies host genes important for influenza virus replication.</a> Nature. 454 (7206), 890-893 (2008).</li><li>Houzet, L., Jeang, K. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+screening+using+RNA+interference+to+study+host+factors+in+viral+replication+and+pathogenesis.">Genome-wide screening using RNA interference to study host factors in viral replication and pathogenesis.</a> Experimental Biology and Medicine. 236 (8), 962-967 (2011).</li><li>Marceau, C. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+dissection+of+Flaviviridae+host+factors+through+genome-scale+CRISPR+screens.">Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens.</a> Nature. 535 (7610), 159-163 (2016).</li><li>Savidis, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+Zika+Virus+and+Dengue+Virus+Dependency+Factors+using+Functional+Genomics.">Identification of Zika Virus and Dengue Virus Dependency Factors using Functional Genomics.</a> Cell Reports. 16 (1), 232-246 (2016).</li><li>Panda, D., Cherry, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-based+genomic+screening:+elucidating+virus-host+interactions.">Cell-based genomic screening: elucidating virus-host interactions.</a> Current Opinion in Virology. 2 (6), 784-792 (2012).</li><li>Gammon, D. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single+vertebrate+DNA+virus+protein+disarms+invertebrate+immunity+to+RNA+virus+infection.">A single vertebrate DNA virus protein disarms invertebrate immunity to RNA virus infection.</a> Elife. 3, (2014).</li><li>Letchworth, G. J., Rodriguez, L. L., Del cbarrera, ., J, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vesicular+stomatitis.">Vesicular stomatitis.</a> Veterinary Journal. 157 (3), 239-260 (1999).</li><li>Whelan, S. P., Ball, L. A., Barr, J. N., Wertz, G. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+recovery+of+infectious+vesicular+stomatitis+virus+entirely+from+cDNA+clones.">Efficient recovery of infectious vesicular stomatitis virus entirely from cDNA clones.</a> Proceedings of the National Academy of Sciences of the United States of America. 92 (18), 8388-8392 (1995).</li><li>Cureton, D. K., Massol, R. H., Saffarian, S., Kirchhausen, T. L., Whelan, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vesicular+stomatitis+virus+enters+cells+through+vesicles+incompletely+coated+with+clathrin+that+depend+upon+actin+for+internalization.">Vesicular stomatitis virus enters cells through vesicles incompletely coated with clathrin that depend upon actin for internalization.</a> PLoS Pathogens. 5 (4), e1000394 (2009).</li><li>Duntsch, C. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recombinant+vesicular+stomatitis+virus+vectors+as+oncolytic+agents+in+the+treatment+of+high-grade+gliomas+in+an+organotypic+brain+tissue+slice-glioma+coculture+model.">Recombinant vesicular stomatitis virus vectors as oncolytic agents in the treatment of high-grade gliomas in an organotypic brain tissue slice-glioma coculture model.</a> Journal of Neurosurgery. 100 (6), 1049-1059 (2004).</li><li>Li, Y., Yuan, S., Moyer, R. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+non-permissive+infection+of+insect+(gypsy+moth)+LD-652+cells+by+Vaccinia+virus.">The non-permissive infection of insect (gypsy moth) LD-652 cells by Vaccinia virus.</a> Virology. 248 (1), 74-82 (1998).</li><li>Seet, B. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Poxviruses+and+immune+evasion.">Poxviruses and immune evasion.</a> Annual Review of Immunology. 21, 377-423 (2003).</li><li>Cotter, C. A., Earl, P. L., Wyatt, L. S., Moss, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+Cell+Cultures+and+Vaccinia+Virus+Stocks.">Preparation of Cell Cultures and Vaccinia Virus Stocks.</a> Current Protocols in Microbiology. 39, 11-18 (2015).</li><li>Andrei, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cidofovir+resistance+in+vaccinia+virus+is+linked+to+diminished+virulence+in+mice.">Cidofovir resistance in vaccinia virus is linked to diminished virulence in mice.</a> Journal of Virology. 80 (19), 9391-9401 (2006).</li><li>Dascher, C., VanSlyke, J. K., Thomas, L., Balch, W. E., Thomas, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+recombinant+vaccinia+virus+for+expression+of+small+GTPases.">Preparation of recombinant vaccinia virus for expression of small GTPases.</a> Methods in Enzymology. , 174-188 (1995).</li><li>Martin, A., Rex, E. A., Ishidate, T., Lin, R., Gammon, D. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Infection+of+Caenorhabditis+elegans+with+Vesicular+Stomatitis+Virus+via+Microinjection.">Infection of Caenorhabditis elegans with Vesicular Stomatitis Virus via Microinjection.</a> Bio-Protocol. 7 (22), (2017).</li><li>Luker, K. E., Hutchens, M., Schultz, T., Pekosz, A., Luker, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bioluminescence+imaging+of+vaccinia+virus:+effects+of+interferon+on+viral+replication+and+spread.">Bioluminescence imaging of vaccinia virus: effects of interferon on viral replication and spread.</a> Virology. 341 (2), 284-300 (2005).</li><li>Rozelle, D. K., Filone, C. M., Dower, K., Connor, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaccinia+reporter+viruses+for+quantifying+viral+function+at+all+stages+of+gene+expression.">Vaccinia reporter viruses for quantifying viral function at all stages of gene expression.</a> Journal of Visualizes Experiments. (87), e51522 (2014).</li><li>Cao, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+the+transcriptome+of+the+Asian+gypsy+moth+Lymantria+dispar+identifies+numerous+transcripts+associated+with+insecticide+resistance.">Characterization of the transcriptome of the Asian gypsy moth Lymantria dispar identifies numerous transcripts associated with insecticide resistance.</a> Pesticide Biochemistry and Physiology. 119, 54-61 (2015).</li><li>Sparks, M. E., Blackburn, M. B., Kuhar, D., Gundersen-Rindal, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptome+of+the+Lymantria+dispar+(gypsy+moth)+larval+midgut+in+response+to+infection+by+Bacillus+thuringiensis.">Transcriptome of the Lymantria dispar (gypsy moth) larval midgut in response to infection by Bacillus thuringiensis.</a> PloS One. 8 (5), e61190 (2013).</li><li>Sparks, M. E., Gundersen-Rindal, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Lymantria+dispar+IPLB-Ld652Y+cell+line+transcriptome+comprises+diverse+virus-associated+transcripts.">The Lymantria dispar IPLB-Ld652Y cell line transcriptome comprises diverse virus-associated transcripts.</a> Viruses. 3 (11), 2339-2350 (2011).</li><li>Lin, G., Li, G., Granados, R. R., Blissard, G. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable+cell+lines+expressing+baculovirus+P35:+resistance+to+apoptosis+and+nutrient+stress,+and+increased+glycoprotein+secretion.">Stable cell lines expressing baculovirus P35: resistance to apoptosis and nutrient stress, and increased glycoprotein secretion.</a> In Vitro Cellular &amp; Developmental Biology - Animal. 37 (5), 293-302 (2001).</li><li>Li, W. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interferon+antagonist+proteins+of+influenza+and+vaccinia+viruses+are+suppressors+of+RNA+silencing.">Interferon antagonist proteins of influenza and vaccinia viruses are suppressors of RNA silencing.</a> Proceedings of the National Academy of Sciences of the United States of America. 101 (5), 1350-1355 (2004).</li><li>Kanost, M. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multifaceted+biological+insights+from+a+draft+genome+sequence+of+the+tobacco+hornworm+moth,+Manduca+sexta.">Multifaceted biological insights from a draft genome sequence of the tobacco hornworm moth, Manduca sexta.</a> Insect Biochemistry and Molecular Biology. 76, 118-147 (2016).</li><li>Paixao, E. S., Teixeira, M. G., Rodrigues, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika,+chikungunya+and+dengue:+the+causes+and+threats+of+new+and+re-emerging+arboviral+diseases.">Zika, chikungunya and dengue: the causes and threats of new and re-emerging arboviral diseases.</a> BMJ Global Health. 3, (2018).</li></ol>

