D.G.는 텍사스 대학의 남서부 의료 센터의 부여 학자 프로그램에서 자금을 지원 했다. 저자는 마이클 휘 트 (테네시 대학 건강 과학 센터)와 숀 Whelan (하버드의과 대학) VSV DsRed 및 VSV 뤽의 조항에 대 한 감사. 또한 저자 게리 Luker (미시간 대학의과 대학) VACV-플로리다-GFP 긴장의 종류 선물 감사합니다.

1. 일반적인 Lymantria dispar (LD652) 세포와 바이러스 문화
<ol><li>
LD652 셀 배양 및 도금
	<ol>
<li>문화 나 dispar-파생된 LD652 세포는 정상적인 분위기에서 27 ° C에서 incubated 성장 매체 (자료 테이블)에 있는 세포의 단층을 유지. 조직 문화 취급 요리 10 cm 세포를 유지 하 고 80 %confluency 도달 시 세포를 통과.</li>
		<li>하려면 접시, 접시에서 부착 LD652 셀 (이 셀이 꺼내 려 trypsinization를 필요로 하지 않는) 단층에 반복적으로 미디어를 pipetting으로 꺼내 1 x 105 셀/mL의 대략 조밀도에 성장 매체에서 샘플을 희석. 1 mL의 희석 문화/24-잘 접시의 플라스틱 각 시간 포인트 (최대 8 개의 치료/접시)에 대 한 3 개의 복제 웰 스/치료 형식의 최소 씨앗</li>
		<li>1 h의 최소를 셀 수 있습니다.</li>
	</ol>
</li>
	<li>
Vaccinia 바이러스 준비
	<ol>
<li>VACV의 준비, 헬러에 바이러스를 증폭 세포20 또는 아프리카 녹색 원숭이 신장 세포 (BSC-1 또는 BSC 40 셀)20,,2122. 참고: VACV 스트레인 서쪽 예비 (VACV-WR) 여기에서 설명 하는 분석 실험에서 잘 작동 합니다.</li>
		<li>VACV 긴장을 통해 플 라크 분석 결과 BSC-1 또는 BSC 40 셀20,22에 적정 참고: 모든 VACV 복합성 감염 (MOI)의 세포 감염 titers BSC 40 패 분석 실험에서 얻은 기반으로 하는 LD652에 대 한 여기에 설명 된 표시.</li>
	</ol>
</li>
	<li>
Vesicular 구내 염 바이러스 준비
	<ol>
<li>VSV 주식 준비, BHK 세포23바이러스를 증폭.</li>
		<li>BSC-40 또는 BHK 세포 monolayers13,23패 분석 실험에 의해 VSV를 적정. 참고: 모든 VSV MOIs 여기 셀 감염 titers BSC 40 패 분석 실험에서 얻은 기반으로 하는 LD652에 대 한 설명.</li>
	</ol>
</li>
</ol>2. 형광 기반 VSV 구조 분석 결과 공동 감염 및 라이브 셀 이미징 사용 하 여
<ol><li>
시드 및 LD652 세포의 감염
	<ol>
<li>8 잘 챔버의 40000 LD652 셀/잘 플레이트.</li>
		<li>형광 기반 라이브 셀 이미징, VSV 긴장 형광 단백질을 인코딩을 사용 합니다. 여기에 제시 된 실험 VSV DsRed17, 다른 VSV 단백질에 융합 하지 무료 DsRed 단백질을 표현 하는 재조합 VSV 긴장을 사용 합니다. 참고: LD652 셀의 VSV 감염 96 hpi에 의해 cytopathic 이며, 따라서, 세포 죽음 아니다 혼동 요인이 시간 내 VSV 복제를 평가할 때.</li>
		<li>혈 청 무료 미디어 (SFM; VSV-DsRed 및 VACV-플로리다-GFP를 준비 자료의 테이블) 1 25 년의 나에 각각. 참고: VACV-플로리다-GFP는 루크와 GFP24사이의 융합을 표현 하는 재조합 VACV 긴장. VACV 변종에 대 한 25 또는 더 큰 나를 사용 하 여 모든 LD652 세포 감염된13는 보장 합니다. 다른 coinfecting 바이러스를 사용 하는 경우에 나 사용자에 의해 실험적으로 결정 해야 합니다. 각 감염 치료 중복 우물에서 설정 해야 하 고 포함 모의 감염 치료만 SFM 셀에 추가 됩니다.</li>
		<li>27 ° c.에서 2 h inoculum 0.2 mL에 셀을 품 어</li>
		<li>씻어 0.5 mL/성장 매체의 셀.</li>
		<li>셀 셀 생존 염료 (자료 테이블)의 25 μ M에 27 ° c.에서 45 분에 대 한 성장 매체에 품 어</li>
		<li>미디어를 발음 하 고 세척 우물 1 x 0.5 mL/과잉 염료를 제거 하는 잘.</li>
		<li>셀 0.3 mL/성장 매체의 잘 유지 합니다.</li>
	</ol>
</li>
	<li>
라이브 셀 이미지 캡처
	<ol>
<li>Confocal 현미경 30 분 사전에 켜고 8 잘 챔버 접시를 로드. 참고: LD652 셀 20-25 ° C에서 배열 하는 실내 온도에 몇 군데 있습니다 하지만 최적의 조건, 방의 온도 27 ° c.에 조정 되어야 한다</li>
		<li>단계 대조 이미지 설정 뿐 아니라 이미지 수를 각 형광 마커 단백질에 대 한 적절 한 여기/방출 설정을 설정 합니다.</li>
		<li>각 채널에 대 한 레이저 강도 조정 합니다. 참고:이 마지막 실험에 사용 될 시간 내내 관찰 하는 형광 신호 강렬의 범위를 결정 하는 시범 실험을 실행 해야 합니다.</li>
		<li>원하는 시간 까지는 감염의 기간에 대 한 각 잘 각 1-5 h의 위상 대비 및 형광 이미지를 캡처 10 X 목표를 사용 하 여 (예., 48-72 hpi). 참고: 각 잘 정확 하 게 문화를 통해 감염 속도 추정 하에 여러 필드의 보기를 캡처하는 데 중요 하다.</li>
	</ol>
</li>
	<li>
이미지 분석
	<ol>
<li>이미지 분석 소프트웨어를 사용 하 여 적절 한 형광 채널의 자동된 이미지 분석 (예., 405 nm, 488 nm, 568 nm).</li>
		<li>감염 된 세포의 백분율을 계산 하려면 분할 VSV 감염을 나타내는 형광 세포의 총 수 (예., VSV DsRed 감염에 대 한 DsRed-긍정적인 세포) 세포 생존 염료에 의해 표시 된 가능한 세포의 총 수로 모든 치료에서 각 필드의 보기</li>
	</ol>
</li>
</ol>3. 일반 바이러스 감염 프로토콜 LD652 세포에서 발광 기반 VSV 구조 분석에 대 한
<ol><li>
Inoculum의 준비
	<ol>
<li>이전에, 감염 30 분 녹여 VSV 루크16 (재조합 VSV 긴장 무료 반딧불 luciferase 단백질 하지 다른 VSV 단백질을 융합 하는 표현)의 주식. 만약 VSV 뤽 구조에 대 한 VACV coinfection 동안 시 금, 또한 VACV WR 바이러스 얼음에 녹여. 참고: (VACV-WR) 외 다른 바이러스 coinfection, 동안 VSV 루크를 구출 수 있습니다 하지만이 각 사용자에 의해 실험적으로 결정 될 것 이다.</li>
		<li>10 그리고 25의 나 각각 0.2 mL의 총 inoculum 볼륨을 추가할 때 유발은 SFM으로 VACV WR의 유무에 VSV 루크를 diluting 하 여는 inoculum을 준비/잘.</li>
	</ol>
</li>
	<li>
세포의 감염
	<ol>
<li>성숙한 LD652 미디어는 단층을 방해 하지 않으려면 신중 하 게 발음 하 고 바이러스/잘 0.2 mL를 접종. 이 시간 0 hpi로 정의 됩니다. "모의 감염" 부정적인 제어 트리 트 먼 트로 추가 우물을 메 마른 SFM을 추가 합니다.</li>
		<li>27 ° c.에서 2 h inoculum 셀을 품 어</li>
		<li>2 hpi에서 포부에 의해 inoculum을 제거 1 mL를 바꿉니다/LD652 성장 매체를 잘.</li>
		<li>24-72 hpi 진행에 감염을 수 있습니다.</li>
	</ol>
</li>
</ol>4. luciferase 분석 결과
<ol><li>
세포 lysates의 준비
	<ol>
<li>신중 하 게는 상쾌한 발음 및 Dulbecco의 인산 염 버퍼 식 염 수 (DPBS)의 1 mL을 추가/잘.</li>
		<li>1 mL 주사기의 플런저를 사용 하 여 DPBS로 셀을 다쳤어요.</li>
