The authors would like to thank the National Key Research and Development Program of China (Grant No. 2021YFD2200502), the National Natural Science Foundation of China (Grant No. 31971736) for the financial support.

1. Preparation of bamboo seedlings
<ol>
	<li>Prepare moso bamboo (Phyllostachys edulis) seedlings using seeds harvested in Guilin, Guangxi, China. Begin by soaking the seeds in water for 2-3 days, making sure to change the water daily. Next, create a substrate by mixing soil and vermiculite in a ratio of 3:1.</li>
	<li>Sow the soaked seeds into the substrate for germination. Maintain the seedlings under laboratory conditions, keeping the temperature between 18-25 &#176;C. Ensure a 16 h light/8 h dark photoperiod with a light intensity of 250-350 &#181;mol/m2/s during the light phase.</li>
	<li>Maintain a relative humidity of approximately 60%. For Agrobacterium-infection, use seedlings that are 15 days old and have a height of 2-10 cm, which is the best stage for transformation. 
	NOTE: Because bamboo flowering is unpredictable, seeds are not available every year. The seeds are usually stored for 2-3 years at 4 &#176;C in a dry environment and can still maintain a viability of over 20%.</li>
</ol>
2. Preparation of plasmids and&#160;&#160;Agrobacterium
<ol>
	<li>Plasmids: To validate the transient expression effect, employ the pHDE-35S::RUBY construct containing a visible reporter gene driven by the CaMV 35S promoter10. For gene editing, use the pCambia1300-Ubi::Cas9 construct, which carries the Cas9 gene driven by the maize Ubi promoter11. Insert the sgRNA guiding sequences of PeVDE and other target genes between the two AarI sites in the pCambia1300-Ubi::Cas9 construct9.</li>
	<li>Insert the CRISPR/Cas9 guide RNA sequences between the two AarI restriction endonuclease sites of the pCambia1300-Ubi::Cas9 construct, including PeVDE and PeCCR5 target genes.</li>
	<li>Add GGCA to the 5&#39; end of the 20-nucleotide sequence and synthesize a single-stranded DNA sequence. Reverse complement the 20-nucleotide sequence and add AAAC to the 5&#39; end, then synthesize another single-stranded DNA sequence.</li>
	<li>Dilute both single-stranded DNA sequences to a concentration of 10 nM/L in diluted water, mix thoroughly, and heat at 95 &#176;C for 5 min. Allow the mixture to cool to room temperature, resulting in the formation of double-stranded adapters.</li>
	<li>Connect the adapters with the linear pCambia1300-Ubi::Cas9 fragment digested by AarI endonuclease using T4 DNA ligase and sequence the constructed CRISPR/Cas9 vector to obtain the desired gene-targeting construct.</li>
	<li>To transform plasmids into Agrobacterium, use the freeze-thaw method as follows: Mix 1 &#181;L of the plasmids (concentration: 10 - 1,000 ng/&#181;L) with 100 &#181;L of Agrobacterium-competent cells (translation efficiency: &#62; 1 x 104 colony-forming-units/&#181;g) and gently mix them. Place the mixture on ice for 5 min. Transfer the mixture to liquid nitrogen for 5 min.</li>
	<li>Thaw the mixture in a 37 &#176;C water bath for 5 min. Add 500 &#181;L of Luria-Bertani (LB) medium to the mixture and incubate it on a shaking incubator at 28 &#176;C at 200 rpm for 2-3 h. For the pHDE-35S::RUBY plasmids, introduce them individually into the AGL1, GV3101, LBA4044, and EHA105 strains of Agrobacterium tumefaciens (A. tumefaciens)12. For the CRISPR/Cas9 plasmids, introduce them into the GV3101 strain of A. tumefaciens.</li>
	<li>Grow Agrobacterium in yeast extract peptone (YEP) medium (10 g beef extract, 10 g yeast extract, and 5 g NaCl per L) with the corresponding antibiotics (spectinomycin for 35S::RUBY and kanamycin for CRISPR/Cas9) at 28 &#176;C. The single colonies were observed 36-48 h after cultivation.</li>
	<li>Pick and transfer the colonies into liquid YEP medium (with corresponding antibiotics) for further growth. After 24-36 h, use the primers of RUBY-F and RUBY-R (Table 1) to perform PCR to confirm the successful transfer of plasmids into Agrobacterium.</li>
	<li>Transfer 1 mL of the successfully transformed Agrobacterium into 100 mL of fresh liquid YEP medium (with corresponding antibiotics) and then grow overnight at 28 &#176;C to an OD600 of 0.8.</li>
	<li>Centrifuge the bacterial suspension at 4,000 x g for 5 min at 4 &#176;C, wash the bacterial pellet once with suspensions infiltration medium (10 mM MgCl2 and 10 mM MES-KOH [pH 5.6]), and then centrifuge again. Resuspend the bacterial pellet in a suspension infiltration medium to an OD600 of 0.6 for bamboo transformation.</li>
</ol>
3. Agrobacterium -mediated in planta transformation system
<ol>
	<li>Prepare for transformation; carefully remove the seedlings with soil-attached roots from the substrate, ensuring the roots remain intact. Wrap the seedlings with tin foil to maintain moisture and prevent soil detachment (Figure 1A).</li>
	<li>Transfer the wrapped seedlings to an environment with higher humidity (relative air humidity &#62;90%) and lower illumination (intensity less than 50 &#181;mol/m2/s) for a duration of 2 h.</li>
	<li>Using a sharp needle from a syringe, wound the upper part of curled immature leaves (approximately 1-2 cm from the top) of the bamboo seedlings once or twice (as indicated by the red triangles in Figure 1A).</li>
	<li>Afterward, dip the wounded upper part of the seedlings into suspensions of Agrobacterium. Perform the entire process, from wounding to dipping into Agrobacterium rapidly, as the fresh wound will increase inoculation efficiency.</li>
	<li>Immediately transfer the seedlings to a vacuum chamber with a pressure of 25-27 mmHg for 2 min (Figure 1B).</li>
	<li>After vacuuming, carefully unwrap the seedlings and replant them into the substrate. Place the seedlings in dim light or darkness (&#60;50 &#181;mol/m2/s) with high humidity (RH&#62;90%) at room temperature (18-25 &#176;C) for 2 days. Subsequently, culture the seedlings under normal growth conditions, watering them every 5-7 days. Observe their phenotypes to provide materials for subsequent experiments.</li>
</ol>
4. Designing single guide RNAs (sgRNAs) for gene editing
<ol>
