O desenvolvimento do DNA que se estende do ensaio foi auxiliado por Paulo Blainey, Lee Jong-Bong, e Hamdan Samir. Este trabalho é apoiado pelos Institutos Nacionais de Saúde concede a Charles Richardson (GM54397), e Antoine van Oijen (GM077248).

1. Modelo de replicação do DNA DNA para a reação é um DNA λ linearizada modificado por anelamento de oligonucleotídeos para formar uma forquilha de replicação. Além disso, biotina é anexado ao final de uma vertente do DNA λ, e uma porção digoxigenina está ligado à outra extremidade do fio mesmo 1. Materiais: Bacteriófago λ DNA, Oligonucleotídeos: braço garfo biotinilado (A: 5&#39;-biotina-AAAAAAAAAAAAAAAAGAGTACTGTACGATCTAGCATCAATCACAGGGTCAGGTTCGTTATTGTCCAACTTGCTGTCC-3 &#39;), λ-complementares braço fork (B: 5&#39;-GGGCGGCGACCTGGACAGCAAGTTG GACAATCTCGTTCTATCACTAATTCACTAATGCAGGGAGGATTTCAGATATGGCA-3&#39;), primer fork (C: 5 &#39; -TGCCATATCTGAAATCCTCCCTGC-3 &#39;), fim digoxigenina λ-complementares (D: 5&#39;-AGGTCG CCGCCCAAAAAAAAAAAA-digoxigenina-3&#39;), DNA Ligase T4, T4 polinucleotídeo quinase, bloco Heat. <ol><li> Fosforilar termina a 5 &#39;de oligonucleotídeos B e D utilizando Quinase Polinucleotídeo T4. </li><li> Recozer oligonucleotides A, B e C para o DNA λ em uma única etapa, adicionando um excesso de 10 vezes de oligonucleotídeos A e B, e um excesso de 100 vezes de oligonucleotídeo C em tampão T4 DNA ligase. </li><li> Aquecer a mistura a 65 ° C no bloco de calor. Uma vez aquecida, por sua vez o bloco de calor e deixe resfriamento lento corretamente anneal oligonucleotides. </li><li> Adicionar DNA ligase T4 à mistura e incubar à temperatura ambiente por 2 horas. Ligase T4 DNA vai catalisar a correta união de oligonucleotides A e B e DNA λ. </li><li> Finalmente, recozer a D oligonucleotídeo para o modelo de replicação do DNA pela adição de 100 vezes o excesso de oligonucleotídeo D com respeito ao DNA l em tampão T4 DNA ligase. </li><li> Incubar a mistura a 45 ° C por 30 min no bloco, calor e arrefecer à temperatura ambiente girando lentamente bloco calor fora. </li><li> O modelo de replicação final DNA está pronto para uso. Nós armazenar o modelo em uma concentração de 1,4 nM a 4 ° C por várias semanas. </li></ol> 2. Contas Contas são funcionalizados com um fragmento Fab, com especificidade para digoxigenina. Eles podem ser então anexado ao modelo de dois DNA de replicação. Materiais: Tosil contas ativado, α-digoxigenina fragmento Fab, tampão A: 0,1 M pH 9,5 H3BO3, tampão B: 0,1 M PBS pH 7,4, 0,1% w / v BSA, Buffer C: 0,2 M Tris-HCl pH 8.5 (25 ° C), 0,1% w / v BSA, separador magnético, Rotator. <ol><li> Ressuspender a solução estoque de contas e transferência de uma alíquota pequena dentro do tubo eppendorf. Colocar o tubo em um slot do separador magnético e incubar até que a solução limpa, em seguida, retire o sobrenadante por pipetagem. </li><li> Adicionar Um buffer, que irá ativar grupos tosila para acoplamento de anticorpos. Misture delicadamente por pipetagem e remover do buffer com o separador magnético. </li><li> Adicionar fragmento Fab e contas ressuspender novamente em tampão A, misture bem e incubar 16-24 horas a 37 ° C usando rotador. Após a incubação, contas separadas usando o separador magnético e remover buffer. </li><li> Lavar contas adicionando tampão B e incubar a 4 ° C por 5 min. Remover o buffer usando separador magnético. Repetir a lavagem duas vezes. </li><li> Adicionar tampão C e incubar a 37 ° C por 4 horas para bloquear grupos tosila livre. Contas separadas usando separador magnético e remover buffer. </li><li> Lavar duas vezes em tampão B e alíquotas para o uso. Contas podem ser armazenados a 4 ° C por 1 ano ou mais sem perda substancial de qualidade (nossa solução estoque contém 1 - 2x10 9 esferas / ml). </li></ol> 3. Lamelas funcionalizados Para permitir a ligação do DNA à lamela de vidro, o vidro é o primeiro funcionalizados com um aminosilane, que é acoplado a moléculas de PEG