		<li>Microcentrifuge 튜브, 및 4 ° c.에 20 분에 대 한 400 x g 에서 원심 분리기는 셀 전송</li>
		<li>한편, 1 x 희석 기자 세포의 용 해 버퍼 (RLB) 살 균 H2o. x 5의 준비</li>
		<li>원심 분리, 다음 셀 펠 렛을 방해 하지 않고는 DPBS 발음.</li>
		<li>각 펠 릿 1의 150 µ L에서 resuspend x RLB.</li>
		<li>샘플 1-80 ° C 냉장고 실내 온도 물 욕조에 급속 해 동 뒤에 5 분 외피를 사용 하 여 x를 동결-해 동. -80 ° C에서 lysates 분석할 준비가 될 때까지 저장 합니다.</li>
	</ol>
</li>
	<li>
Luciferase 분석 결과
	<ol>
<li>얼음에 lysates 녹여</li>
		<li>20 μ의 단색 검정 또는 흰색 96-잘 미 판으로 lysate의 플라스틱</li>
		<li>각 잘 100 μ luciferase 분석 실험 시 약의 추가.</li>
		<li>즉시 사용 하는 루미 노 빛의 강도 측정 (특정 luminometers에 대 한 적절 한 설정을 해야 합니다 사용자에 의해 실험적으로 결정).</li>
	</ol>
</li>
	<li>
Luciferase 분석 결과 분석
	<ol>
<li>루 루 수치 제어 트리 트 먼 트 (대표 결과)에서 얻은 각 치료에 대 한 신호를 정상화. 적어도 3 개의 독립적인 실험 수행한 후 적절 한 통계적 테스트에 의해 루 각 치료/제어 그룹에서 얻은 의미를 분석할 수 있습니다.</li>
	</ol>
</li>
</ol>5입니다. Immunoblot
<ol><li>SDS 페이지 및 적절 한 시 약 및 계측을 사용 하 여 후속 immunoblotting 뤽 분석 실험에 대 한 추출 lysates를 사용 합니다.</li>
</ol>6. titer VSV LD652 세포 배양에서의
<ol><li>1.1 단계에 따라 플레이트 LD652 셀입니다.</li>
	<li>바이러스 성 감염 3 단계에 따라 셀.</li>
	<li>원하는 시간 지점에서 살 균 microcentrifuge 튜브는 supernatants를 수집 합니다.</li>
	<li>4 ° C에서 10 분 1000 x g 를 사용 하 여 셀을 작은 고 새로운 튜브는 supernatants 전송.</li>
	<li>저장-80 ° C에서 supernatants 또는 BSC 40 세포 분석 결과 플 라크에 의해 적정 진행. 참고: 경우 넣는 VSV VACV를 포함 하는 LD652 세포 배양에서 그것은 BSC-40 monolayers13플 라크 형성에서 잔여 VACV 입자를 방지 하기 위해 2 hpi 내 BSC 40 문화 미디어를 100 μ g/mL 시 토 신 arabinoside (아크)를 추가 하는 것이 좋습니다. 아크는 바이러스 성 DNA 중 합 효소 억제제 VACV DNA 복제25 차단 하지만 VSV 복제에는 영향을 미치지 않습니다.</li>
</ol>7. 발광 기반 VSV의 변형 구조 LD652 세포 분석 실험: RNAi 및 플라스 미드 Transfection 실험
<ol><li>
DsRNA 바이러스의 최저 RNAi 중재에 대 한 준비 또는 호스트 사본
	<ol>
<li>디자인 유전자 특정 뇌관 꼬리 끝에 5' T7 발기인 순서 (TAATACGACTCACTATAGGG) 중 하나를 대상으로 coinfecting 바이러스 (예를들면, VACV) 또는 관심의 L. dispar mRNA 사본. 이 뇌관은 효과적인 RNAi 중재 최저에 대 한 400-600 bp의 PCR 제품을 생산 한다. 사기 그 외 참조 13 뇌관 시퀀스 사용 아래 최저 VACV 또는 L. dispar LD652 세포에서 RNAi dsRNA 중재 녹취 록. 참고: L. dispar mRNA 사본에서 확인할 수 있습니다 L. dispar transcriptome 데이터베이스26,,2728출판.</li>
		<li>DNA 템플릿을 통해 RT-PCR 생성 (cDNA 합성: 30 분; 50 ° C의 1 개 주기 PCR: 15 94 ° C의 40 주기 s, 30 ° C 50 s, 그리고 45 ° C 68 s 각).</li>
		<li>PCR 정화 키트를 사용 하 여 PCR 제품을 정화.</li>
		<li>템플릿으로 순화 PCR 제품을 사용 하 여 에 체 외 녹음 하 고 정화 dsRNA를 생체 외에서 전사 및 정화 키트를 사용 하 여.</li>
	</ol>
</li>
	<li>
Transfection dsRNA 또는 LD652 세포로 DNA 플라스 미드의
	<ol>
<li>씨앗 1 x 105 셀/24-잘 접시의 우물 그리고 셀 적어도 1 시간에 대 한 정착.</li>
		<li>페 수를 각 잘 SFM의 100 μ로 4 μ transfection 시 약의 희석. 실 온에서 최대 15 분 동안 품 어. 이 수행 되어야 할 모든 transfections에 대 한 마스터 믹스를 만들기 위해 확장할 수 있습니다.</li>
		<li>페 수를 각 잘 SFM의 100 μ로 dsRNA 또는 총 플라스 미드 DNA의 1 μ g까지 희석. 실 온에서 최대 15 분 동안 품 어. 참고: 우리는 이전에 발견 dsRNA/105 LD652 셀의 1 μ g의 transfection에 대 한 충분 한은 >의 80% 최저 바이러스 또는 호스트 사본13, dsRNA 복용 하지만 필요한 실험 수정에 대 한 설정 업/조건 해야 합니다 실험적으로 결정 될.</li>
		<li>Transfection 시 약 및 dsRNA/플라스 미드 DNA 희석 1:1 비율을 결합 (예를 들어, 희석된 dsRNA의 100 μ와 혼합 희석된 transfection 시 약의 100 μ)와 실 온에서 20 분 동안 품 어.</li>
		<li>한편, 1 mL/SFM의 우물을 세척 하 고 각 우물에 SFM의 500 μ를 추가.</li>
		<li>Transfection 시 약 dsRNA (또는 플라스 미드 DNA) 천천히 추가 각 우물에 dropwise 혼합물.</li>
		<li>Transfection 시 약 5 h에 대 한 셀을 품 어.<ol>
<li>RNAi에 대 한 최저 성적 (예, VACV), coinfecting 바이러스에 의해를 포함 하는 실험 바꿉니다 transfection 시 약 5 h transfection 잠복기 후 바이러스 inoculum VSV 루크를 포함 된 (또는 VACV 없이 또는 또 다른 coinfecting 바이러스) (3 단계). 그 후, 완전 한 성장 미디어 2 hpi와 VSV 루크를 포함 하는 바이러스 inoculum을 교체 합니다. 루크 분석 실험 (4 단계) 바이러스 사본 coinfecting의 최저 VSV 뤽 구조의 손실에 이르게 하는 경우 확인 하려면 다양 한 시간 포인트에서 추출한 lysates 다음 수행할 수 있습니다.</li>
			<li>RNAi 실험 L. dispar 성적표의 RNAi를 포함, 완전 한 성장 매체 transfection 믹스 바꿉니다 및 감염 VSV 뤽 (4 단계) 이전 24 시간에 대 한 ensue를 최저 허용. 루크 분석 실험 (4 단계) 다음 경우 L. dispar 성적 최저 승격 VSV 뤽 구조 결정을 다양 한 시간 포인트에서 추출한 lysates에 수행할 수 있습니다.</li>
			<li>플라스 미드 식 벡터 표현 후보 immunomodulators의 transfections를 포함 하는 실험에 대 한 transfection 시 약 교체 하 고 단백질 식 VSV 뤽 (4 단계)와 감염 전에 24 h에 대 한 허용 합니다. 루크 분석 실험 (단계 4) 후보 immunomodulatory 단백질의 표현을 촉진 VSV 뤽 구조를 다양 한 시간 포인트에서 추출한 lysates 다음 수행할 수 있습니다. 참고: transfection 조건 40-6013의 transfection 효율에 1 μ g/우물의 플라스 미드 DNA 결과 사용 하 여 여기에 설명 된.</li>
		</ol>
</li>
	</ol>
</li>
</ol>