	<li>Identify a protospacer adjacent motif (PAM) site located near a specific and conserved domain of the target gene sequence. Ensure that the specific PAM sequence is NGG in this CRISPR/Cas9 system. Verify the on-target specificity of the selected sequence by performing a BlastN search against the bamboo genome database. Ensure that the sgRNA is unique, especially in the upstream region and close to the PAM9,11. 
	NOTE: This comparison will effectively reduce potential off-target sites in the genome affected by the gene-editing process.</li>
	<li>Design two sgRNAs (sgRNA-1 and sgRNA-2) on the first exon of the PeVDE gene13. Include AgeI restriction sites upstream of the PAM in sgRNA-1 and XbaI restriction sites upstream of the PAM in sgRNA-2. Design one sgRNA on the fourth exon of the PeCCR5 gene, which encodes the conserved motif of KNWYCYGK. This motif is critical for the catalysis of CCRs14.</li>
	<li>Design a 20 nucleotide spacer sequence adjacent to the PAM site. This spacer sequence will guide the Cas9 enzyme to the target site for DNA cleavage and subsequent gene editing. 
	&#8203;NOTE: It is advisable to choose a target region upstream of the endonuclease enzyme cleavage site within the PAM site. This will facilitate the validation of gene editing efficiency.</li>
</ol>
5. Primer design and PCR
<ol>
	<li>Manually design specific primers for amplification of the PeVDE and PeCCR5 fragments. Design the upstream and downstream primers to be located at least 100 bp outside the target site, with a length difference of over 100 bp to allow for distinct band separation during electrophoresis. Design primers for amplification of RUBY within the first 500 bp of the gene. A list of all primers used is provided in Table 1.</li>
	<li>Use a high-fidelity DNA polymerase for PCR. In this case, utilize DNA polymerase with high fidelity and efficient amplification in gene cloning.</li>
	<li>Prepare the PCR reaction mixture as follows: 5x buffer (Mg2+ Plus): 4 &#181;L; dNTP mixture (2.5 mM each): 1.6 &#181;L; Forward and reverse primers (10 pmol each): 1 &#181;L each; bamboo genome DNA (approximately 50 ng); DNA Polymerase (2.5 U/&#181;L): 0.2 &#181;L; Dilute water to a total volume of 20 &#181;L.</li>
	<li>Follow the PCR running conditions: Initial denaturation at 98 &#176;C for 5 min; Denaturation at 98 &#176;C for 10 s; Annealing at 56 &#176;C for 5 s; Extension at 72 &#176;C for 30 s; Repeat denaturation to extension for 32 cycles; Final extension at 72 &#176;C for 5 min; Hold at 4 &#176;C indefinitely. 
	&#8203;NOTE: PCR conditions are provided as an example and may need to be optimized for specific applications or targets.</li>
</ol>
6. DNA extraction, endonuclease enzyme digestion, and sequencing
<ol>
	<li>Separate the region with lower NPQ values from fresh bamboo leaf blades using scissors, as identified by the imaging-PAM fluorometer (refer to step 7.4). Freeze the leaf samples with liquid nitrogen and transfer the frozen leaf samples into a mortar. Grind the samples into a fine powder using a pestle, adding enough liquid nitrogen during the grinding process. This step helps in releasing the cellular content, including DNA.</li>
	<li>Extract genomic DNA from the powdered leaf using the Cetyltrimethylammonium Ammonium Bromide (CTAB) method. Add 50 mg of leaf powder samples to 800 &#181;L of a 2% CTAB solution. Mix the sample thoroughly and incubate at 65 &#176;C for 30 min, with gentle shaking every 5 min.</li>
	<li>Add an equal volume of chloroform/isoamyl alcohol (24:1, v/v) and vigorously shake the mixture. After centrifugation at 8,000 g for 8 min, transfer the supernatant to a new tube.</li>
	<li>Add an equal volume of chloroform/isoamyl alcohol and repeat step 6.3. Add an equal volume of ice-cold isopropanol, and invert the tube several times before being placed at -20 &#176;C for 30 min. After centrifugation at 8,000 x g for 5 min, discard the supernatant.</li>
	<li>Wash the DNA pellet 2x with 75% ethanol at 4 &#176;C, then dissolve in 50 &#181;L of water.</li>
	<li>Amplify the genomic DNA containing the target site of the target genes from both wild-type and Agrobacterium-infected bamboo leaves with the protocol in step 5.4.</li>
	<li>Perform endonuclease enzyme digestion of the PCR products. Select a specific enzyme that recognizes the desired restriction sites within the amplified DNA fragments. Use AgeI and XbaI endonucleases for digestion.</li>
	<li>Prepare a reaction mixture consisting of AgeI or XbaI (20 units/&#181;L)- 1 &#181;L, 1 &#181;g PCR products, 10x buffer- 5 &#181;L, and add water to a total volume of 50 &#181;L. Incubate at 37 &#176;C for 1 h.</li>
	<li>Analyze the proportion of digested DNA fragments using gel electrophoresis. Compare the digested fragments from the wild-type and Agrobacterium-infected samples to assess gene editing efficiency.</li>
	<li>Tag the transposase adapter TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG and GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG sequences to the 5&#39; end of the forward and reverse primers, respectively, for the amplification of PeVDE and PeCCR5 fragments9,15. Use the protocol described in step 5.4 for amplification. Prepare the PCR products (before digestion) for deep sequencing.</li>
</ol>
7. Measurement of chlorophyll fluorescence of NPQ values in leaves
<ol>
	<li>Prior to the measurements, expose the bamboo seedlings to high light intensity conditions of 1200 &#181;mol/m2/s for 2 h. This exposure increases the amount of absorbed light quantum and activates the photoprotection system in the leaves.</li>
	<li>Use an imaging-PAM fluorometer to measure the in vivo PS II chlorophyll fluorescence of bamboo leaves. Set the actinic light intensity to 800 &#181;mol/m2/s for 6 min fluorescence measurements. During this period, apply a saturating pulse every 30 s to obtain chlorophyll fluorescence curves. The stable values of the curves will be used for calculations13.</li>
	<li>Calculate the non-photochemical quenching (NPQ) using the formula: 
	NPQ = (Fm - Fm&#39;) / Fm&#39; 
	where Fm represents the maximum fluorescence in the dark-adapted state, and Fm&#39; represents the maximum fluorescence in any light-adapted state.</li>
	<li>Monitor the NPQ values from the visual interface of the imaging software. The software allows real-time analysis and display of the fluorescence data, including the NPQ values.</li>
</ol>