biotinilado. Este revestimento ajuda a reduzir as interações não específicas de DNA e proteínas de replicação com a superfície 3,4. Materiais: lamínulas de vidro, potes de coloração, 3-aminopropyltriethoxysilane, Methoxy-PEG5k NHS-éster, Biotina-PEG5k-NHSester, acetona, 1M KOH, Etanol, Forno sonicador Bath, <ol><li> Limpam-se as lamínulas de vidro, colocando-os na coloração frascos e encher os frascos com etanol. Sonicado por 30 minutos, enxaguar os frascos e encher com 1 M KOH. Repita os dois lavagens. </li><li> Para a reação de funcionalização em primeiro lugar, todos os vestígios de água precisam ser removidos. Enchei as talhas de acetona e sonicate por 10 min. Vazio e encher novamente com acetona. </li><li> Prepare uma solução 2% v / v do reagente silano em acetona. Adicionar ao tinas de coloração e agitar por 2 minutos. Esta reação casais do grupo de alcóxi de aminosilane ao vidro, deixando uma amina reativos para a etapa seguinte de acoplamento. Saciar a reação com um grande excesso de água. </li><li> Seca as lamelas cozendo-los em 110 °; C no forno por 30 minutos. </li><li> Prepare um metoxi 50:1: biotina mistura PEG em 100 mM NaHCO 3 pH 8.2. Apontar para cerca de 0,2% PEG w / v biotinilado. </li><li> Pipetar 100 mL da mistura PEG em uma lamela seca silanizadas e colocar outra lamínula por cima. Incluindo um espaçador lamela de vidro vai permitir a separação das lamelas. </li><li> Incubar as lamelas na solução de PEG por 3 horas, em seguida, separe cada par de lamelas e lavar abundantemente com água. Tenha cuidado para manter as lamelas funcionalizados lateral-se como apenas o lado uma vez serão revestidas com PEG. </li><li> Seca as lamelas com o ar e armazenar sob vácuo em exsicador. As superfícies de permanecer estável por pelo menos um mês, assim que dezenas de lamelas podem ser feitas em um lote e usado quando necessário. </li></ol> 4. Preparação câmara de fluxo O experimento é realizado com uma câmara de fluxo simples construída com uma lamela funcionalizados, fita dupla face, uma lâmina de quartzo e tubo. Uma câmara de fluxo está preparado para cada experimento uma única molécula de 2,4. Materiais: fita dupla face, lâmina de barbear, lâmina de quartzo com furos para tubos de epóxi, de secagem rápida, lamela funcionalizados, estreptavidina solução (25 mL de 1 mg / mL em PBS), tubulação, tampão de bloqueio (5X: 20 mM Tris pH 7.5, 2 mM EDTA, 50 mM NaCl, 0,2 mg / mL BSA, 0,005% Tween-20), buffer de trabalho (1X: 20 mM Tris-HCl pH 7,5, 2 mM EDTA, 50 mM NaCl). <ol><li> Comece por misturar e colocar 5 mL de tampão de bloqueio e 20 ml de tampão trabalhando em um dessecador para remover quaisquer bolhas de ar para etapas posteriores. </li><li> Dê uma lamela PEG-funcionalizados e espalhar 125 de PBS-diluída solução de estreptavidina sobre a superfície. Deixar isso para incubar por 20 minutos em temperatura ambiente enquanto prepara outras partes da câmara, permitindo estreptavidina para ligar a Biotins superfície. </li><li> Corte um pedaço de fita dupla face para corresponder ao tamanho da lâmina de quartzo. Marcar a posição dos furos de tubos na fita para que um esboço da câmara de fluxo podem ser tiradas na fita. </li><li> Faça um canal central de 3 mm de largura e retângulos contendo dois buracos. Nós usamos câmaras de fluxo, com dois de entrada e duas de saída em forma de Y canais. </li><li> Corte ao longo do contorno desenhado, tornando reto, cortes limpos para garantir que nenhum sobressaia adesivo para o canal. </li><li> Limpe o quartzo, cuidadosamente, com acetona ou etanol para remover adesivo da construção anterior de fluxo de células. </li><li> Encontrar o melhor alinhamento do contorno do canal, remove um dos lados da camada adesiva e coloque cuidadosamente a fita sobre a lâmina de quartzo. Tenha o cuidado de alinhar a fita corretamente, como os buracos de entrada e saída necessidade de permanecer desbloqueados. </li><li> Cortar comprimentos