Yazarlar ifşa gerek yok.

Burada basit floresan ışıma-temelli ve deneyleri VSV çoğaltma kısıtlayıcı Lepidoptera hücre kültürlerinde kurtarmak koşulları için ekran anlatmıştık. Mükemmel bir sinyal-gürültü oranı VSV gen ekspresyonu için raporlaması VSV Lepidoptera hücrelerdeki abes enfeksiyon oluşturur. Örneğin, lysates--dan tek VSV-LUC hastalık tespit LU sinyalleri edildi ~ 1000 kat daha fazla daha yüksek lysates, sahte enfekte içinde bu sinyalleri sadece yaklaşık iki kat 72-h saat boyunca değişti. henüz. Buna ...

Bir virüs verimli belirli bir ana çoğaltmak yeteneği kısmen destek viral giriş ve çoğaltma1konak hücre faktörler kullanılabilirlik tarafından yönetilmektedir. Aksi takdirde viral çoğaltma2,3engel olur sayaç hücresel antiviral savunma için bir virüs kapasitesi tarafından virüs ana bilgisayar aralığı da dikte. Sonuçta bir virüs yaşam döngüsünün belirli bir ana içinde tamamlamak mümkün olacak olup olmadığını karar bu karmaşık virüs-ana etkileşimler sonucu olur. Eğer viral çoğaltma ensues ana bilgisayara ilişkin potansiyel patojenik sonuçları göz önüne alındığında, bu abes ve üretken arasındaki dengeyi ipucu anahtar virüs-ana etkileşimler anlayışımız daha fazla için deneysel stratejiler geliştirmek için önemlidir enfeksiyonlar. Virüs ana bilgisayar etkileşimi moleküler özelliklerinin elucidating yeni ve alternatif antiviral tedavi stratejilerinin geliştirilmesi vesile olacaktır.
RNA müdahale (RNAi)4,ve advent ile5 ve genom düzenleme araçları (Örn., CRISPR-Cas9, çinko parmak nükleaz, TALENs)6,7, değiştirmek için deneysel olarak mümkün olmuştur hücresel genom çapında faktörlere ifade ölçekler ve virüs çoğaltma hakkında bu değişiklikleri etkisini keşfedin. Gerçekten de, çok sayıda RNAi ve ekranlar genom-düzenleme-tabanlı virüs-ana etkileşimler8,9,10, yeni esaslarını açıkladı omurgasız ve omurgalı konak hücre tiplerinde yapılmıştır 11 , 12. bu ekranlar genellikle gazetecilere, ateş böceği luciferase (LUC) veya floresan proteinler gibi kodlama virüs istihdam (Örn., GFP, DsRed), bir okuma olarak viral gen ekspresyonu kantitatif değerlendirilmesi uygun aracı sağlayan viral çoğaltma9,12. Bu strateji araştırmacılar ya teşvik veya viral çoğaltma tarafından artar ya da azalır, sırasıyla kanıtlandığı düşman,9,12viral muhabiri sinyalleri ana faktörleri belirlemek için sağlar. Ancak, büyük çoğu durumda, bu ekranlar hangi onlar incelendiği ana hücre tipi iyi adapte virüs kullanılarak yapılmıştır. Bu strateji viral patojenler ve onların doğal ana bilgisayarlar arasında coevolutionary ilişkiler anlamak için önemli olabilir de, açığa çıkarmak ana bilgisayar antiviral faktörleri onların kullanımı ile ilgili temel sorunları teşkil etmez. Bu gibi durumlarda, bir donanım virüs muhabir olarak sinyal RNAi nakavt için baktı ediliyor veya viral çoğaltma normalde engellemektedir hücresel bir faktör inactivation. İlk olarak, bir virüs zaten sağlam kontrol koşullar altında incelenmektedir ana bilgisayar hücredeki çoğaltmak mümkün ise (Örneğin, arka plan ve gelişmiş viral muhabir sinyalleri arasında ayrım yapmak yeteneği) ekranın dinamik alan sınırlı olabilir. İkinci olarak, bu sorun daha fazla virüs iyi adapte konak hücre ve içinde belgili tanımlık perde hedef alınmaktadır konak savunma yolları ortaya koydu, etkili olduğu durumlar tarafından bileşik olduğunu.
Eleme yöntemleri geleneksel virüs-ana bilgisayar etkileşimi ile ilgili yukarıdaki kaygıları nedeniyle doğal olarak başarısız Abdovirüs enfeksiyonlar Lepidoptera böcek hücrelerinde yararlanmak virüs-ana etkileşimler çalışmak için yeni bir paradigma geliştirdik. Bu strateji iyi okudu insan Abdovirüs, VSV, gypsy moth (L. dispar)13türetilmiş hücrelerdeki abes bir enfeksiyon uğrar bir gözlem türetilmiştir. VSV doğal memeli ana dipteran böcekler (yani, kum sinekleri) tarafından iletilir ve deneysel olarak geniş bir omurgasız bulaştırmak için gösterilmiştir ve omurgalı konaklarda her iki14kültür ve in vivohücre. 11-kb olumsuz anlamda tek iplikçikli RNA genomu VSV her saran virion kadar yapmak proteinler çevriliyor beş subgenomic mRNA'ların kodlar. Ancak, VSV ters genetik sistemler çoğaltma yetkili suşları LUC veya floresan proteinler, ek olarak beş doğal VSV gen ürünleri15,16,17kodlama yaratılması için izin. Bu muhabir proteinler VSV virion dahil değil çünkü onlar sonrası giriş oluşur VSV gen ekspresyonu için uygun bir okuma sağlar. VSV suşları GFP veya LUC kodlama kullanarak, biz daha önce VSV gen ekspresyonu ciddi LD652 hücreleri girişte sınırlıdır ve VSV titreleri 72 saat sonrası enfeksiyon (HPI) artırmayın göstermiştir. Buna ek olarak, LD652 hücreleri VSV ve memeli poxvirus, vaksinia virüs (VACV), coinfection VSV gen ekspresyonu ve titreleri Logaritmik artar bu zaman noktası tarafından yol açar. VACV erken gen ekspresyonu, DNA ikileşmesi ve geç gen ekspresyonu LD652 hücre enfeksiyonlar geçer ama VACV çoğaltma döngüsü nedeniyle eksik virion morfogenetik18sonuçta başarısız. Büyük ~ 192 kb DNA genom VACV, bunların çoğu viral çoğaltma ana bilgisayar bağışıklık yanıtı19bastırılması yoluyla teşvik immunomodulatory özelliklerini görüntülemek > 200 protein kodlayan. Bu nedenle, biz bu VACV coinfection tarafından LD652 hücrelerdeki VSV çoğaltma "kurtarma" büyük olasılıkla L. dispar yanıt normalde VSV çoğaltma sınırlama inhibe VACV immunomodulators tarafından aracılı olan. Bu destek, ana bilgisayar RNA polimeraz II inhibitörü actinomycin D LD652 hücrelerle tedavi de LD652 hücrelerde transkripsiyon-bağımlı ana bilgisayar yanıt VSV çoğaltma sonrası giriş13blok gösteren VSV çoğaltma kurtarır.