Developing Gene Transformation and Editing Methods in Bamboo

<ol>
	<li>Jiang, Z. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> World Bamboo and Rattan (in Chinese). , (2002).</li><li>Ye, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+plant+regeneration+and+transformation+system+of+ma+bamboo+(Dendrocalamus+latiflorus+Munro)+started+from+young+shoot+as+explant.">An efficient plant regeneration and transformation system of ma bamboo (Dendrocalamus latiflorus Munro) started from young shoot as explant.</a> Frontiers in Plant Science. 8, 1298 (2017).</li><li>Ye, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Robust+CRISPR/Cas9+mediated+genome+editing+and+its+application+in+manipulating+plant+height+in+the+first+generation+of+hexaploid+Ma+bamboo+(Dendrocalamus+latiflorus+Munro).">Robust CRISPR/Cas9 mediated genome editing and its application in manipulating plant height in the first generation of hexaploid Ma bamboo (Dendrocalamus latiflorus Munro).</a> Plant Biotechnology Journal. 18 (7), 1501-1503 (2020).</li><li>Xiang, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+purple+Ma+bamboo+(Dendrocalamus+latiflorus+Munro)+with+enhanced+drought+and+cold+stress+tolerance+by+engineering+anthocyanin+biosynthesis.">Production of purple Ma bamboo (Dendrocalamus latiflorus Munro) with enhanced drought and cold stress tolerance by engineering anthocyanin biosynthesis.</a> Planta. 254 (3), 50 (2021).</li><li>Huang, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+genetic+transformation+and+CRISPR/Cas9-based+genome+editing+system+for+moso+bamboo+(Phyllostachys+edulis).">An efficient genetic transformation and CRISPR/Cas9-based genome editing system for moso bamboo (Phyllostachys edulis).</a> Frontiers in Plant Science. 13, 822022 (2022).</li><li>Lee, M. W., Yang, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+expression+assay+by+agroinfiltration+of+leaves.">Transient expression assay by agroinfiltration of leaves.</a> Methods in Molecular Biology. 323, 225-229 (2006).</li><li>Canto, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+expression+systems+in+plants:+potentialities+and+constraints.">Transient expression systems in plants: potentialities and constraints.</a> Advances in Experimental Medicine and Biology. 896, 287-301 (2016).</li><li>Chen, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+method+for+the+production+and+expedient+screening+of+CRISPR/Cas9-mediated+non-transgenic+mutant+plants.">A method for the production and expedient screening of CRISPR/Cas9-mediated non-transgenic mutant plants.</a> Horticulture Research. 5, 13 (2018).</li><li>Sun, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+biotechnology+for+in-planta+gene+editing+and+its+application+in+promoting+flavonoid+biosynthesis+in+bamboo+leaves.">A new biotechnology for in-planta gene editing and its application in promoting flavonoid biosynthesis in bamboo leaves.</a> Plant Methods. 19 (1), 20 (2023).</li><li>He, Y., Zhang, T., Sun, H., Zhan, H., Zhao, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reporter+for+noninvasively+monitoring+gene+expression+and+plant+transformation.">A reporter for noninvasively monitoring gene expression and plant transformation.</a> Horticulture Research. 7 (1), 152 (2020).</li><li>Wang, C., Shen, L., Fu, Y., Yan, C., Wang, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+simple+CRISPR/Cas9+system+for+multiplex+genome+editing+in+rice.">A simple CRISPR/Cas9 system for multiplex genome editing in rice.</a> Journal of Genetics and Genomics. 42 (12), 703-706 (2015).</li><li>McCormick, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Leaf+disc+transformation+of+cultivated+tomato+(L.+esculentum)+using+Agrobacterium+tumefaciens.">Leaf disc transformation of cultivated tomato (L. esculentum) using Agrobacterium tumefaciens.</a> Plant Cell Reports. 5 (2), 81-84 (1986).</li><li>Lou, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=a+violaxanthin+de-epoxidase+gene+from+moso+bamboo,+confers+photoprotection+ability+in+transgenic+Arabidopsis+under+high+light.">a violaxanthin de-epoxidase gene from moso bamboo, confers photoprotection ability in transgenic Arabidopsis under high light.</a> Frontiers in Plant Science. 13, 927949 (2022).</li><li>Zhou, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+cinnamoyl+CoA+reductases+involved+in+parallel+routes+to+lignin+in+Medicago+truncatula.">Distinct cinnamoyl CoA reductases involved in parallel routes to lignin in Medicago truncatula.</a> Proceedings of the National Academy of Sciences of the United States of America. 107 (41), 17803-17808 (2010).</li><li>De Roeck, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deleterious+ABCA7+mutations+and+transcript+rescue+mechanisms+in+early+onset+Alzheimer's+disease.">Deleterious ABCA7 mutations and transcript rescue mechanisms in early onset Alzheimer's disease.</a> Acta Neuropathologica. 134 (3), 475-487 (2017).</li></ol>

The authors declare that they have no competing interests.

This method significantly reduces the time required compared to traditional genetic transformation methods, which typically take 1-2 years, and achieves transient expression of exogenous genes and gene editing of endogenous genes within 5 days. However, this method has limitations as it can only transform a small proportion of cells, and the gene-edited leaves are chimeric and lack the ability to regenerate into complete plants. Nevertheless, this in planta gene expression and gene editing technology provides a powerful approach for the functional verification of endogenous bamboo genes.
Currently, in planta gene expression and gene editing technology can only be performed in immature (curled) leaves, not in mature leaves. As the leaves unfold and enlarge, the number of gene-edited cells undergoing division increases, allowing for gene editing in specific leaf regions. However, the Agrobacterium-mediated transformation method used does not result in insertion of the exogenous T-DNA into the bamboo chromosome, making it difficult to use stable marker genes in bamboo6,9. Therefore, it is challenging to determine the exact locations of these regions. To address this, the PeVDE gene was edited, and the edited area exhibited a decreased photoprotection ability under high light treatment, as indicated by lower NPQ values, which can be easily detected using a chlorophyll fluorometer imaging-PAM. Thus, PeVDE was developed as a marker in bamboo to detect the occurrence of exogenous gene expression and gene editing. Due to the high conservation of this gene across different species 13, it can also be widely applied to other plants.
Due to the deposition of a cuticular wax layer on the epidermis of bamboo leaves, coupled with the characteristic curled and tightly wrapped morphology of immature leaves, the accessibility of Agrobacterium to leaf cells is significantly hindered. In order to improve the effectiveness of Agrobacterium infection, physical approaches, including wound and vacuum infiltration, have been utilized to promote the ingress of Agrobacterium into the enclosed curled bamboo leaves. This process enables close proximity between Agrobacterium and the leaf cells, thereby enhancing the efficiency of genetic transformation. Meanwhile, this gene editing system has so far been limited to bamboo leaves and cannot be expressed in organs with reproductive ability, such as seeds and lateral buds that can be inherited by the next generation. Future applications of the technique will be optimized to achieve in-planta gene expression and gene editing technology in organs with reproductive ability, aiming to obtain stably inheritable regenerating plants.