<ol>
	<li>Nomaguchi, M., Fujita, M., Miyazaki, Y., Adachi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+tropism.">Viral tropism.</a> Frontiers in Microbiology. 3, 281 (2012).</li><li>Werden, S. J., McFadden, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+cell+signaling+in+poxvirus+tropism:+the+case+of+the+M-T5+host+range+protein+of+myxoma+virus.">The role of cell signaling in poxvirus tropism: the case of the M-T5 host range protein of myxoma virus.</a> Biochimica et Biophysica Acta (BBA) - Bioenergetics. 1784 (1), 228-237 (2008).</li><li>McFadden, G., Mohamed, M. R., Rahman, M. M., Bartee, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytokine+determinants+of+viral+tropism.">Cytokine determinants of viral tropism.</a> Nature Reviews: Immunology. 9 (9), 645-655 (2009).</li><li>Silva, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Second-generation+shRNA+libraries+covering+the+mouse+and+human+genomes.">Second-generation shRNA libraries covering the mouse and human genomes.</a> Nature Genetics. 37 (11), 1281-1288 (2005).</li><li>Moffat, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+lentiviral+RNAi+library+for+human+and+mouse+genes+applied+to+an+arrayed+viral+high-content+screen.">A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen.</a> Cell. 124 (6), 1283-1298 (2006).</li><li>Ma, D., Liu, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+Editing+and+Its+Applications+in+Model+Organisms.">Genome Editing and Its Applications in Model Organisms.</a> Genomics Proteomics Bioinformatics. 13 (6), 336-344 (2015).</li><li>Yin, H., Kauffman, K. J., Anderson, D. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delivery+technologies+for+genome+editing.">Delivery technologies for genome editing.</a> Nature Reviews: Drug Discovery. 16 (6), 387-399 (2017).</li><li>Hao, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drosophila+RNAi+screen+identifies+host+genes+important+for+influenza+virus+replication.">Drosophila RNAi screen identifies host genes important for influenza virus replication.</a> Nature. 454 (7206), 890-893 (2008).</li><li>Houzet, L., Jeang, K. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+screening+using+RNA+interference+to+study+host+factors+in+viral+replication+and+pathogenesis.">Genome-wide screening using RNA interference to study host factors in viral replication and pathogenesis.</a> Experimental Biology and Medicine. 236 (8), 962-967 (2011).</li><li>Marceau, C. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+dissection+of+Flaviviridae+host+factors+through+genome-scale+CRISPR+screens.">Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens.</a> Nature. 535 (7610), 159-163 (2016).</li><li>Savidis, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+Zika+Virus+and+Dengue+Virus+Dependency+Factors+using+Functional+Genomics.">Identification of Zika Virus and Dengue Virus Dependency Factors using Functional Genomics.</a> Cell Reports. 16 (1), 232-246 (2016).</li><li>Panda, D., Cherry, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-based+genomic+screening:+elucidating+virus-host+interactions.">Cell-based genomic screening: elucidating virus-host interactions.</a> Current Opinion in Virology. 2 (6), 784-792 (2012).</li><li>Gammon, D. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single+vertebrate+DNA+virus+protein+disarms+invertebrate+immunity+to+RNA+virus+infection.">A single vertebrate DNA virus protein disarms invertebrate immunity to RNA virus infection.</a> Elife. 3, (2014).</li><li>Letchworth, G. J., Rodriguez, L. L., Del cbarrera, ., J, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vesicular+stomatitis.">Vesicular stomatitis.</a> Veterinary Journal. 157 (3), 239-260 (1999).</li><li>Whelan, S. P., Ball, L. A., Barr, J. N., Wertz, G. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+recovery+of+infectious+vesicular+stomatitis+virus+entirely+from+cDNA+clones.">Efficient recovery of infectious vesicular stomatitis virus entirely from cDNA clones.</a> Proceedings of the National Academy of Sciences of the United States of America. 92 (18), 8388-8392 (1995).</li><li>Cureton, D. K., Massol, R. H., Saffarian, S., Kirchhausen, T. L., Whelan, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vesicular+stomatitis+virus+enters+cells+through+vesicles+incompletely+coated+with+clathrin+that+depend+upon+actin+for+internalization.">Vesicular stomatitis virus enters cells through vesicles incompletely coated with clathrin that depend upon actin for internalization.</a> PLoS Pathogens. 5 (4), e1000394 (2009).</li><li>Duntsch, C. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recombinant+vesicular+stomatitis+virus+vectors+as+oncolytic+agents+in+the+treatment+of+high-grade+gliomas+in+an+organotypic+brain+tissue+slice-glioma+coculture+model.">Recombinant vesicular stomatitis virus vectors as oncolytic agents in the treatment of high-grade gliomas in an organotypic brain tissue slice-glioma coculture model.</a> Journal of Neurosurgery. 100 (6), 1049-1059 (2004).</li><li>Li, Y., Yuan, S., Moyer, R. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+non-permissive+infection+of+insect+(gypsy+moth)+LD-652+cells+by+Vaccinia+virus.">The non-permissive infection of insect (gypsy moth) LD-652 cells by Vaccinia virus.</a> Virology. 248 (1), 74-82 (1998).</li><li>Seet, B. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Poxviruses+and+immune+evasion.">Poxviruses and immune evasion.</a> Annual Review of Immunology. 21, 377-423 (2003).</li><li>Cotter, C. A., Earl, P. L., Wyatt, L. S., Moss, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+Cell+Cultures+and+Vaccinia+Virus+Stocks.">Preparation of Cell Cultures and Vaccinia Virus Stocks.</a> Current Protocols in Microbiology. 39, 11-18 (2015).</li><li>Andrei, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cidofovir+resistance+in+vaccinia+virus+is+linked+to+diminished+virulence+in+mice.">Cidofovir resistance in vaccinia virus is linked to diminished virulence in mice.</a> Journal of Virology. 80 (19), 9391-9401 (2006).</li><li>Dascher, C., VanSlyke, J. K., Thomas, L., Balch, W. E., Thomas, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+recombinant+vaccinia+virus+for+expression+of+small+GTPases.">Preparation of recombinant vaccinia virus for expression of small GTPases.</a> Methods in Enzymology. , 174-188 (1995).</li><li>Martin, A., Rex, E. A., Ishidate, T., Lin, R., Gammon, D. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Infection+of+Caenorhabditis+elegans+with+Vesicular+Stomatitis+Virus+via+Microinjection.">Infection of Caenorhabditis elegans with Vesicular Stomatitis Virus via Microinjection.</a> Bio-Protocol. 7 (22), (2017).</li><li>Luker, K. E., Hutchens, M., Schultz, T., Pekosz, A., Luker, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bioluminescence+imaging+of+vaccinia+virus:+effects+of+interferon+on+viral+replication+and+spread.">Bioluminescence imaging of vaccinia virus: effects of interferon on viral replication and spread.</a> Virology. 341 (2), 284-300 (2005).</li><li>Rozelle, D. K., Filone, C. M., Dower, K., Connor, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaccinia+reporter+viruses+for+quantifying+viral+function+at+all+stages+of+gene+expression.">Vaccinia reporter viruses for quantifying viral function at all stages of gene expression.</a> Journal of Visualizes Experiments. (87), e51522 (2014).</li><li>Cao, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+the+transcriptome+of+the+Asian+gypsy+moth+Lymantria+dispar+identifies+numerous+transcripts+associated+with+insecticide+resistance.">Characterization of the transcriptome of the Asian gypsy moth Lymantria dispar identifies numerous transcripts associated with insecticide resistance.</a> Pesticide Biochemistry and Physiology. 119, 54-61 (2015).</li><li>Sparks, M. E., Blackburn, M. B., Kuhar, D., Gundersen-Rindal, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptome+of+the+Lymantria+dispar+(gypsy+moth)+larval+midgut+in+response+to+infection+by+Bacillus+thuringiensis.">Transcriptome of the Lymantria dispar (gypsy moth) larval midgut in response to infection by Bacillus thuringiensis.</a> PloS One. 8 (5), e61190 (2013).</li><li>Sparks, M. E., Gundersen-Rindal, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Lymantria+dispar+IPLB-Ld652Y+cell+line+transcriptome+comprises+diverse+virus-associated+transcripts.">The Lymantria dispar IPLB-Ld652Y cell line transcriptome comprises diverse virus-associated transcripts.</a> Viruses. 3 (11), 2339-2350 (2011).</li><li>Lin, G., Li, G., Granados, R. R., Blissard, G. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable+cell+lines+expressing+baculovirus+P35:+resistance+to+apoptosis+and+nutrient+stress,+and+increased+glycoprotein+secretion.">Stable cell lines expressing baculovirus P35: resistance to apoptosis and nutrient stress, and increased glycoprotein secretion.</a> In Vitro Cellular &amp; Developmental Biology - Animal. 37 (5), 293-302 (2001).</li><li>Li, W. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interferon+antagonist+proteins+of+influenza+and+vaccinia+viruses+are+suppressors+of+RNA+silencing.">Interferon antagonist proteins of influenza and vaccinia viruses are suppressors of RNA silencing.</a> Proceedings of the National Academy of Sciences of the United States of America. 101 (5), 1350-1355 (2004).</li><li>Kanost, M. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multifaceted+biological+insights+from+a+draft+genome+sequence+of+the+tobacco+hornworm+moth,+Manduca+sexta.">Multifaceted biological insights from a draft genome sequence of the tobacco hornworm moth, Manduca sexta.</a> Insect Biochemistry and Molecular Biology. 76, 118-147 (2016).</li><li>Paixao, E. S., Teixeira, M. G., Rodrigues, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika,+chikungunya+and+dengue:+the+causes+and+threats+of+new+and+re-emerging+arboviral+diseases.">Zika, chikungunya and dengue: the causes and threats of new and re-emerging arboviral diseases.</a> BMJ Global Health. 3, (2018).</li></ol>