Yukarıdaki gözlemleri VSV enfeksiyona LD652 hücrelerin doğal olarak kısıtlayıcı doğa nispeten düşük bir arka plan ne zaman muhabir VSV kodlu sinyalleri (yani, bu ana bilgisayar inhibe geliştirmek koşulları için eleme sağlayabilir öneririm Antiviral savunma). Burada, floresan veya LUC tabanlı deneyleri ekrana VSV kısıtlama Lepidoptera hücrelerdeki rahatlatmak koşulları için kullanma yöntemleri sağlamak. İlk olarak, bu deneyleri VSV kısıtlama aday viral etkenler ektopik ifade veya her iki coinfection deneyler sırasında break virally kodlanmış immunomodulatory faktörleri belirlemek için nasıl kullanılabileceğini göstermektedir. Örnek olarak, biz nasıl biz bu tarama teknikleri poxvirus kodlanmış A51R protein diğer poxvirus faktörler13yokluğunda VSV çoğaltma kurtarmak immunomodulatory faktörler yeni bir aile tanımlamak için kullanılan göstermektedir. İkinci olarak, RNAi kısıtlayıcı VSV-LD652 hücre enfeksiyonları eleme doğrudan ökaryotik ana faktörler Abdovirüs kısıtlama13' te katılan tanımlamak için nasıl kullanılabileceğini göstermektedir.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>6-well tissue culture plates</td>
			<td>CELLTREAT</td>
			<td>229106</td>
			<td></td>
		</tr>
		<tr>
			<td>24-well tissue culture plates</td>
			<td>CELLTREAT</td>
			<td>229124</td>
			<td></td>
		</tr>
		<tr>
			<td>10 cm tissue culture dishes</td>
			<td>Corning</td>
			<td>C430167</td>
			<td></td>
		</tr>
		<tr>
			<td>Grace&#8217;s Insect Medium</td>
			<td>Sigma</td>
			<td>G8142</td>
			<td></td>
		</tr>
		<tr>
			<td>EX-CELL 420</td>
			<td>Sigma</td>
			<td>14420C</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum - Optima</td>
			<td>Atlanta Biologicals</td>
			<td>S12450</td>
			<td></td>
		</tr>
		<tr>
			<td>Growth medium</td>
			<td></td>
			<td></td>
			<td>1:1 mixture of Grace&#39;s Insect Medium and EX-Cell 420 Serum-Free Medium also containing 1 % antibiotic-antimycotic solution and 10 % Fetal bovine serum</td>
		</tr>
		<tr>
			<td>Antibiotic-Antimycotic Solution (100&#215;)</td>
			<td>Sigma</td>
			<td>A5955</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#8217;s Phosphate Buffered Saline (DPBS)</td>
			<td>Sigma</td>
			<td>D8662</td>
			<td></td>
		</tr>
		<tr>
			<td>Serum Free Media (SFM)</td>
			<td>Thermo Fisher</td>
			<td>10902096</td>
			<td></td>
		</tr>
		<tr>
			<td>Cytosine arabinoside</td>
			<td>Sigma</td>
			<td>C1768</td>
			<td></td>
		</tr>
		<tr>
			<td>Transfection reagent</td>
			<td>Thermo Fisher</td>
			<td>10362100</td>
			<td></td>
		</tr>
		<tr>
			<td>Corning cellgro DMSO (Dimethyl Sulfoxide)</td>
			<td>Corning</td>
			<td>25950CQC</td>
			<td></td>
		</tr>
		<tr>
			<td>Reporter lysis buffer 5X</td>
			<td>Promega</td>
			<td>E3971</td>
			<td></td>
		</tr>
		<tr>
			<td>Luciferase Assay Reagent</td>
			<td>Promega</td>
			<td>E1483</td>
			<td></td>
		</tr>
		<tr>
			<td>96-Well Microplates</td>
			<td>Corning</td>
			<td>3915</td>
			<td></td>
		</tr>
		<tr>
			<td>Mouse anti-FLAG antibody</td>
			<td>Wako</td>
			<td>014-22383</td>
			<td></td>
		</tr>
		<tr>
			<td>Rabbit anti-firefly luciferase antibody</td>
			<td>Abcam</td>
			<td>ab21176</td>
			<td></td>
		</tr>
		<tr>
			<td>Mouse anti-actin antibody</td>
			<td>Sigma</td>
			<td>A2066</td>
			<td></td>
		</tr>
		<tr>
			<td>Mouse anti-VSV M</td>
			<td>N/A</td>
			<td>N/A</td>
			<td>Dr. John Connor (Boston University)</td>
		</tr>
		<tr>
			<td>Mouse anti-VACV I3L</td>
			<td>N/A</td>
			<td>N/A</td>
			<td>Dr. David Evans (University of Alberta)</td>
		</tr>
		<tr>
			<td>8-well Chambered dish</td>
			<td>Lab-Tek II</td>
			<td>155409</td>
			<td></td>
		</tr>
		<tr>
			<td>Cell viability dye</td>
			<td>Thermo Fisher</td>
			<td>C12881</td>
			<td></td>
		</tr>
		<tr>
			<td>FLUOstar microplate reader</td>
			<td>BMG Labtech</td>
			<td>FLUOstar</td>
			<td></td>
		</tr>
		<tr>
			<td>Confocal microscope</td>
			<td>Olympus</td>
			<td>FV10i-LIV</td>
			<td></td>
		</tr>
		<tr>
			<td>Image analysis software</td>
			<td>Olympus</td>
			<td>v1.18</td>
			<td>cellSens software</td>
		</tr>
		<tr>
			<td>Eppendorf 5702 ventilated centrifuge</td>
			<td>Eppendorf</td>
			<td>22628102</td>
			<td></td>
		</tr>
		<tr>
			<td>Odyssey Fc Infrared Imaging System</td>
			<td>Li-COR Biosciences</td>
			<td>Odyssey Fc</td>
			<td></td>
		</tr>
		<tr>
			<td>LD652 cells</td>
			<td>N/A</td>
			<td>N/A</td>
			<td>Dr. Basil Arif (Natural Resources Canada)</td>
		</tr>
		<tr>
			<td>BSC-40 cells</td>
			<td>ATCC</td>
			<td>CRL-2761</td>
			<td></td>
		</tr>
		<tr>
			<td>BHK cells</td>
			<td>ATCC</td>
			<td>CCL-10</td>
			<td></td>
		</tr>
		<tr>
			<td>HeLa cells</td>
			<td>ATCC</td>
			<td>CCL-2</td>
			<td></td>
		</tr>
		<tr>
			<td>BSC-1 cells</td>
			<td>ATCC</td>
			<td>CCL-26</td>
			<td></td>
		</tr>
		<tr>
			<td>in vitro transcription and purification kit</td>
			<td>Thermo Fisher</td>
			<td>AM1626</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR purification kit</td>
			<td>Qiagen</td>
			<td>28104</td>
			<td></td>
		</tr>
	</tbody>
</table>