de tubulação para a entrada e saída da célula de fluxo. Isso ajuda a cortar a extremidade do tubo em cerca de um ângulo de 30 ° para que o tubo não vai pressionar plana contra o fundo de câmara. Colocar os tubos em algum tipo de apoio (suportes de tubos, por exemplo) para suspendê-las para fixação fácil a célula de fluxo nas próximas etapas. </li><li> Lavar a lamela estreptavidina revestida abundantemente com água e seque com ar comprimido. Lembre-se que apenas um lado é funcionalizada. Remover o outro lado do suporte de fita e colocar a lâmina de quartzo para a lamela. </li><li> Pressione levemente na lamela a empurrar para fora todo o ar aprisionado no adesivo. Isso ajudará a evitar as bolhas de ar entrando no canal de fluxo. </li><li> Vedação dos lados da câmara com epóxi. Insira o tubo de corte nos orifícios do quartzo e foca no lugar com epóxi. Isso precisa secar por alguns minutos. </li><li> Depois de seco, comece a bloquear a superfície, puxando alguns dos desgaseificados tampão de bloqueio através de um dos tubos. A agulha calibre 21 se encaixa perfeitamente dentro do tubo de 0,76 milímetros. Lavar algumas vezes para remover bolhas de ar, e permitir que a câmara para incubar por pelo menos meia hora. </li></ol> 5. Única molécula Experiment Replicação Uma vez que o modelo de DNA e contas funcionalizados foram preparadas, ea câmara de fluxo está pronto, uma experiência única molécula pode ser realizada. Materiais: câmara de fluxo preparados, tampão de bloqueio (5X: 20 mM Tris-HCl pH 7,5, 2 mM EDTA, 50 mM NaCl, 1 mg / mL BSA, 0,025% Tween-20) buffer, de trabalho (1X: 20 mM Tris-HCl pH 7,5, 2 mM EDTA, 50 mM NaCl), buffers de replicação T7 com ou sem 10 mM MgCl 2 (1X: 40 mM Tris-HCl pH 7,5, 50 mM K-glutamato, 2 mM EDTA, 100 mg / ml BSA, 10 mM TDT, 600 mM dNTPs), proteínas de replicação, microscópio óptico invertido com objetiva de 10X, câmera CCD, um ímã permanente de terras-raras, bomba de seringa, airspring, iluminador de fibra, computador com software de aquisição de imagem. <ol><li> Após a célula de fluxo foi bloqueado, ele está pronto para começar o experimento. </li><li> Pegue a célula de fluxo e colocá-lo no palco microscópio. Segure a câmara no lugar com clipes de estágioe certifique-se que o canal de fluxo é posicionado em alinhamento com a câmara CCD. </li><li> Conecte o fluxo de saída de tubos de célula para a airspring usando um tubo conector maior diâmetro ou uma agulha. O airspring é usado para estabilizar as irregularidades de fluxo. Um tubo de plástico de 50 ml é preenchida com 45ml de água. A tampa do tubo é selada com epóxi. Três buracos são perfurados na tampa, e três pedaços de tubos são inseridos no tubo. Usando epoxy, os tubos são, então, selados para a tampa, impedindo o ar de entrar ou escapar. O airspring está conectado à bomba de seringa, e os tubos de saída da célula de fluxo. </li><li> Coloque os tubos de entrada da célula de fluxo em tampão de bloqueio e puxe a seringa para remover qualquer ar no tubo. Um filme suave do tubo de saída vai ajudar a limpar as bolhas de ar aprisionado na célula de fluxo. </li><li> Uma vez que todas as bolhas de ar foram removidos, a um quarteirão dos tubos de entrada com uma agulha, e um dos tubos de saída, dobrando-em 1800 e proteger o tubo com fita adesiva. </li><li> Diluir o modelo de DNA de ações para 22:00 em 1 ml de tampão de bloqueio desgaseificados. Fluxo para a câmara de fluxo moderado para permitir a cobertura boa superfície de DNA (0,01-0,05 ml / min por 20 minutos funciona bem). Isto pode ser variado com base em quantas moléculas de DNA estão na superfície para cada lote de lamelas ou quantos forem desejados para o experimento. </li><li> Diluir a solução estoque talão a 2 4x10-6 contas / ml em 1 ml de tampão de bloqueio desgaseificados. Fluxo para a câmara de 0,01-0,05 ml / min por 15 minutos. </li><li> Uma vez que contas são adicionados, por sua vez o fluxo e deixe câmara