저자는 공개 없다.

여기 우리는 VSV 복제 제한 lepidopteran 세포 배양에서 구출 하는 조건에 대 한 화면을 간단한 형광 및 발광 기반 분석 실험을 설명 했습니다. Lepidopteran 셀에 VSV의 조산 감염 VSV 유전자 발현에 대 한 시 금 때 우수한 신호 대 잡음 비율을 만듭니다. 예를 들어 단일 VSV 뤽 감염에서 lysates 감지 LU 신호 했다 ~ 1,000-fold 보다 높은 모의 감염 lysates 아직 이러한 신호만 72 h 시간 걸쳐 약 두 가지를 변경. VSV-루크?...

생산적으로 특정 호스트에 복제 하는 바이러스의 기능 바이러스 항목 및 복제1을 지 원하는 호스트 셀 요소의 가용성 부분에 적용 됩니다. 바이러스-호스트 범위 또한 카운터 세포 항 바이러스 방어 바이러스 성 복제2,3방해 그렇지 않으면 것을 바이러스의 용량에 의해 지시 될 수 있습니다. 그것은 궁극적으로 바이러스 특정 호스트에서의 라이프 사이클을 완료할 수 여부를 결정 하는 이러한 복잡 한 바이러스-호스트 상호 작용의 결과. 바이러스 성 복제 발생 하는 경우 호스트에 대 한 잠재적으로 병원 성 결과 감안할 때, 그것은 실패와 생산 사이의 균형 팁 수 있습니다 주요 바이러스-호스트 상호 작용에 대 한 우리의 이해를 심화 하기 위해 실험적인 전략을 개발 하는 중요 한 감염입니다. 바이러스-호스트 상호 작용의 분자 기능 elucidating 신규 및 대체 항 바이러스 치료 전략의 개발에 도움이 될 것입니다.
RNA 간섭 (RNAi)4,의 도래와 함께5 및 게놈 편집 도구 (예., CRISPR-Cas9, 아연 손가락 nucleases TALENs)6,7, 실험적으로 변경 가능한 되고있다는 게놈 넓은에 세포질 요인의 식을 확장 하 고 바이러스 복제에 이러한 변경의 영향. 실제로, 수많은 RNAi 및 편집-게놈 스크린 실시 되었습니다 바이러스-호스트 상호 작용8,,910, 의 새로운 측면을 발표 했다 무척 추 및 척추 호스트 셀 유형 11 , 12. 일반적으로 바이러스 기자, 반딧불 luciferase (루크) 또는 형광 성 단백질 등을 인코딩을 사용 하는이 화면 (예., GFP, DsRed), 양적 평가 판독으로 바이러스 성 유전자 발현의 편리한 수단을 제공 하는 바이러스 성 복제9,12에 대 한. 이 전략 중 홍보 또는 각각 증가 또는 감소에 의해 입증으로 바이러스 성 복제를 반대, 바이러스 성 기자 신호9,12호스트 요소를 식별 하는 연구를 수 있습니다. 그러나, 대부분의 경우에서 이러한 화면 실시 되어 있는 그들은 공부 되 고 있다 호스트 셀 형식에 잘 적응 하는 바이러스를 사용 하 여. 이 전략이 될 수 있지만 바이러스 성 병원 체 및 그들의 자연적인 호스트 간의 coevolutionary 관계를 이해 하기 위한 중요 한, 그것은 잠복 호스트 항 바이러스 요인에 그들의 사용에 관한 근본적인 문제를 제기지 않습니다. 이러한 경우 바이러스 기자에 있는 증진 최저는 되 찾고, RNAi 나 세포 요소는 일반적으로 바이러스 성 복제를 방해의 비활성화 신호. 첫째, 이면 바이러스가 이미 엄격 하 게 제어 조건 하에서 시험 되 고 호스트 셀에 복제할 수 화면 (즉, 배경 및 향상 된 바이러스 성 기자 신호 사이 구별 하는 기능)의 동적 범위 제한 될 수 있습니다. 둘째,이 문제는 바이러스는 주인 세포에 잘 적응 하 고 화면에 타겟이 되고있다 호스트 방어 통로 대항에서 효과적인 상황에 의해 더 합성 된다.
전통적인 바이러스-호스트 상호 작용 방법 심사에 관한 위의 우려로 인해 우리는 lepidopteran 곤충 세포에서 자연적으로 유산 arbovirus 감염을 악용 하는 바이러스-호스트 상호 작용을 공부에 대 한 새로운 패러다임을 개발 했다. 이 전략은 잘 공부 인간의 arbovirus, VSV, 집시 나 방 (L. dispar)13에서 파생 된 셀에 조산 감염을 겪 습 관측에서 파생 한다. VSV는 자연스럽 게 포유류 호스트, dipteran 곤충 (즉, 모래 파리)에 의해 전송 무척추동물의 넓은 범위를 감염 하기 위하여 실험적으로 표시 되었습니다 및 척추 호스트 모두에 셀 문화 그리고 vivo에서14. VSV의 11 kb 부정 감지 단일 가닥 RNA 게놈 각각 엔벌로프된 virion 구성 하는 단백질으로 번역 하는 5 개의 subgenomic mRNAs를 인코딩합니다. 그러나, VSV 역 유전자 시스템 인코딩 루크 또는 5 자연 VSV 유전자 제품15,,1617이외에 형광 단백질, 복제 유능한 긴장의 창조에 대 한 수 있다. 이 기자 단백질은 VSV virion에 통합 되지, 때문에 그들은 후 항목을 발생 하는 VSV 유전자 발현에 대 한 편리한 판독을 제공 합니다. VSV 긴장 GFP 또는 루크 인코딩을 사용 하 여, 우리는 이전 표시 VSV 유전자 발현은 LD652 셀의 항목에 따라 엄격 하 게 제한 VSV titers 72 시간 후 감염 (hpi)에 의해 증가 하지 않습니다. 반면, VSV와 포유류 poxvirus, vaccinia 바이러스 (VACV), LD652 세포의 coinfection VSV 유전자 발현에 titers 로그 증가이 시간 포인트 리드. VACV는 이른 유전자 발현, DNA 복제, 및 LD652 세포 감염에서 늦은 유전자 발현을 겪 습 하지만 VACV 복제 주기 때문에 불완전 한 virion morphogenesis18궁극적으로 실패. VACV의 큰 ~ 192 kb DNA 게놈 많은 호스트 면역 응답19의 억제를 통해 바이러스 성 복제를 촉진 immunomodulatory 속성을 표시 하는 > 200 단백질을 인코딩합니다. 따라서, 우리는 VSV 복제 VACV coinfection LD652 셀에서의 "구조"는 가능성이 VACV immunomodulators L. dispar 응답 VSV 복제를 제한 하는 일반적으로 저해 하 여 중재 하는 가설. 이 지원 호스트 RNA 중 합 효소 II 억제제 악티노마이신 D와 LD652 세포의 치료 또한 VSV 복제 LD652 세포에서 전사 종속 호스트 응답 VSV 복제 후 항목13블록 나타내는 구출.
위의 관찰 VSV 인코딩 기자 신호 (즉, 호스트를 억제 하는 그를 강화 하는 조건에 대 한 심사 때 자연스럽 게 제한적인 성격의 VSV 감염 LD652 셀 상대적으로 낮은 배경을 제공할 수 있습니다 제안 항 바이러스 방어)입니다. 여기, 우리는 조건 완화 VSV 제한 lepidopteran 세포에서 형광 또는 루크 기반 분석 화면을 사용 하기 위한 방법을 제공 합니다. 첫째, 우리는 VSV 제한 중 coinfection 실험 중 또는 후보 바이러스 성 요인의 소성 표현을 통해 휴식 virally 인코딩된 immunomodulatory 요소를 식별 하기 위해 이러한 분석 실험을 사용 하는 방법을 보여줍니다. 예를 들어, 우리는 어떻게 우리가 다른 poxvirus 요인13의 부재에 VSV 복제 구조 immunomodulatory 요인의 새로운 가족으로 poxvirus 인코딩된 A51R 단백질을 식별 하기 위해 이러한 심사 기법을 사용을 보여 줍니다. 둘째, 우리는 RNAi 제한적인 VSV LD652 세포 감염에서 심사를 사용 하 여 직접 arbovirus 제한13에 관련 된 진 핵 호스트 요소를 식별 하는 방법을 보여 줍니다.