The investigation of gene function in bamboo holds great promise for the advanced understanding of bamboo and unlocking its potential for genetic modification. An effective way of this can be achieved through the process of Agrobacterium-mediated infection in bamboo leaves, whereby the T-DNA fragment containing exogenous genes is introduced into the cells, subsequently leading to the expression of the genes within the leaf cells.
Bamboo is a valuable and renewable resource with a wide range of applications in manufacturing, art, and research. Bamboo possesses excellent wood properties such as high mechanical strength, toughness, moderate stiffness, and flexibility1, which is now widely used in a variety of household and industrial supplies, including toothbrushes, straws, buttons, disposable tableware, underground pipelines, and cooling tower fillers for thermal power generation. Therefore, bamboo breeding plays a crucial role in obtaining bamboo varieties with excellent wood properties for replacing plastics and reducing plastic usage, protecting the environment, and tackling climate change, as well as generating significant economic value.
However, traditional bamboo breeding faces challenges due to the lengthy vegetative growth stage and uncertain flowering period. Although molecular breeding techniques have been developed and applied to bamboo breeding, the process of bamboo gene transformation is time-consuming, labor-intensive, and complicated due to the callus induction and regeneration processes2,3,4,5. Stable genetic transformation often requires Agrobacterium-mediated methods, which involve tissue culture processes such as callus induction and regeneration. However, bamboo has a low ability for callus regeneration, greatly limiting the application of stable genetic transformation in bamboo. After Agrobacterium infects plant cells, the T-DNA fragment enters the plant cells, with the majority of T-DNA fragments remaining non-integrated in the cells, resulting in transient expression. Only a small portion of T-DNA fragments randomly integrate into its chromosome, leading to stable expression. The transient expression levels show an accumulation curve that can vary for each gene expressed from an Agrobacterium-delivered T-DNA. In most cases, the highest expression levels occur 3-4 days after infiltration and quickly decrease after 5-6 days6,7. Previous studies have shown that more than 1/3rd of mutations in gene-edited plants obtained without selection pressure for resistance come from the transient expression of CRISPR/Cas9, while the remaining less than 2/3rd come from stable expression after DNA integration into the genome8. This indicates that T-DNA integration into the plant genome is not necessary for gene editing. Moreover, selection pressure for resistance significantly inhibits the growth of non-transgenic cells, directly affecting the regeneration process of infected explants. Therefore, by using transient expression without selection pressure for resistance in bamboo, it is possible to achieve non-integrated expression of exogenous genes and study gene function directly in plant organs. Hence, an easy and time-saving method can be developed for exogenous gene expression and editing in bamboo9.
The developed exogenous gene expression and gene editing method is characterized by its simplicity, cost-effectiveness, and the absence of expensive equipment or complex procedures9. In this method, the bamboo endogenous violaxanthin de-epoxidase gene (PeVDE) was used as the reporter for exogenous gene expression without selection pressure. This is because the edited PeVDE in bamboo leaves reduces the photoprotection ability under high light and demonstrates a decrease in the non-photochemical quenching (NPQ) value, which can be detected through chlorophyll fluorescence imaging. To demonstrate the effectiveness of this method, another bamboo endogenous gene, the cinnamoyl-CoA reductase gene (PeCCR5)9, was knocked out using this system and successfully generated mutants of this gene. This technique can be used for the functional characterization of genes that have functions in bamboo leaves. By overexpressing these genes transiently in bamboo leaves, their expression levels can be enhanced, or by gene editing, their expression can be knocked down, allowing for the study of downstream gene expression levels, leaf phenotypes, and product contents. This provides a more efficient and feasible approach for gene function research in bamboo. This technique can be applied to the functional characterization of genes that function in bamboo leaves. By overexpressing these genes transiently in bamboo leaves, their expression levels can be enhanced, or by gene editing, their expression can be knocked down, allowing for the study of downstream gene expression levels, leaf phenotypes, and product contents. Additionally, it is important to note that, due to extensive polyploidization, the majority of commercially important genes in bamboo genomes are present in multiple copies, resulting in genetic redundancy. This poses a challenge for performing multiplex genome editing in bamboo. Prior to the application of stable genetic transformation or gene editing techniques, it is crucial to quickly validate gene functions. In addressing the issue of multiple gene copies, one approach is to analyze transcriptome expression profiles to identify genes that are actively expressed during specific stages. Furthermore, targeting the conserved functional domains of these gene copies allows for the design of common target sequences or the incorporation of multiple target sites into the same CRISPR/Cas9 vector, enabling the simultaneous knockout of these genes. This provides a more efficient and feasible approach for gene function research in bamboo.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>35S::RUBY</td>
			<td>Addgene, United States</td>
			<td>160908</td>
			<td>Plamid construct</td>
		</tr>
		<tr>
			<td>Agrobacterium competent cells of GV3101, EHA105,LBA4404, and AGL1</td>
			<td>Biomed, China</td>
			<td>BC304-01, BC303-01, BC301-01, and BC302-01</td>
			<td>For Agrobacterium infection</td>
		</tr>
		<tr>
			<td>CTAB</td>
			<td>Sigma-Aldrich, United States</td>
			<td>57-09-0</td>
			<td>DNA extraction</td>
		</tr>
		<tr>
			<td>Imaging-PAM fluorometer</td>
			<td>Walz, Effeltrich, Germany</td>
			<td></td>
			<td>Detect chlorophyll fluorescence of bamboo leaves</td>
		</tr>
		<tr>
			<td>ImagingWin</td>
			<td>Walz, Effeltrich, Germany</td>
			<td></td>
			<td>Software for Imaging-PAM fluorometer</td>
		</tr>
		<tr>
			<td>Paq CI or Aar I</td>
			<td>NEB, United States</td>
			<td>R0745S</td>
			<td>Incorporate the target sequence onto the CRISPR/Cas9 vector.</td>
		</tr>
		<tr>
			<td>PrimeSTAR Max DNA polymerase</td>
			<td>Takara, Japan</td>
			<td>R045Q</td>
			<td>For gene cloning</td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>NEB, United States</td>
			<td>M0202V</td>
			<td>Incorporate the target sequence onto the CRISPR/Cas9 vector.</td>
		</tr>
	</tbody>
</table>

in planta gene expression and gene editing in moso bamboo leaves

A novel in planta gene transformation method was developed for bamboo, which avoids the need for time-consuming and labor-intensive callus induction and regeneration processes. This method involves Agrobacterium-mediated gene expression via wounding and vacuum for bamboo seedlings. It successfully demonstrated the expression of exogenous genes, such as the RUBY reporter and Cas9 gene, in bamboo leaves. The highest transformation efficiency for the accumulation of betalain in RUBY seedlings was achieved using the GV3101 strain, with a percentage of 85.2% after infection. Although the foreign DNA did not integrate into the bamboo genome, the method was efficient in expressing the exogenous genes. Furthermore, a gene editing system has also been developed with a native reporter using this method, from which an in situ mutant generated by the edited bamboo violaxanthin de-epoxidase gene (PeVDE) in bamboo leaves, with a mutation rate of 17.33%. The mutation of PeVDE resulted in decreased non-photochemical quenching (NPQ) values under high light, which can be accurately detected by a fluorometer. This makes the edited PeVDE a potential native reporter for both exogenous and endogenous genes in bamboo. With the reporter of PeVDE, a cinnamoyl-CoA reductase gene was successfully edited with a mutation rate of 8.3%. This operation avoids the process of tissue culture or callus induction, which is quick and efficient for expressing exogenous genes and endogenous gene editing in bamboo. This method can improve the efficiency of gene function verification and will help reveal the molecular mechanisms of key metabolic pathways in bamboo.