arbovirus infections as screening tools for the identification of viral immunomodulators and host antiviral factors

RNA müdahale - ve genom düzenleme-tabanlı platformlar tarama virüs çoğaltma kısıtlamak konak hücre faktörleri tanımlamak için yaygın olarak kullanılmaktadır. Ancak, bu ekranlar genellikle viral patojen altında eğitim için doğal olarak keyfi olan hücreler yapılmaktadır. Bu nedenle, virüs denetimi koşullarında güçlü çoğaltma bu ekranlar dinamik aralığını sınırlayabilir. Ayrıca, bu ekranlar virüs çoğaltma virüs iyi adapte ana bilgisayara ve antiviral savunma mücadele yeteneğine ise sınırlandıran hücresel savunma yolları kolayca belirleyemiyor olabilir. Bu makalede, biz arboviruses gibi vesicular Stomatit virüs (VSV) tarafından üzerinde doğal olarak başarısız enfeksiyonlar virüs-ana etkileşimler merkezi ekranlar aracılığıyla keşfetmek için yeni bir paradigma tanımlamak. Çeşitli dipteran böcek ve memeli ev sahibi çoğaltmak yeteneği VSV rağmen VSV Lepidoptera böcekler, gypsy moth (Lymantria dispar) gibi türetilmiş hücre hatları çeşitli sonrası giriş, başarısız bir enfeksiyon uğrar. "Ne zaman konak hücre antiviral Savunma virüs olduğundan Ancak, bunlar abes VSV hastalık kurtarıldı". Biz nasıl VSV kodlama uygun reporter genler ve kısıtlayıcı L. dispar suşları tarif hücre hatları ana faktörler Abdovirüs sınırlama içinde katılan tanımlamak için kurulum ekranları için eşleştirilmiş. Ayrıca, biz de bu tarama araçları yarar VSV çoğaltma veya ektopik ifade memeli virüsler tarafından kodlanmış dahil olmak üzere, coinfection sırasında kurtarma virally kodlanmış faktörler tanımlaması gösterir. L. dispar hücrelerdeki VSV çoğaltma doğal sınırlamasının VSV kurtarma, böylece izlemek için basit ışıma ve floresan tabanlı deneyleri kullanımını teşvik koşulları için eleme yüksek sinyal gürültü oranı sağlar VSV çoğaltma değişiklikleri. Bu metodolojileri ana bilgisayar antiviral yanıt ve viral bağışıklık kaçırma faktörler arasındaki etkileşimi anlamak için değerlidir.