<table><tbody><tr><td>6-well tissue culture plates</td><td>CELLTREAT</td><td>229106</td><td></td></tr><tr><td>24-well tissue culture plates</td><td>CELLTREAT</td><td>229124</td><td></td></tr><tr><td>10 cm tissue culture dishes</td><td>Corning</td><td>C430167</td><td></td></tr><tr><td>Grace&amp;rsquo;s Insect Medium</td><td>Sigma</td><td>G8142</td><td></td></tr><tr><td>EX-CELL 420</td><td>Sigma</td><td>14420C</td><td></td></tr><tr><td>Fetal Bovine Serum - Optima</td><td>Atlanta Biologicals</td><td>S12450</td><td></td></tr><tr><td>Growth medium</td><td></td><td></td><td>1:1 mixture of Grace&#039;s Insect Medium and EX-Cell 420 Serum-Free Medium also containing 1% antibiotic-antimycotic solution and 10% Fetal bovine serum</td></tr><tr><td>Antibiotic-Antimycotic Solution (100&amp;times;)</td><td>Sigma</td><td>A5955</td><td></td></tr><tr><td>Dulbecco&amp;rsquo;s Phosphate Buffered Saline (DPBS)</td><td>Sigma</td><td>D8662</td><td></td></tr><tr><td>Serum Free Media (SFM)</td><td>Thermo Fisher</td><td>10902096</td><td></td></tr><tr><td>Cytosine arabinoside</td><td>Sigma</td><td>C1768</td><td></td></tr><tr><td>Transfection reagent</td><td>Thermo Fisher</td><td>10362100</td><td></td></tr><tr><td>Corning cellgro DMSO (Dimethyl Sulfoxide)</td><td>Corning</td><td>25950CQC</td><td></td></tr><tr><td>Reporter lysis buffer 5x</td><td>Promega</td><td>E3971</td><td></td></tr><tr><td>Luciferase Assay Reagent</td><td>Promega</td><td>E1483</td><td></td></tr><tr><td>96-Well Microplates</td><td>Corning</td><td>3915</td><td></td></tr><tr><td>Mouse anti-FLAG antibody</td><td>Wako</td><td>014-22383</td><td></td></tr><tr><td>Rabbit anti-firefly luciferase antibody</td><td>Abcam</td><td>ab21176</td><td></td></tr><tr><td>Mouse anti-actin antibody</td><td>Sigma</td><td>A2066</td><td></td></tr><tr><td>Mouse anti-VSV M</td><td>N/A</td><td>N/A</td><td>Dr. John Connor (Boston University)</td></tr><tr><td>Mouse anti-VACV I3L</td><td>N/A</td><td>N/A</td><td>Dr. David Evans (University of Alberta)</td></tr><tr><td>8-well Chambered dish</td><td>Lab-Tek II</td><td>155409</td><td></td></tr><tr><td>Cell viability dye</td><td>Thermo Fisher</td><td>C12881</td><td></td></tr><tr><td>FLUOstar microplate reader</td><td>BMG Labtech</td><td>FLUOstar</td><td></td></tr><tr><td>Confocal microscope</td><td>Olympus</td><td>FV10i-LIV</td><td></td></tr><tr><td>Image analysis software</td><td>Olympus</td><td>v1.18</td><td>cellSens software</td></tr><tr><td>Eppendorf 5702 ventilated centrifuge</td><td>Eppendorf</td><td>22628102</td><td></td></tr><tr><td>Odyssey Fc Infrared Imaging System</td><td>Li-COR Biosciences</td><td>Odyssey Fc</td><td></td></tr><tr><td>LD652 cells</td><td>N/A</td><td>N/A</td><td>Dr. Basil Arif (Natural Resources Canada)</td></tr><tr><td>BSC-40 cells</td><td>ATCC</td><td>CRL-2761</td><td></td></tr><tr><td>BHK cells</td><td>ATCC</td><td>CCL-10</td><td></td></tr><tr><td>HeLa cells</td><td>ATCC</td><td>CCL-2</td><td></td></tr><tr><td>BSC-1 cells</td><td>ATCC</td><td>CCL-26</td><td></td></tr><tr><td>&lt;em&gt;in vitro&lt;/em&gt; transcription and purification kit</td><td>Thermo Fisher</td><td>AM1626</td><td></td></tr><tr><td>PCR purification kit</td><td>Qiagen</td><td>28104</td><td></td></tr></tbody></table>

arbovirus infections as screening tools for the identification of viral immunomodulators and host antiviral factors