Agrobacterium-mediated in planta gene expression in bamboo leaves 
The RUBY reporter gene has been demonstrated to be effective in visualizing transient gene expression due to its ability to produce vivid red betalain from tyrosine10. In this study, Agrobacterium-mediated transformation was utilized to transiently express the exogenous RUBY gene in bamboo leaves (Figure 1). At&#160; the 3rd days after infection, red coloration was observed in the immature folded leaves, which became more vivid on the 5th day once the leaves had unfolded (blue triangle, Figure 1C). These results demonstrate that Agrobacterium successfully mediated the expression of the exogenous RUBY gene in bamboo leaves and that betalain synthesis occurred.
Furthermore, four strains of Agrobacterium (AGL1, LBA4404, EHA105, and GV3101) were compared and found that the GV3101 strain caused the most significant betalain accumulation in infected bamboo leaves, with the highest percentage of 85.2% of seedlings accumulated betalain after being infected, followed by AGL1 (76.9%) and then EHA105 (49.1%) and LBA4404 (31.3%; Figure 1D). This suggests that GV3101 is the most suitable strain for this purpose. High-fidelity PCR was conducted to detect whether the Agrobacterium-mediated T-DNA fragment had integrated into the bamboo chromosome. After 40 cycles of PCR, no bands of the RUBY gene were detected, indicating that the T-DNA fragment did not integrate or was integrated in such a low number that it could not be detected. Thus, these results conclude that this gene expression is transient.
Overall, these findings demonstrate the feasibility of Agrobacterium-mediated transient in planta gene expression in bamboo using the RUBY reporter gene. However, the red betalain color was found to be unstable and disappeared after 3 months of infection, indicating that the transient expression system is not stable for long-term observation.
In planta gene editing of bamboo violaxanthin de-epoxidase gene (PeVDE) 
Agrobacterium-mediated in planta gene expression is a transient method of gene expression in bamboo. To investigate whether a transient CRISPR/Cas9 system could achieve gene editing in bamboo leaves, the key enzyme in bamboo&#39;s xanthophyll cycle, violaxanthin de-epoxidase (PeVDE), was selected as a target for trial gene editing. Single guide RNAs (sgRNAs) were designed on the first exon of the PeVDE gene (sgRNA-1), which contains restriction sites of AgeI upstream of the protospacer adjacent motif (PAM) to facilitate gene editing validation (Figure 2A).
The CRISPR/Cas9 construct carrying sgRNA-1 was transfected into Agrobacterium to transform bamboo leaves. After infection of the Agrobacterium containing the CRISPR/Cas9 constructs carrying sgRNA-1 for 5 days, bamboo seedlings were subjected to high light treatment, and subsequently, chlorophyll fluorescence parameter detection was conducted. Certain areas of leaf blades were found that had lower non-photochemical quenching (NPQ) values (Figure 2B), indicating that the photoprotection ability of these areas was reduced under intense light. As PeVDE gene has the capacity to dissipate excess absorbed light energy13, these areas with lower NPQ values are likely to be the regions where the PeVDE gene was edited. Then, enzyme digestion and sequencing analysis were performed of the PeVDE gene fragment in these areas of the leaf blades (Figure 2C-D) and it was found that the mutation rate of sgRNA-1 was 17.33%, indicating that gene editing was successful in these areas of the PeVDE gene.
In addition, another sgRNA targeting site, sgRNA-2, containing an XbaI restriction site, was designed on the first exon of PeVDE. To investigate the possibility of long fragment deletion with dual sgRNA targeting, gene editing at both target sites was performed, resulting in long fragment deletion (Figure 2E).
Edited PeVDE mutant used as a reporter in the transient gene editing system 
Whether the PeVDE sgRNA could serve as a reporter in the transient gene editing system was investigated. The cinnamoyl-CoA reductase (PeCCR5) gene (Gene ID: PH02Gene42984.t1) was randomly selected, to evaluate the PeVDE reporter. One sgRNA target for PeCCR5 was designed in its conserved motif on the fourth exon. The CRISPR/Cas9 construct carrying both sgRNAs, PeVDE, and PeCCR5, was transformed into bamboo leaves (Figure 3A).
After Agrobacterium infection for 30 days, the seedlings were treated with high-intensity light for 20 min. It was observed that only the leaf areas edited for the PeCCR5 gene had no effect on NPQ values, while the leaf areas transfected by sgRNAs of both PeVDE and PeCCR5 exhibited lower NPQ values (Figure 3B).
Subsequently, the PeCCR5 fragment from the leaf areas with lower NPQ values was amplified and sequenced and found a mutation efficiency of 8.3% using deep sequencing. Therefore, the PeVDE reporter successfully served as a transient gene editing reporter and can be used to screen for gene editing of other endogenous bamboo genes.
Overall, these results demonstrate the feasibility of bamboo gene editing using CRISPR/Cas9 in bamboo.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/65799/65799fig01.jpg" /> 
Figure 1: In planta expression of RUBY gene and betalain accumulation in moso bamboo leaves. (A) Moso bamboo seedlings wrapped in tin foil and ready for Agrobacterium infection, with red triangles indicating positions that were wounded by a sharp needle from a syringe. (B) Vacuum infiltration process of bamboo seedlings. (C) Betalain accumulation in bamboo leaves after 3 days of infection observed through phenotypic changes. (D) Here, four Agrobacterium strains, AGL1, LBA4404, EHA105, and GV3101 mediated RUBY gene transformation in bamboo leaves was performed. GV3101 harboring the GFP construct was used as a negative control. This figure has been modified from9. <a href="https://www.jove.com/files/ftp_upload/65799/65799fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/65799/65799fig02.jpg" /> 
Figure 2: In planta expression and gene editing of PeVDE gene in bamboo leaves. (A) Location and target sequence information of sgRNA in the PeVDE gene. Red triangles indicate forward and reverse primers&#39; positions for fragment amplification. (B) NPQ and raw imaging of bamboo leaves after infection. Numbers in the NPQ image represent NPQ values in the imaging software monitor. (C) Electrophoresis results of PeVDE fragment before and after AgeI digestion. WT denotes the wild-type non-infected leaves, and + and - represent PeVDE fragments with or without AgeI digestion, respectively. (D) Deep sequencing results of the PeVDE fragment in lower NPQ value leaves. The red, blue, and grey fonts in the sequences represent the target sites, PAM, and insertions, respectively. The red dashes indicate deleted nucleotides. (E) Sanger sequencing results of the PeVDE fragment after editing by both sgRNA-1 and sgRNA-2. This figure has been modified from9. <a href="https://www.jove.com/files/ftp_upload/65799/65799fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/65799/65799fig03.jpg" /> 
Figure 3: PeVDE sgRNA as a reporter for screening gene editing of PeCCR5. (A) Schematic representation of CRISPR/Cas9 constructs containing PeVDE and PeCCR5 sgRNAs. (B) NPQ and raw images of bamboo leaves after infection with the constructs in (A). White triangles indicate areas with lower NPQ values. The rainbow color represents the value of NPQ/4, where red corresponds to the minimum value and purple corresponds to 1. (C) The red, blue, and grey fonts in the sequences represent the target sites, PAM, and insertions, respectively. The red dashes indicate deleted nucleotides. This figure has been modified from9. <a href="https://www.jove.com/files/ftp_upload/65799/65799fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Gene name</td>
			<td colspan="2">Primer sequence (5&#39;-3&#39;)</td>
			<td colspan="2">Application</td>
		</tr>
		<tr>
			<td rowspan="2">RUBY</td>
			<td colspan="2">F: ATGGATCATGCGACCCTCG</td>
			<td colspan="2" rowspan="2">For PCR amplification in infected bamboo leaves</td>
		</tr>
		<tr>
			<td colspan="2">R: GTACTCGTAGAGCTGCTGCAC</td>
		</tr>
		<tr>
			<td rowspan="2">PeVDE</td>
			<td colspan="2">F: TGTGGCTTCTAAAGCTCTGCAATCT</td>
			<td colspan="2" rowspan="2">For gene cloning and sequencing</td>
		</tr>
		<tr>
			<td colspan="2">R: TGTCAATGCTACAAGTCCTGGCA</td>
		</tr>
		<tr>
			<td rowspan="2">PeVDE-Target1</td>
			<td colspan="2">F: GGCATAGCCCTCACGCAGCACCGG</td>
			<td colspan="2" rowspan="2">For designing PeVDE sgRNA-1 target</td>
		</tr>
		<tr>
			<td colspan="2">R: AAACCCGGTGCTGCGTGAGGGCTA</td>
		</tr>
		<tr>
			<td rowspan="2">PeVDE-Target2</td>
			<td colspan="2">F: GGCACTCCACGGTCCCAAATCTAG</td>
			<td colspan="2" rowspan="2">For designing PeVDE sgRNA-2 target</td>
		</tr>
		<tr>
			<td colspan="2">R: AAACCTAGATTTGGGACCGTGGAG</td>
		</tr>
		<tr>
			<td rowspan="2">PeCCR5-Target</td>
			<td colspan="2">F: GGCACTGGTACTGCTACGCTAAGA</td>
			<td colspan="2" rowspan="2">For designing PeCCR5 sgRNA target</td>
		</tr>
		<tr>
			<td colspan="2">R: AAACTCTTAGCGTAGCAGTACCAG</td>
		</tr>
	</tbody>
</table>
Table 1: The sequence information of primers.