Canlı hücre görüntüleme uygulamaları VSV kurtarma VACV coinfection üzerine izlemek için bir örnek olarak, LD652 hücreleri bir 8-şey odacıklı tabak içinde kaplama ve sahte enfekte veya VSV-DsRed ile enfekte (MOI = 1) varlığı veya yokluğu VACV-FL-GFP (MOI = 25). VSV-DsRed DsRed ücretsiz bir protein olarak ifade eder ve yapısal VSV proteinler (Şekil 1A) erimiş değil çünkü, VSV giriş ve gen ifade başlattıktan sonra sadece algılanır....

Watch this Scientific Journal Video about Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors at JoVE.com

Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors

Burada, Abdovirüs çoğaltma ve Abdovirüs çoğaltma kısıtlamak 2) ökaryotik ana faktörler teşvik 1) virüs kodlanmış immunomodulators tanımlamak için protokolleri mevcut. Floresan ve ışıldama dayalı yöntemlerin araştırmacılar hızla düşük sinyal noise oranları ile basit deneyleri Abdovirüs çoğaltma nicel veriler elde etmek için izin verir.

Araçlar Viral Immunomodulators ve ana bilgisayar Antiviral faktörler tanımlanması için eleme olarak Abdovirüs enfeksiyonlar

RNA interference- and genome editing-based screening platforms have been widely used to identify host cell factors that restrict virus replication. ...

arbovirus-infections-as-screening-tools-for-identification-viral

Research

JoVE Journal

Immunology and Infection

6.8K Görüntüleme.  University of Texas Southwestern Medical Center. Burada, Abdovirüs çoğaltma ve Abdovirüs çoğaltma kısıtlamak 2) ökaryotik ana faktörler teşvik 1) virüs kodlanmış immunomodulators tanımlamak için protokolleri mevcut. Floresan ve ışıldama dayalı yöntemlerin araştırmacılar hızla düşük sinyal noise oranları ile basit deneyleri Abdovirüs çoğaltma nicel veriler elde etmek için izin verir.

Video: Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Viral pathogens represent a significant public health threat; not only can viruses cause natural epidemics of human disease, but their potential use in bioterrorism is also a concern. A better understanding of the cellular factors that impact infection would facilitate the development of much-needed therapeutics. Recent advances in RNA interference (RNAi) technology coupled with complete genome sequencing of several organisms has led to the optimization of genome-wide, cell-based loss-of-function screens. Drosophila cells are particularly amenable to genome-scale screens because of the ease and efficiency of RNAi in this system 1. Importantly, a wide variety of viruses can infect Drosophila cells, including a number of mammalian viruses of medical and agricultural importance 2,3,4. Previous RNAi screens in Drosophila have identified host factors that are required for various steps in virus infection including entry, translation and RNA replication 5. Moreover, many of the cellular factors required for viral replication in Drosophila cell culture are also limiting in human cells infected with these viruses 4,6,7,8, 9. Therefore, the identification of host factors co-opted during viral infection presents novel targets for antiviral therapeutics. Here we present a generalized protocol for a high-throughput RNAi screen to identify cellular factors involved in viral infection, using vaccinia virus as an example.

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Novel host factors involved in viral infection can be identified through cell-based genome-wide loss of function RNAi screening. A Drosophila cell culture model is particularly amenable to this approach due to the ease and efficiency of RNAi. Here we demonstrate this technique using vaccinia virus as an example.

RNAi Tarama için ilgilendim Ana Faktörler Vaccinia Virüs Enfeksiyonu Drosophila Hücre

Viral pathogens represent a significant public health threat; not only can viruses cause natural epidemics of human disease, but their potential use in ...

İmmünoloji ve Enfeksiyon

Introducing Shear Stress in the Study of Bacterial Adhesion

During bacterial infections a sequence of interactions occur between the pathogen and its host. Bacterial adhesion to the host cell surface is often the initial and determining step of the pathogenesis. Although experimentally adhesion is mostly studied in static conditions adhesion actually takes place in the presence of flowing liquid. First encounters between bacteria and their host often occur at the mucosal level, mouth, lung, gut, eye, etc. where mucus flows along the surface of epithelial cells. Later in infection, pathogens occasionally access the blood circulation causing life-threatening illnesses such as septicemia, sepsis and meningitis. A defining feature of these infections is the ability of these pathogens to interact with endothelial cells in presence of circulating blood. The presence of flowing liquid, mucus or blood for instance, determines adhesion because it generates a mechanical force on the pathogen. To characterize the effect of flowing liquid one usually refers to the notion of shear stress, which is the tangential force exerted per unit area by a fluid moving near a stationary wall, expressed in dynes/cm2. Intensities of shear stress vary widely according to the different vessels type, size, organ, location etc. (0-100 dynes/cm2). Circulation in capillaries can reach very low shear stress values and even temporarily stop during periods ranging between a few seconds to several minutes 1. On the other end of the spectrum shear stress in arterioles can reach 100 dynes/cm2 2. The impact of shear stress on different biological processes has been clearly demonstrated as for instance during the interaction of leukocytes with the endothelium 3. To take into account this mechanical parameter in the process of bacterial adhesion we took advantage of an experimental procedure based on the use of a disposable flow chamber 4. Host cells are grown in the flow chamber and fluorescent bacteria are introduced in the flow controlled by a syringe pump. We initially focused our investigations on the bacterial pathogen Neisseria meningitidis, a Gram-negative bacterium responsible for septicemia and meningitis. The procedure described here allowed us to study the impact of shear stress on the ability of the bacteria to: adhere to cells 1, to proliferate on the cell surface 5and to detach to colonize new sites 6 (Figure 1). Complementary technical information can be found in reference 7. Shear stress values presented here were chosen based on our previous experience1 and to represent values found in the literature. The protocol should be applicable to a wide range of pathogens with specific adjustments depending on the objectives of the study.