RNA 간섭-및 편집-기반 플랫폼을 심사 하는 게놈 바이러스 복제를 제한 하는 호스트 셀 요소를 식별 하기 위해 널리 사용 되어 왔습니다. 그러나, 이러한 스크린 자연스럽 게 연구 바이러스 성 병원 체를 허용 하는 셀에 일반적으로 지휘 된다. 따라서, 제어 조건에 있는 바이러스의 강력한 복제 이러한 스크린의 동적 범위를 제한할 수 있습니다. 또한,이 화면 수 있습니다 수 없습니다 쉽게 식별할 세포 방어 경로 바이러스가 호스트에 잘 적응 하 고 대항 항 바이러스 방어의 경우 바이러스 복제를 제한 하는. 이 문서에서는, 우리는 vesicular 구내 염 바이러스 (VSV) arboviruses에 의해 자연스럽 게 조산 감염에 바이러스-호스트 상호 작용 센터 화면 사용을 탐험에 대 한 새로운 패러다임을 설명 합니다. Dipteran 곤충과 포유류 호스트의 넓은 범위에서 복제 VSV의 능력에도 불구 하 고 VSV는 집시 나 방 (Lymantria dispar)와 같은 lepidopteran 곤충에서 파생 된 세포 라인의 다양 한 후 항목, 조산 감염을 겪 습. 그러나, 이러한 조산 VSV 감염 수 수 "구출" 호스트 세포 항 바이러스 방어 손상 된 경우. 우리가 어떻게 VSV 긴장 인코딩 편리한 리포터 유전자와 제한적인 L. dispar 설명 셀 라인 호스트 요소 arbovirus 제한에 관련 된 식별을 설정 화면에 쌍이 될 수 있습니다. 또한, 우리는 또한 coinfection 또는 포유류 바이러스에 의해 비롯 소성 표현을 통해 VSV 복제 구조 virally 인코딩된 요소의 식별 이러한 검사 도구 유틸리티를 보여줍니다. VSV 구조, 모니터를 단순한 발광 및 형광 기반 분석의 사용 활성화를 촉진 하는 조건에 대 한 심사 때 L. dispar 셀에 VSV 복제의 자연 제한 높은 신호 대 잡음 비율을 제공 VSV 복제의 변화입니다. 이러한 방법론은 호스트 항 바이러스 응답 바이러스 면역 회피 요인 사이 상호 작용을 이해 하는 데 중요 합니다.

라이브 셀 이미징 응용 프로그램을 모니터링 VSV 구조 VACV coinfection 시의 예를 들어, LD652 세포 했다 8 잘 연 발된 접시에 도금 고 다음 모의 감염 또는 VSV DsRed 감염 (나 = 1) VACV-플로리다-GFP의 유무에서 (나 = 25). VSV DsRed DsRed 무료 단백질으로 표현 하 고 구조 VSV 단백질 (그림 1A)에 융합 하지, 때문에 그것만 VSV 항목 및 유전자 식 시작 후 감지 됩니다. 모든 ...

Watch this Scientific Journal Video about Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors at JoVE.com

Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors

여기, 선물이 arbovirus 복제 및 arbovirus 복제를 제한 하는 2) 진 핵 호스트 요인 1) 바이러스 인코딩된 immunomodulators 식별 프로토콜. 이러한 형광 및 발광 기반 방법을 빠르게 낮은 신호 대 잡음 비율 단순한 분석에 arbovirus 복제의 양적 정보를 연구 수 있습니다.

Arbovirus 감염 바이러스 Immunomodulators 및 호스트 항 바이러스 요인의 식별을 위한 도구를 심사로

RNA interference- and genome editing-based screening platforms have been widely used to identify host cell factors that restrict virus replication. ...

arbovirus-infections-as-screening-tools-for-identification-viral

Research

JoVE Journal

Immunology and Infection

6.8K 조회수.  University of Texas Southwestern Medical Center. 여기, 선물이 arbovirus 복제 및 arbovirus 복제를 제한 하는 2) 진 핵 호스트 요인 1) 바이러스 인코딩된 immunomodulators 식별 프로토콜. 이러한 형광 및 발광 기반 방법을 빠르게 낮은 신호 대 잡음 비율 단순한 분석에 arbovirus 복제의 양적 정보를 연구 수 있습니다.

비디오: Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Viral pathogens represent a significant public health threat; not only can viruses cause natural epidemics of human disease, but their potential use in bioterrorism is also a concern. A better understanding of the cellular factors that impact infection would facilitate the development of much-needed therapeutics. Recent advances in RNA interference (RNAi) technology coupled with complete genome sequencing of several organisms has led to the optimization of genome-wide, cell-based loss-of-function screens. Drosophila cells are particularly amenable to genome-scale screens because of the ease and efficiency of RNAi in this system 1. Importantly, a wide variety of viruses can infect Drosophila cells, including a number of mammalian viruses of medical and agricultural importance 2,3,4. Previous RNAi screens in Drosophila have identified host factors that are required for various steps in virus infection including entry, translation and RNA replication 5. Moreover, many of the cellular factors required for viral replication in Drosophila cell culture are also limiting in human cells infected with these viruses 4,6,7,8, 9. Therefore, the identification of host factors co-opted during viral infection presents novel targets for antiviral therapeutics. Here we present a generalized protocol for a high-throughput RNAi screen to identify cellular factors involved in viral infection, using vaccinia virus as an example.

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Novel host factors involved in viral infection can be identified through cell-based genome-wide loss of function RNAi screening. A Drosophila cell culture model is particularly amenable to this approach due to the ease and efficiency of RNAi. Here we demonstrate this technique using vaccinia virus as an example.

에 관련된 호스트 요인에 대한 RNAi 심사 우두</em사용하기> 바이러스 감염 Drosophila 전지

Viral pathogens represent a significant public health threat; not only can viruses cause natural epidemics of human disease, but their potential use in ...

연구

면역학 및 감염병학

Using a Pan-Viral Microarray Assay (Virochip) to Screen Clinical Samples for Viral Pathogens

The diagnosis of viral causes of many infectious diseases is difficult due to the inherent sequence diversity of viruses as well as the ongoing emergence of novel viral pathogens, such as SARS coronavirus and 2009 pandemic H1N1 influenza virus, that are not detectable by traditional methods. To address these challenges, we have previously developed and validated a pan-viral microarray platform called the Virochip with the capacity to detect all known viruses as well as novel variants on the basis of conserved sequence homology1. Using the Virochip, we have identified the full spectrum of viruses associated with respiratory infections, including cases of unexplained critical illness in hospitalized patients, with a sensitivity equivalent to or superior to conventional clinical testing2-5. The Virochip has also been used to identify novel viruses, including the SARS coronavirus6,7, a novel rhinovirus clade5, XMRV (a retrovirus linked to prostate cancer)8, avian bornavirus (the cause of a wasting disease in parrots)9, and a novel cardiovirus in children with respiratory and diarrheal illness10. The current version of the Virochip has been ported to an Agilent microarray platform and consists of ~36,000 probes derived from over ~1,500 viruses in GenBank as of December of 2009. Here we demonstrate the steps involved in processing a Virochip assay from start to finish (~24 hour turnaround time), including sample nucleic acid extraction, PCR amplification using random primers, fluorescent dye incorporation, and microarray hybridization, scanning, and analysis.