Watch this Scientific Journal Video about Advancing Gene Editing in Bamboo Leaves for Sustainable Plastic Alternatives at JoVE.com

Author Spotlight: Advancing Gene Editing in Bamboo Leaves for Sustainable Plastic Alternatives 

In this study, a novel in planta gene expression and gene editing method mediated by Agrobacterium was developed in bamboo. This method greatly improved the efficiency of gene function validation in bamboo, which has significant implications for accelerating the process of bamboo breeding.

In Planta Gene Expression and Gene Editing in Moso Bamboo Leaves

A novel in planta gene transformation method was developed for bamboo, which avoids the need for time-consuming and labor-intensive callus induction and ...

in-planta-gene-expression-and-gene-editing-in-moso-bamboo-leaves

Universidad San Sebastian

Research

JoVE Journal

Biology

1.4K Views.  Key Laboratory of State Forestry and Grassland Administration/Beijing on Bamboo & Rattan Science and Technology. In this study, a novel in planta gene expression and gene editing method mediated by Agrobacterium was developed in bamboo. This method greatly improved the efficiency of gene function validation in bamboo, which has significant implications for accelerating the process of bamboo breeding.

Video: Author Spotlight: Advancing Gene Editing in Bamboo Leaves for Sustainable Plastic Alternatives 

Localized RNAi and Ectopic Gene Expression in the Medicinal Leech

In this video, we show the use of a pneumatic capillary gun for the accurate biolistic delivery of reagents into live tissue. We use the procedure to perturb gene expression patterns in selected segments of leech embryos, leaving the untreated segments as internal controls.
The pneumatic capillary gun can be used to reach internal layers of cells at early stages of development without opening the specimen. As a method for localized introduction of substances into living tissues, the biolistic delivery with the gun has several advantages: it is fast, contact-free and non-destructive. In addition, a single capillary gun can be used for independent delivery of different substances. The delivery region can have lateral dimensions of ~50-150 &#181;m and extends over ~15 &#181;m around the mean penetration depth, which is adjustable between 0 and 50 &#181;m. This delivery has the advantage of being able to target a limited number of cells in a selected location intermediate between single cell knock down by microinjection and systemic knockdown through extracellular injections or by means of genetic approaches.
For knocking down or knocking in the expression of the axon guidance molecule Netrin, which is naturally expressed by some central neurons and in the ventral body wall, but not the dorsal domain, we deliver molecules of dsRNA or plasmid-DNA into the body wall and central ganglia. This procedure includes the following steps: (i) preparation of the experimental setup for a specific assay (adjusting the accelerating pressure), (ii) coating the particles with molecules of dsRNA or DNA, (iii) loading the coated particles into the gun, up to two reagents in one assay, (iv) preparing the animals for the particle delivery, (v) delivery of coated particles into the target tissue (body wall or ganglia), and (vi) processing the embryos (immunostaining, immunohistochemistry and neuronal labeling) to visualize the results, usually 2 to 3 days after the delivery.
When the particles were coated with netrin dsRNA, they caused clearly visible knock-down of netrin expression that only occurred in cells containing particles (usually, 1-2 particles per cell). Particles coated with a plasmid encoding EGFP induced fluorescence in neuronal cells when they stopped in their nuclei.

In this video, we show a procedure for an accurate biolistic delivery of reagents into live tissue with a novel miniature gene gun. We are knocking down the expression of the axon guidance molecule Netrin in leech embryos by delivering molecules of dsRNA into the ventral body wall and ganglia of single segments.

In this video, we show the use of a pneumatic capillary gun for the accurate biolistic delivery of reagents into live tissue. We use the procedure to ...