During the infection process, a key step is the adhesion of pathogens with host cells. In most instances this adhesion step occurs in the presence of mechanical stress generated by flowing liquid. We describe a technique that introduces shear stress as an important parameter in the study of bacterial adhesion.

Bakteriyel Yapışma Çalışma Kesme Stres Tanıtımı

During bacterial infections a sequence of interactions occur between the pathogen and its host. Bacterial adhesion to the host cell surface is often the ...

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The apical and basolateral surfaces of airway epithelial cells demonstrate directional responses to pathogen exposure in vivo. Thus, ideal in vitro models for examining cellular responses to respiratory pathogens polarize, forming apical and basolateral surfaces. One such model is differentiated normal human bronchial epithelial cells (NHBE). However, this system requires lung tissue samples, expertise isolating and culturing epithelial cells from tissue, and time to generate an air-liquid interface culture.
Calu-3 cells, derived from a human bronchial adenocarcinoma, are an alternative model for examining the response of proximal airway epithelial cells to respiratory insult1, pharmacological compounds2-6, and bacterial7-9 and viral pathogens, including influenza virus, rhinovirus and severe acute respiratory syndrome - associated coronavirus10-14. Recently, we demonstrated that Calu-3 cells are susceptible to respiratory syncytial virus (RSV) infection in a manner consistent with NHBE15,16 . Here, we detail the establishment of a polarized, liquid-covered culture (LCC) of Calu-3 cells, focusing on the technical details of growing and culturing Calu-3 cells, maintaining cells that have been cultured into LCC, and we present the method for performing respiratory virus infection of polarized Calu-3 cells.
To consistently obtain polarized Calu-3 LCC, Calu-3 cells must be carefully subcultured before culturing in Transwell inserts. Calu-3 monolayer cultures should remain below 90% confluence, should be subcultured fewer than 10 times from frozen stock, and should regularly be supplied with fresh medium. Once cultured in Transwells, Calu-3 LCC must be handled with care. Irregular media changes and mechanical or physical disruption of the cell layers or plates negatively impact polarization for several hours or days. Polarization is monitored by evaluating trans-epithelial electrical resistance (TEER) and is verified by evaluating the passive equilibration of sodium fluorescein between the apical and basolateral compartments17,18 . Once TEER plateaus at or above 1,000 &Omega;&times;cm2, Calu-3 LCC are ready to use to examine cellular responses to respiratory pathogens.

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The findings and conclusions in this report are those of the authors and do not necessarily represent the views of the Centers for Disease Control and Prevention.

Polarize İnsan Havayolu bir sıvı kaplı Kültürünün Oluşturulması Solunum Patojenler için Host Hücre Yanıtı Okumak Epitel Calu-3 Hücreler<em&gt; In vitro</em

The  apical and basolateral surfaces of airway epithelial cells demonstrate  directional responses to pathogen exposure in  vivo. Thus, ideal in vitro ...

Using Click Chemistry to Measure the Effect of Viral Infection on Host-Cell RNA Synthesis

Many RNA viruses have evolved the ability to inhibit host cell transcription as a means to circumvent cellular defenses. For the study of these viruses, it is therefore important to have a quick and reliable way of measuring transcriptional activity in infected cells. Traditionally, transcription has been measured either by incorporation of radioactive nucleosides such as 3H-uridine followed by detection via autoradiography or scintillation counting, or incorporation of halogenated uridine analogs such as 5-bromouridine (BrU) followed by detection via immunostaining. The use of radioactive isotopes, however, requires specialized equipment and is not feasible in a number of laboratory settings, while the detection of BrU can be cumbersome and may suffer from low sensitivity.
The recently developed click chemistry, which involves a copper-catalyzed triazole formation from an azide and an alkyne, now provides a rapid and highly sensitive alternative to these two methods. Click chemistry is a two step process in which nascent RNA is first labeled by incorporation of the uridine analog 5-ethynyluridine (EU), followed by detection of the label with a fluorescent azide. These azides are available as several different fluorophores, allowing for a wide range of options for visualization.
This protocol describes a method to measure transcriptional suppression in cells infected with the Rift Valley fever virus (RVFV) strain MP-12 using click chemistry. Concurrently, expression of viral proteins in these cells is determined by classical intracellular immunostaining. Steps 1 through 4 detail a method to visualize transcriptional suppression via fluorescence microscopy, while steps 5 through 8 detail a method to quantify transcriptional suppression via flow cytometry. This protocol is easily adaptable for use with other viruses.

This method describes the use of click chemistry to measure changes in host cell transcription after infection with the Rift Valley fever virus (RVFV) strain MP-12. Results can be visualized qualitatively via fluorescence microscopy or obtained quantitatively through flow cytometry. This method is adaptable for use with other viruses.

Ana-Hücre RNA sentezi üzerinde Viral Enfeksiyon Etkisi Tedbir tıklayın Kimya Kullanımı

Many RNA viruses have evolved the ability to inhibit host cell transcription as a means to circumvent cellular defenses. For the study of these viruses, ...

VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance

Nonhost disease resistance of plants against bacterial pathogens is controlled by complex defense pathways. Understanding this mechanism is important for developing durable disease-resistant plants against wide range of pathogens. Virus-induced gene silencing (VIGS)-based forward genetics screening is a useful approach for identification of plant defense genes imparting nonhost resistance. Tobacco rattle virus (TRV)-based VIGS vector is the most efficient VIGS vector to date and has been efficiently used to silence endogenous target genes in Nicotiana benthamiana.

	In this manuscript, we demonstrate a forward genetics screening approach for silencing of individual clones from a cDNA library in N. benthamiana and assessing the response of gene silenced plants for compromised nonhost resistance against nonhost pathogens, Pseudomonas syringae pv. tomato T1, P. syringae pv. glycinea, and X. campestris pv. vesicatoria. These bacterial pathogens are engineered to express GFPuv protein and their green fluorescing colonies can be seen by naked eye under UV light in the nonhost pathogen inoculated plants if the silenced target gene is involved in imparting nonhost resistance. This facilitates reliable and faster identification of gene silenced plants susceptible to nonhost pathogens. Further, promising candidate gene information can be known by sequencing the plant gene insert in TRV vector. Here we demonstrate the high throughput capability of VIGS-mediated forward genetics to identify genes involved in nonhost resistance. Approximately, 100 cDNAs can be individually silenced in about two to three weeks and their relevance in nonhost resistance against several nonhost bacterial pathogens can be studied in a week thereafter. In this manuscript, we enumerate the detailed steps involved in this screening. VIGS-mediated forward genetics screening approach can be extended not only to identifying genes involved in nonhost resistance but also to studying genes imparting several biotic and abiotic stress tolerances in various plant species.

Virus-induced gene silencing is an useful tool for identifying genes involved in nonhost resistance of plants. We demonstrate the use of bacterial pathogens expressing GFPuv in identifying gene silenced plants susceptible to nonhost pathogens. This approach is easy, fast and facilitates large scale screening and similar protocol can be applied to studying various other plant-microbe interactions.

Genler belirlenmesi için VIGS-aracılığı ile İleri Genetik Tarama konakçı olmayan Direnç ilgilendim


	Nonhost disease resistance of plants against bacterial pathogens is controlled by complex defense pathways. Understanding this mechanism is important ...

Generation and Multi-phenotypic High-content Screening of Coxiella burnetii Transposon Mutants

Invasion and colonization of host cells by bacterial pathogens depend on the activity of a large number of prokaryotic proteins, defined as virulence factors, which can subvert and manipulate key host functions. The study of host/pathogen interactions is therefore extremely important to understand bacterial infections and develop alternative strategies to counter infectious diseases. This approach however, requires the development of new high-throughput assays for the unbiased, automated identification and characterization of bacterial virulence determinants. Here, we describe a method for the generation of a GFP-tagged mutant library by transposon mutagenesis and the development of high-content screening approaches for the simultaneous identification of multiple transposon-associated phenotypes. Our working model is the intracellular bacterial pathogen Coxiellaburnetii, the etiological agent of the zoonosis Q fever, which is associated with severe outbreaks with a consequent health and economic burden. The obligate intracellular nature of this pathogen has, until recently, severely hampered the identification of bacterial factors involved in host pathogen interactions, making of Coxiella the ideal model for the implementation of high-throughput/high-content approaches.

Generation and Multi-phenotypic High-content Screening of Coxiella burnetii Transposon Mutants

Coxiella burnetii is an obligate intracellular Gram-negative bacterium responsible for the zoonotic disease Q fever. Here we describe methods for the generation of Coxiella fluorescent transposon mutants as well as the automated identification and analysis of the resulting internalization, replication and cytotoxic phenotypes.

Üretim ve Çok fenotipik Yüksek içerik Eleme<em&gt; Coxiella burnetii</em&gt; Transposon Mutantlar

Invasion and colonization of host cells by bacterial pathogens depend on the activity of a large number of prokaryotic proteins, defined as virulence ...

Early Viral Entry Assays for the Identification and Evaluation of Antiviral Compounds

Cell-based systems are useful for discovering antiviral agents. Dissecting the viral life cycle, particularly the early entry stages, allows a mechanistic approach to identify and evaluate antiviral agents that target specific steps of the viral entry. In this report, the methods of examining viral inactivation, viral attachment, and viral entry/fusion as antiviral assays for such purposes are described, using hepatitis C virus as a model. These assays should be useful for discovering novel antagonists/inhibitors to early viral entry and help expand the scope of candidate antiviral agents for further drug development.

Here, we present a protocol that examines specific steps of the viral entry to identify and evaluate novel antiviral agents.

Erken Viral Giriş Tespiti için Tahliller ve Antiviral Bileşiklerin Değerlendirilmesi

Cell-based systems are useful for discovering antiviral agents. Dissecting the viral life cycle, particularly the early entry stages, allows a mechanistic ...

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

Coxiella burnetii, the agent causing Q fever, is an obligate intracellular bacterium. PCR based diagnostic assays have been developed for detecting C. burnetii DNA in cell cultures and clinical samples. PCR requires specialized equipment and extensive end user training, and therefore, it is not suitable for routine work especially in a resource-constrained area. We have developed a loop-mediated isothermal amplification (LAMP) assay to detect the presence of C. burnetii in patient samples. This method is performed at a single temperature around 60 &#176;C in a water bath or heating block. The sensitivity of this LAMP assay is very similar to PCR with a detection limit of about 25 copies per reaction. This report describes the preparation of the reaction using lyophilized reagents and visualization of results using hydroxynaphthol blue (HNB) or a UV lamp with fluorescent intercalating dye in the reaction. The LAMP reagents were lyophilized and stored at room temperature (RT) for one month without loss of detection sensitivity. This LAMP assay is particularly robust because the reaction mixture preparation does not involve complex steps. This method is ideal for use in resource-limited settings where Q fever is endemic.