Using a Pan-Viral Microarray Assay Virochip to Screen Clinical Samples for Viral Pathogens

The Virochip is a pan-viral microarray designed to simultaneously detect all known viruses as well as novel viruses on the basis of conserved sequence homology. Here we demonstrate how to run a Virochip assay to analyze clinical samples for the presence of both known and unknown viruses.

바이러스성 병원균에 대한 임상 샘플을 화면에 판 - 바이러스성 Microarray 분석 (Virochip)를 사용

The diagnosis of viral causes of many infectious diseases is difficult due to the inherent sequence diversity of viruses as well as the ongoing emergence ...

Genome-wide RNAi Screening to Identify Host Factors That Modulate Oncolytic Virus Therapy

High-throughput genome-wide RNAi (RNA interference) screening technology has been widely used for discovering host factors that impact&#160;virus replication. Here we present the application of this technology to uncovering host targets that specifically modulate the replication of Maraba virus, an oncolytic rhabdovirus, and vaccinia virus with the goal of enhancing therapy. While the protocol has been tested for use with oncolytic Maraba virus and oncolytic vaccinia virus, this approach is applicable to other oncolytic viruses and can also be utilized for identifying host targets that modulate virus replication in mammalian cells in general. This protocol describes the development and validation of an assay for high-throughput RNAi screening in mammalian cells, the key considerations and preparation steps important for conducting a primary high-throughput RNAi screen, and a step-by-step guide for conducting a primary high-throughput RNAi screen; in addition, it broadly outlines the methods for conducting secondary screen validation and tertiary validation studies. The benefit of high-throughput RNAi screening is that it allows one to catalogue, in an extensive and unbiased fashion, host factors that modulate any aspect of virus replication for which one can develop an in vitro assay such as infectivity, burst size, and cytotoxicity. It has the power to uncover biotherapeutic targets unforeseen based on current knowledge.

Here we describe a protocol for employing high-throughput RNAi screening to uncover host targets that can be manipulated to enhance oncolytic virus therapy, specifically rhabodvirus and vaccinia virus therapy, but it can be readily adapted to other oncolytic virus platforms or for discovering host genes that modulate virus replication generally.

RNAi 게놈 넓은 검사 Oncolytic 바이러스 치료 변조 호스트 요소를 식별 하

High-throughput genome-wide RNAi (RNA interference) screening technology has been widely used for discovering host factors that impact&#160;virus ...

암 연구학

Assays for the Identification of Novel Antivirals against Bluetongue Virus

To identify potential antivirals against BTV, we have developed, optimized and validated three assays presented here. The CPE-based assay was the first assay developed to evaluate whether a compound showed any antiviral efficacy and have been used to screen large compound library. Meanwhile, cytotoxicity of antivirals could also be evaluated using the CPE-based assay. The dose-response assay was designed to determine the range of efficacy for the selected antiviral, i.e. 50% inhibitory concentration (IC50) or effective concentration (EC50), as well as its range of cytotoxicity (CC50). The ToA assay was employed for the initial MoA study to determine the underlying mechanism of the novel antivirals during BTV viral lifecycle or the possible effect on host cellular machinery. These assays are vital for the evaluation of antiviral efficacy in cell culture system, and have been used for our recent researches leading to the identification of a number of novel antivirals against BTV.

Three assays, including the cytopathic effect (CPE)-based assay, dose-response assay and Time-of-Addition (ToA) assay have been developed, optimized, validated and utilized to identify novel antivirals against Bluetongue virus (BTV), as well as to determine the possible Mechanism-of-Action (MoA) for newly identified antivirals.

Bluetongue 바이러스에 대한 항 바이러스제 소설의 식별에 대한 분석

To identify potential antivirals against BTV, we have  developed, optimized and validated three assays presented here. The CPE-based  assay was the first ...

High-throughput Screening for Broad-spectrum Chemical Inhibitors of RNA Viruses

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat because of increased worldwide exchanges and human populations penetrating more and more natural ecosystems. A good example of such an emerging situation is chikungunya virus epidemics of 2005-2006 in the Indian Ocean. Recent progresses in our understanding of cellular pathways controlling viral replication suggest that compounds targeting host cell functions, rather than the virus itself, could inhibit a large panel of RNA viruses. Some broad-spectrum antiviral compounds have been identified with host target-oriented assays. However, measuring the inhibition of viral replication in cell cultures using reduction of cytopathic effects as a readout still represents a paramount screening strategy. Such functional screens have been greatly improved by the development of recombinant viruses expressing reporter enzymes capable of bioluminescence such as luciferase. In the present report, we detail a high-throughput screening pipeline, which combines recombinant measles and chikungunya viruses with cellular viability assays, to identify compounds with a broad-spectrum antiviral profile.

In vitro assays to measure virus replication have been greatly improved by the development of recombinant RNA viruses expressing luciferase or other enzymes capable of bioluminescence. Here we detail a high-throughput screening pipeline that combines such recombinant strains of measles and chikungunya viruses to isolate broad-spectrum antivirals from chemical libraries.

RNA 바이러스의 넓은 스펙트럼 화학 억제를위한 높은 처리량 검사

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat ...

Early Viral Entry Assays for the Identification and Evaluation of Antiviral Compounds

Cell-based systems are useful for discovering antiviral agents. Dissecting the viral life cycle, particularly the early entry stages, allows a mechanistic approach to identify and evaluate antiviral agents that target specific steps of the viral entry. In this report, the methods of examining viral inactivation, viral attachment, and viral entry/fusion as antiviral assays for such purposes are described, using hepatitis C virus as a model. These assays should be useful for discovering novel antagonists/inhibitors to early viral entry and help expand the scope of candidate antiviral agents for further drug development.

Here, we present a protocol that examines specific steps of the viral entry to identify and evaluate novel antiviral agents.

초기 바이러스 성 항목 식별을위한 분석 실험 및 항 바이러스 화합물의 평가

Cell-based systems are useful for discovering antiviral agents. Dissecting the viral life cycle, particularly the early entry stages, allows a mechanistic ...

Isolation and Quantification of Zika Virus from Multiple Organs in a Mouse

The methods being presented demonstrate laboratory procedures for the isolation of organs from Zika virus infected animals and the quantification of viral load. The purpose of the procedure is to quantify viral titers in peripheral and CNS areas of the mouse at different time points post infection or under different experimental conditions to identify virologic and immunological factors that regulate Zika virus infection. The organ isolation procedures demonstrated allow for both focus forming assay quantification and quantitative PCR assessment of viral titers. The rapid organ isolation techniques are designed for the preservation of virus titer. Viral titer quantification by focus forming assay allows for the rapid throughput assessment of Zika virus. The benefit of the focus forming assay is the assessment of infectious virus, the limitation of this assay is the potential for organ toxicity reducing the limit of detection. Viral titer assessment is combined with quantitative PCR, and using a recombinant RNA copy control viral genome copy number within the organ is assessed with low limit of detection. Overall these techniques provide an accurate rapid high throughput method for the analysis of Zika viral titers in the periphery and CNS of Zika virus infected animals and can be applied to the assessment of viral titers in the organs of animals infected with most pathogens, including Dengue virus.

The goal of the protocol is to demonstrate the techniques used to investigate viral disease by isolating and quantifying Zika virus, from multiple organs in a mouse following infection.

마우스의 여러 장기에서 Zika 바이러스의 격리 및 정량화

The methods being presented demonstrate laboratory procedures for the isolation of organs from Zika virus infected animals and the quantification of viral ...