The Preparation of Primary Hematopoietic Cell Cultures From Murine Bone Marrow for Electroporation

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser MXcell  electroporation system and Gene Pulser  electroporation buffer were specifically developed to transfect nucleic acids into mammalian cells and difficult-to-transfect cells, such as primary and stem cells.This video demonstrates how to establish primary hematopoietic cell cultures from murine bone marrow, and then prepare them for electroporation in the MXcell system. We begin by isolating femur and tibia. Bone marrow from both femur and tibia are then harvested and cultures are established. Cultured bone marrow cells are then transfected and analyzed.

This procedure describes how to establish primary hematopoietic cell cultures from murine bone marrow and is followed by transfection using the Gene Pulser MXCell electroporation system.

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser ...

Using the Gene Pulser MXcell Electroporation System to Transfect Primary Cells with High Efficiency

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser MXcell electroporation system and Gene Pulser electroporation buffer (Bio-Rad) were specifically developed to easily transfect nucleic acids into mammalian cells and difficult-to-transfect cells, such as primary and stem cells. We will demonstrate how to perform a simple experiment to quickly identify the best electroporation conditions. We will demonstrate how to run several samples through a range of electroporation conditions so that an experiment can be conducted at the same time as optimization is performed. We will also show how optimal conditions identified using 96-well electroporation plates can be used with standard electroporation cuvettes, facilitating the switch from electroporation plates to electroporation cuvettes while maintaining the same electroporation efficiency. In the video, we will also discuss some of the key factors that can lead to the success or failure of electroporation experiments.

This procedure shows how to use the Gene Pulser MXcell electroporation system to rapidly and easily identify the best electroporation conditions for mouse embryonic fibroblasts (MEFs) or other primary cells. Considerations for troubleshooting are also discussed in the associated video.

Using an Automated Cell Counter to Simplify Gene Expression Studies: siRNA Knockdown of IL-4 Dependent Gene Expression in Namalwa Cells

The use of siRNA mediated gene knockdown is continuing to be an important tool in studies of gene expression.  siRNA studies are being conducted not only to study the effects of downregulating single genes, but also to interrogate signaling pathways and other complex interaction networks.  These pathway analyses require both the use of relevant cellular models and methods that cause less perturbation to the cellular physiology.  Electroporation is increasingly being used as an effective way to introduce siRNA and other nucleic acids into difficult to transfect cell lines and primary cells without altering the signaling pathway under investigation. There are multiple critical steps to a successful siRNA experiment, and there are ways to simplify the work while improving the data quality at several experimental stages.  To help you get started with your siRNA mediated gene knockdown project, we will demonstrate how to perform a pathway study complete from collecting and counting the cells prior to electroporation through post transfection real-time PCR gene expression analysis.  The following study investigates the role of the transcriptional activator STAT6 in IL-4 dependent gene expression of CCL17 in a Burkitt lymphoma cell line (Namalwa).  The techniques demonstrated are useful for a wide range of siRNA-based experiments on both adherent and suspension cells.  We will also show how to streamline cell counting with the TC10 automated cell counter, how to electroporate multiple samples simultaneously using the MXcell electroporation system, and how to simultaneously assess RNA quality and quantity with the Experion automated electrophoresis system.

This procedure describes a quick and easy workflow to introduce siRNA into difficult to transfect cell lines and follow gene expression by real-time PCR. Use of an automated cell counter, multi-well electroporation plate, and automated electrophoresis station provide quick and reliable results without the need for expensive robotic handling.

The use of siRNA mediated gene knockdown is continuing to be an important tool in studies of gene expression.  siRNA studies are being conducted not only ...

Paraffin-Embedded and Frozen Sections of Drosophila Adult Muscles

The molecular characterization of muscular dystrophies and myopathies in humans has revealed the complexity of muscle disease and genetic analysis of muscle specification, formation and function in model systems has provided valuable insight into muscle physiology. Therefore, identifying and characterizing molecular mechanisms that underlie muscle damage is critical. The structure of adult Drosophila multi-fiber muscles resemble vertebrate striated muscles 1 and the genetic tractability of Drosophila has made it a great system to analyze dystrophic muscle morphology and characterize the processes affecting muscular function in ageing adult flies 2. Here we present the histological technique for preparing paraffin-embedded and frozen sections of Drosophila thoracic muscles. These preparations allow for the tissue to be stained with classical histological stains and labeled with protein detecting dyes, and specifically cryosections are ideal for immunohistochemical detection of proteins in intact muscles. This allows for analysis of muscle tissue structure, identification of morphological defects, and detection of the expression pattern for muscle/neuron-specific proteins in Drosophila adult muscles. These techniques can also be slightly modified for sectioning of other body parts.

Paraffin-Embedded and Frozen Sections of Drosophila Adult Muscles

Identification of mechanisms underlying muscle damage is crucial. Here we present the histological technique for preparing paraffin-embedded and frozen sections of Drosophila thoracic muscles. This allows analysis of muscle morphology and localization of protein and other muscle cell components.

The molecular characterization of muscular dystrophies and myopathies in humans has revealed the complexity of muscle disease and genetic analysis of ...

In vitro Reconstitution of the Active T. castaneum Telomerase

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more than a decade. Here, we present methods for the isolation of the recombinant Tribolium castaneum TERT (TcTERT) and the reconstitution of the active T. castaneum telomerase ribonucleoprotein (RNP) complex in vitro.
Telomerase is a specialized reverse transcriptase1 that adds short DNA repeats, called telomeres, to the 3' end of linear chromosomes2 that serve to protect them from end-to-end fusion and degradation. Following DNA replication, a short segment is lost at the end of the chromosome3 and without telomerase, cells continue dividing until eventually reaching their Hayflick Limit4. Additionally, telomerase is dormant in most somatic cells5 in adults, but is active in cancer cells6 where it promotes cell immortality7.
The minimal telomerase enzyme consists of two core components: the protein subunit (TERT), which comprises the catalytic subunit of the enzyme and an integral RNA component (TER), which contains the template TERT uses to synthesize telomeres8,9. Prior to 2008, only structures for individual telomerase domains had been solved10,11. A major breakthrough in this field came from the determination of the crystal structure of the active12, catalytic subunit of T. castaneum telomerase, TcTERT1.
Here, we present methods for producing large quantities of the active, soluble TcTERT for structural and biochemical studies, and the reconstitution of the telomerase RNP complex in vitro for telomerase activity assays. An overview of the experimental methods used is shown in Figure 1.

In vitro Reconstitution of the Active T. castaneum Telomerase

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more than a decade. Here, we present methods for the isolation of the recombinant Tribolium castaneum TERT (TcTERT) and the reconstitution of the active T. castaneum telomerase ribonucleoprotein (RNP) complex in vitro.

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more ...