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

We described here a simple loop-mediated isothermal amplification (LAMP) method using lyophilized reagents for the detection of C. burnetii in patient samples.

tespiti için Liyofilize Döngü aracılı İzotermal Amplifikasyon Reaktifler Gelişimi<em&gt; Coxiella burnetii</em

Coxiella burnetii, the agent causing Q fever, is an obligate intracellular bacterium. PCR based diagnostic assays have been developed for detecting C. ...

Human Placental and Decidual Organ Cultures to Study Infections at the Maternal-fetal Interface

The placenta shows a large degree of interspecies anatomic variability. To best understand biology and pathophysiology of the human placenta, it is imperative to design experiments using human cells and tissues. An advantage of organ culture is maintenance of three-dimensional (3D) structural organization and extracellular matrix. The goal of the method described here is successful establishment of ex vivo human gestational tissue organ cultures and their healthy culture maintenance for 72-96 hr. The protocol details the immediate processing of research-consented, placental and decidual specimens fresh from the operating suite. These are abundant specimens that would otherwise be discarded. Detailed instructions on the sterile collection of these samples, including morphologic details on how to select appropriate tissues to establish 3D organ cultures, is provided. Placental villous and decidual tissues are microdissected into 2-3 mm3 pieces and placed separately on matrix-lined transwell filters and cultured for several days. Villous and decidual organ cultures are well suited for the study of human host-pathogen interaction. As compared to other model organisms, these human cultures are particularly advantageous to examine mechanism of infection for pathogens that demonstrate variable patterns of host specificity. As an example, we demonstrate infection of placental and decidual organ cultures with the clinically relevant, facultative intracellular bacterial pathogen Listeria monocytogenes.

A simple method to establish primary human placental (villous) and decidual organ cultures is described. Villous and decidual organ cultures are invaluable tools for studying pathogenesis at the human maternal-fetal interface. Infection with the facultative intracellular bacterium Listeria monocytogenes is demonstrated.

İnsan Plasental ve Desidual Organ Kültürleri Maternal-Fetal Arayüz de Enfeksiyonlar Eğitim için

The placenta shows a large degree of interspecies anatomic variability. To best understand biology and pathophysiology of the human placenta, it is ...

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

Brucella species are facultative intracellular pathogens that infect animals as their natural hosts. Transmission to humans is most commonly caused by direct contact with infected animals or by ingestion of contaminated food and can lead to severe chronic infections.
Brucella can invade professional and non-professional phagocytic cells and replicates within endoplasmic reticulum (ER)-derived vacuoles. The host factors required for Brucella entry into host cells, avoidance of lysosomal degradation, and replication in the ER-like compartment remain largely unknown. Here we describe two assays to identify host factors involved in Brucella entry and replication in HeLa cells. The protocols describe the use of RNA interference, while alternative screening methods could be applied. The assays are based on the detection of fluorescently labeled bacteria in fluorescently labeled host cells using automated wide-field microscopy. The fluorescent images are analyzed using a standardized image analysis pipeline in CellProfiler which allows single cell-based infection scoring.
In the endpoint assay, intracellular replication is measured two days after infection. This allows bacteria to traffic to their replicative niche where proliferation is initiated around 12 hr after bacterial entry. Brucella which have successfully established an intracellular niche will thus have strongly proliferated inside host cells. Since intracellular bacteria will greatly outnumber individual extracellular or intracellular non-replicative bacteria, a strain constitutively expressing GFP can be used. The strong GFP signal is then used to identify infected cells.
In contrast, for the entry assay it is essential to differentiate between intracellular and extracellular bacteria. Here, a strain encoding for a tetracycline-inducible GFP is used. Induction of GFP with simultaneous inactivation of extracellular bacteria by gentamicin enables the differentiation between intracellular and extracellular bacteria based on the GFP signal, with only intracellular bacteria being able to express GFP. This allows the robust detection of single intracellular bacteria before intracellular proliferation is initiated.

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

Two assays for microscopy-based high-throughput screening of host factors involved in Brucella infection are described. The entry assay detects host factors required for Brucella entry and the endpoint assay those required for intracellular replication. While applicable for alternative approaches, siRNA screening in HeLa cells is used to illustrate the protocols.

Yer Alan Ana Faktörler yüksek verimli tarama mikroskopisi bazlı deneyler<em&gt; Brucella</em&gt; Hela Hücrelerinin Enfeksiyon

Brucella species are facultative intracellular pathogens that infect animals as their natural hosts. Transmission to humans is most commonly caused by ...

Araçlar Viral Immunomodulators ve ana bilgisayar Antiviral faktörler tanımlanması için eleme olarak Abdovirüs enfeksiyonlar

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler

RNAi Tarama için ilgilendim Ana Faktörler Vaccinia Virüs Enfeksiyonu Drosophila Hücre

Bakteriyel Yapışma Çalışma Kesme Stres Tanıtımı

Polarize İnsan Havayolu bir sıvı kaplı Kültürünün Oluşturulması Solunum Patojenler için Host Hücre Yanıtı Okumak Epitel Calu-3 Hücreler

Ana-Hücre RNA sentezi üzerinde Viral Enfeksiyon Etkisi Tedbir tıklayın Kimya Kullanımı

Genler belirlenmesi için VIGS-aracılığı ile İleri Genetik Tarama konakçı olmayan Direnç ilgilendim

Üretim ve Çok fenotipik Yüksek içerik Eleme

Erken Viral Giriş Tespiti için Tahliller ve Antiviral Bileşiklerin Değerlendirilmesi

tespiti için Liyofilize Döngü aracılı İzotermal Amplifikasyon Reaktifler Gelişimi

İnsan Plasental ve Desidual Organ Kültürleri Maternal-Fetal Arayüz de Enfeksiyonlar Eğitim için

Yer Alan Ana Faktörler yüksek verimli tarama mikroskopisi bazlı deneyler