Use of Viral Entry Assays and Molecular Docking Analysis for the Identification of Antiviral Candidates against Coxsackievirus A16

Antiviral assays that mechanistically examine viral entry are pertinent to discern at which step the evaluated agents are most effective, and allow for the identification of candidate viral entry inhibitors. Here, we present the experimental approaches for the identification of small molecules capable of blocking infection by the non-enveloped coxsackievirus A16 (CVA16) through targeting the virus particles or specific steps in early viral entry. Assays include the time-of-drug-addition analysis, flow cytometry-based viral binding assay, and viral inactivation assay. We also present a molecular docking protocol utilizing virus capsid proteins to predict potential residues targeted by the antiviral compounds. These assays should help in the identification of candidate antiviral agents that act on viral entry. Future directions can explore these possible inhibitors for further drug development.

The goal of the protocol is to illustrate the different assays relating to viral entry that can be used to identify candidate viral entry inhibitors.

Coxsackievirus A16에 대하여 항바이러스 후보의 확인을 위한 바이러스 성 입력 분석 및 분자 도킹 분석의 사용

Antiviral assays that mechanistically examine viral entry are pertinent to discern at which step the evaluated agents are most effective, and allow for ...

High-Throughput Transcriptome Analysis for Investigating Host-Pathogen Interactions

Pathogens can cause a wide variety of infectious diseases. The biological processes induced by the host in response to infection determine the severity of the disease.&#160;To study such processes, researchers can use high-throughput sequencing techniques (RNA-seq) that measure the dynamic changes of the host transcriptome at different stages of infection, clinical outcomes, or disease severity.This investigation can lead to a better understanding of the diseases, as well as uncovering potential drug targets and treatments. The protocol presented here describes a complete pipeline to analyze RNA-sequencing data from raw reads to functional analysis. The pipeline is divided into five steps: (1) quality control of the data; (2) mapping and annotation of genes; (3) statistical analysis to identify differentially expressed genes and co-expressed genes; (4) determination of the molecular degree of the perturbation of samples; and (5) functional analysis. Step 1 removes technical artifacts that may impact the quality of downstream analyses. In step 2, genes are mapped and annotated according to standard library protocols.&#160;The statistical analysis in step 3 identifies genes that are differentially expressed or co-expressed in infected samples, in comparison with non-infected ones. Sample variability and the presence of potential biological outliers are verified using the molecular degree of perturbation approach in step 4. Finally, the functional analysis in step 5 reveals the pathways associated with the disease phenotype. The presented pipeline aims to support researchers through the RNA-seq data analysis from host-pathogen interaction studies and drive future&#160;in vitro or in vivo experiments, that are essential to understand the molecular mechanism of infections.

The protocol presented here describes a complete pipeline to analyze RNA-sequencing transcriptome data from raw reads to functional analysis, including quality control and preprocessing steps to advanced statistical analytical approaches.

호스트-병원체 상호 작용을 조사하기 위한 고처리량 전사 분석

Pathogens can cause a wide variety of infectious diseases. The biological processes induced by the host in response to infection determine the severity of ...

High-throughput Antiviral Assays to Screen for Inhibitors of Zika Virus Replication

Antiviral drug discovery requires the development of reliable biochemical and cellular assays that can be performed in high-throughput screening (HTS) formats. The flavivirus non-structural (NS) proteins are thought to co-translationally assemble on the endoplasmic reticulum (ER) membranes, forming the replication complex (RC). The NS3 and NS5 are the most studied enzymes of the RC and constitute the main targets for drug development due to their crucial roles in viral genome replication. NS3 protease domain, which requires NS2B as its cofactor, is responsible for the cleavage of the immature viral polyprotein into the mature NS proteins, whereas NS5 RdRp domain is responsible for the RNA replication. Herein, we describe in detail the protocols used in replicon-based screenings and enzymatic assays to test large compound libraries for inhibitors of the Zika virus (ZIKV) replication. Replicons are self-replicating subgenomic systems expressed in mammalian cells, in which the viral structural genes are replaced by a reporter gene. The inhibitory effects of compounds on viral RNA replication can be easily evaluated by measuring the reduction in the reporter protein activity. The replicon-based screenings were performed using a BHK-21 ZIKV replicon cell line expressing Renilla luciferase as a reporter gene. To characterize the specific targets of identified compounds, we established in-vitro fluorescence-based assays for recombinantly expressed NS3 protease and NS5 RdRp. The proteolytic activity of the viral protease was measured by using the fluorogenic peptide substrate Bz-nKRR-AMC, while the NS5 RdRp elongation activity was directly detected by the increase of the fluorescent signal of SYBR Green I during RNA elongation, using the synthetic biotinylated self-priming template 3&#8242;UTR-U30 (5&#39;-biotin-U30-ACUGGAGAUCGAUCUCCAGU-3&#39;).

In this work, we describe the protocols used in replicon-based and viral enzyme-based assays to screen for inhibitors of Zika virus replication in a high-throughput screening format.

지카 바이러스 복제억제제에 대한 화면에 높은 처리량 항 바이러스 적 소사

Antiviral drug discovery requires the development of reliable biochemical and cellular assays that can be performed in high-throughput screening (HTS) ...

Arbovirus 감염 바이러스 Immunomodulators 및 호스트 항 바이러스 요인의 식별을 위한 도구를 심사로

요약

더 많은 비디오 탐색

이 비디오의 챕터

에 관련된 호스트 요인에 대한 RNAi 심사 우두 바이러스 감염 Drosophila* 전지*

바이러스성 병원균에 대한 임상 샘플을 화면에 판 - 바이러스성 Microarray 분석 (Virochip)를 사용

RNAi 게놈 넓은 검사 Oncolytic 바이러스 치료 변조 호스트 요소를 식별 하

Bluetongue 바이러스에 대한 항 바이러스제 소설의 식별에 대한 분석

RNA 바이러스의 넓은 스펙트럼 화학 억제를위한 높은 처리량 검사

초기 바이러스 성 항목 식별을위한 분석 실험 및 항 바이러스 화합물의 평가

마우스의 여러 장기에서 Zika 바이러스의 격리 및 정량화

Coxsackievirus A16에 대하여 항바이러스 후보의 확인을 위한 바이러스 성 입력 분석 및 분자 도킹 분석의 사용

호스트-병원체 상호 작용을 조사하기 위한 고처리량 전사 분석

지카 바이러스 복제억제제에 대한 화면에 높은 처리량 항 바이러스 적 소사

Arbovirus 감염 바이러스 Immunomodulators 및 호스트 항 바이러스 요인의 식별을 위한 도구를 심사로

요약

더 많은 비디오 탐색

이 비디오의 챕터

에 관련된 호스트 요인에 대한 RNAi 심사 우두 바이러스 감염 Drosophila 전지

바이러스성 병원균에 대한 임상 샘플을 화면에 판 - 바이러스성 Microarray 분석 (Virochip)를 사용

RNAi 게놈 넓은 검사 Oncolytic 바이러스 치료 변조 호스트 요소를 식별 하

Bluetongue 바이러스에 대한 항 바이러스제 소설의 식별에 대한 분석

RNA 바이러스의 넓은 스펙트럼 화학 억제를위한 높은 처리량 검사

초기 바이러스 성 항목 식별을위한 분석 실험 및 항 바이러스 화합물의 평가

마우스의 여러 장기에서 Zika 바이러스의 격리 및 정량화

Coxsackievirus A16에 대하여 항바이러스 후보의 확인을 위한 바이러스 성 입력 분석 및 분자 도킹 분석의 사용

호스트-병원체 상호 작용을 조사하기 위한 고처리량 전사 분석

지카 바이러스 복제억제제에 대한 화면에 높은 처리량 항 바이러스 적 소사

에 관련된 호스트 요인에 대한 RNAi 심사 우두 바이러스 감염 Drosophila* 전지*