Induction and Testing of Hypoxia in Cell Culture

Hypoxia is defined as the reduction or lack of oxygen in organs, tissues, or cells. This decrease of oxygen tension can be due to a reduced supply in oxygen (causes include insufficient blood vessel network, defective blood vessel, and anemia) or to an increased consumption of oxygen relative to the supply (caused by a sudden higher cell proliferation rate). Hypoxia can be physiologic or pathologic such as in solid cancers 1-3, rheumatoid arthritis, atherosclerosis etc&#x2026; Each tissues and cells have a different ability to adapt to this new condition. During hypoxia, hypoxia inducible factor alpha (HIF) is stabilized and regulates various genes such as those involved in angiogenesis or transport of oxygen 4. The stabilization of this protein is a hallmark of hypoxia, therefore detecting HIF is routinely used to screen for hypoxia 5-7. 
In this article, we propose two simple methods to induce hypoxia in mammalian cell cultures and simple tests to evaluate the hypoxic status of these cells.

Here we propose simple methods to induce hypoxia in cell cultures and simple tests to evaluate the hypoxic status of the cultures.

Hypoxia is defined as the reduction or lack of oxygen in organs, tissues, or cells.  This decrease of oxygen tension can be due to a reduced supply in ...

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the messagefor review see 1. However, it's now widely accepted that synonymous codon usage is the primary cause of non-uniform translational elongation rates1. Synonymous codons are not used with identical frequency. A bias exists in the use of synonymous codons with some codons used more frequently than others2. Codon bias is organism as well as tissue specific2,3. Moreover, frequency of codon usage is directly proportional to the concentrations of cognate tRNAs4. Thus, a frequently used codon will have higher multitude of corresponding tRNAs, which further implies that a frequent codon will be translated faster than an infrequent one. Thus, regions on mRNA enriched in rare codons (potential pause sites) will as a rule slow down ribosome movement on the message and cause accumulation of nascent peptides of the respective sizes5-8. These pause sites can have functional impact on the protein expression, mRNA stability and protein foldingfor review see 9. Indeed, it was shown that alleviation of such pause sites can alter ribosome movement on mRNA and subsequently may affect the efficiency of co-translational (in vivo) protein folding1,7,10,11. To understand the process of protein folding in vivo, in the cell, that is ultimately coupled to the process of protein synthesis it is essential to gain comprehensive insights into the impact of codon usage/tRNA content on the movement of ribosomes along mRNA during translational elongation.
Here we describe a simple technique that can be used to locate major translation pause sites for a given mRNA translated in various cell-free systems6-8. This procedure is based on isolation of nascent polypeptides accumulating on ribosomes during in vitro translation of a target mRNA. The rationale is that at low-frequency codons, the increase in the residence time of the ribosomes results in increased amounts of nascent peptides of the corresponding sizes. In vitro transcribed mRNA is used for in vitro translational reactions in the presence of radioactively labeled amino acids to allow the detection of the nascent chains. In order to isolate ribosome bound nascent polypeptide complexes the translation reaction is layered on top of 30% glycerol solution followed by centrifugation. Nascent polypeptides in polysomal pellet are further treated with ribonuclease A and resolved by SDS PAGE. This technique can be potentially used for any protein and allows analysis of ribosome movement along mRNA and the detection of the major pause sites. Additionally, this protocol can be adapted to study factors and conditions that can alter ribosome movement and thus potentially can also alter the function/conformation of the protein.

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

A technique to identify translational pause sites on mRNA is described. This procedure is based on isolation of nascent polypeptides accumulating on ribosomes during in vitro translation of a target mRNA, followed by the size analysis of the nascent chains using a denaturing gel electrophoresis.

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the ...

Using SecM Arrest Sequence as a Tool to Isolate Ribosome Bound Polypeptides

Extensive research has provided ample evidences suggesting that protein folding in the cell is a co-translational process1-5. However, the exact pathway that polypeptide chain follows during co-translational folding to achieve its functional form is still an enigma. In order to understand this process and to determine the exact conformation of the co-translational folding intermediates, it is essential to develop techniques that allow the isolation of RNCs carrying nascent chains of predetermined sizes to allow their further structural analysis.
SecM (secretion monitor) is a 170 amino acid E. coli protein that regulates expression of the downstream SecA (secretion driving) ATPase in the secM-secA operon6. Nakatogawa and Ito originally found that a 17 amino acid long sequence (150-FSTPVWISQAQGIRAGP-166) in the C-terminal region of the SecM protein is sufficient and necessary to cause stalling of SecM elongation at Gly165, thereby producing peptidyl-glycyl-tRNA stably bound to the ribosomal P-site7-9. More importantly, it was found that this 17 amino acid long sequence can be fused to the C-terminus of virtually any full-length and/or truncated protein thus allowing the production of RNCs carrying nascent chains of predetermined sizes7. Thus, when fused or inserted into the target protein, SecM stalling sequence produces arrest of the polypeptide chain elongation and generates stable RNCs both in vivo in E. coli cells and in vitro in a cell-free system. Sucrose gradient centrifugation is further utilized to isolate RNCs.
The isolated RNCs can be used to analyze structural and functional features of the co-translational folding intermediates. Recently, this technique has been successfully used to gain insights into the structure of several ribosome bound nascent chains10,11. Here we describe the isolation of bovine Gamma-B Crystallin RNCs fused to SecM and generated in an in vitro translation system.

We describe here a technique that is now routinely used to isolate stably bound ribosome nascent chain complexes (RNCs). This technique takes advantage of the discovery that a 17 amino acid long SecM "arrest sequence" can halt translation elongation in a prokaryotic (E. coli) system, when inserted into (or fused to the C-terminus) of virtually any protein.

Extensive research has provided ample evidences suggesting that protein folding in the cell is a co-translational process1-5. However, the exact pathway ...

Analysis of Global RNA Synthesis at the Single Cell Level following Hypoxia

Hypoxia or lowering of the oxygen availability is involved in many physiological and pathological processes. At the molecular level, cells initiate a particular transcriptional program in order to mount an appropriate and coordinated cellular response. The cell possesses several oxygen sensor enzymes that require molecular oxygen as cofactor for their activity. These range from prolyl-hydroxylases to histone demethylases. The majority of studies analyzing cellular responses to hypoxia are based on cellular populations and average studies, and as such single cell analysis of hypoxic cells are seldom performed. Here we describe a method of analysis of global RNA synthesis at the single cell level in hypoxia by using Click-iT RNA imaging kits in an oxygen controlled workstation, followed by microscopy analysis and quantification.&nbsp; Using cancer cells exposed to hypoxia for different lengths of time, RNA is labeled and measured in each cell. This analysis allows the visualization of temporal and cell-to-cell changes in global RNA synthesis following hypoxic stress.

We describe a technique for analysis of global RNA synthesis in hypoxia using imaging. Click-chemistry labeling of RNA has not previously been performed under hypoxia and allows visualization of global RNA changes at the single cell level. This approach complements the existing averaged RNA techniques, allowing direct visualization of cell-to-cell changes in global RNA synthesis.

Hypoxia or lowering of the oxygen availability is involved in many physiological and pathological processes. At the molecular level, cells initiate a ...