para alcançar o equilíbrio. Em seguida, fechar tubos tanto de saída. Quaisquer alterações aos tubos sem a câmara fechada vai causar flutuações de pressão que irá exercer uma força sobre as contas e corte as moléculas de DNA amarrados. </li><li> Bloquear o tubo de entrada que foi usado para carregar contas com uma agulha, e começar a lavar a célula de fluxo usando a entrada em segundo lugar com solução 1X desgaseificados de tampão de bloqueio em tampão de trabalho. Lavar exaustivamente a uma taxa de 0,01-0,05 ml / min. Agitar manualmente o palco tocando para remover quaisquer contas inespecificamente preso à superfície ( <a href="https://www.jove.com/files/ftp_upload/1689/Tapping.avi">Tapping</a> ). </li><li> Uma vez que contas livres são suficientemente afastados, por sua vez o fluxo e deixe câmara para alcançar o equilíbrio. Fechar o tubo de saída aberta e mudar o reservatório de entrada para solução de proteína, lentamente abertura da tomada para evitar mudanças de pressão rápida </li><li> Você pode verificar se contas são amarrados ao DNA pela mudança de direção do fluxo ( <a href="https://www.jove.com/files/ftp_upload/1689/DNA.avi">DNA</a> ). </li><li> Agora, a reação enzimática pode ser realizada. Experimentos para a vertente levando-síntese de fazer a solução de 20nm de gp4 helicase e solução de 20nm GP5 polimerase (purificada como um complexo com o seu thioredoxin fator de processabilidade) em tampão desgaseificados replicação T7, que não contém MgCl 2. </li><li> Fluxo da solução de proteína na câmara a taxa de fluxo moderado para permitir a ligação eficiente de DNA. Usamos 0,037 ml / min durante 8 minutos, e depois 0,012 ml / min durante 7 minutos. </li><li> Lave a câmara com tampão desgaseificados replicação T7 sem MgCl 2 para remover proteínas livres. A taxa de 0,037 ml / min por 3-10 minutos funciona bem. </li><li> Após a lavagem, o fluxo de buffer de replicação T7 com MgCl 2 e começar a aquisição de dados. Use um fluxo de 0,012 ml / min, correspondendo a 3 força de arrasto sobre as amarras pN DNA em condições descritos neste protocolo. </li><li> Coloque um ímã permanente de terras-raras acima da célula de fluxo antes de imagem para evitar interações inespecíficas entre contas e de superfície. </li><li> Ver campo com uma objetiva de 10X e câmera CCD. Foco usando um cordão amarrado. </li><li> Posição de um iluminador de fibra em um ângulo de incidência entre 10 graus e paralelo ao estágio do microscópio perto do microscópio. Em campo escuro iluminação é usada para aumentar o contraste da imagem talão. </li><li> Aquisição de dados de 20 30 min em um frame rate lenta (tipicamente 2-4 Hz). </li></ol> 6. Resultados representante Em um experimento bem sucedido você deve ser capaz de observar mais de 100 contas simultaneamente ( <a href="https://www.jove.com/files/ftp_upload/1689/Leading_strand_synthesis.avi">síntese vertente Leading</a> ). O experimento deve render numerosos vestígios exibindo a síntese de DNA levando vertente. Análise de dados: A fim de medir as taxas e processivities de DNA descontrair e polimerização, as posições precisas de contas deve ser determinado. Você pode alcançá-lo pela montagem dessas posições com funções de 2-dimensional de Gauss. Trajetórias podem ser extraídas através do rastreamento posição grânulo em cada quadro usando software de rastreamento (DiaTrack por exemplo). Agora você está pronto para visualizar trajetórias traçando posição talão como uma função do tempo usando qualquer gráfico paraftware (Origin, por exemplo). Para obter dados de taxa, o ajuste das parcelas com uma regressão linear e calcular o declive. Para processabilidade, determinar o comprimento total do DNA do início ao fim de um evento de encurtamento (Figura 3). Ambos estes números terão de ser convertido em pares de bases. Para converter o movimento de contas para pares de bases, primeiro você precisa para medir o comprimento de uma molécula de DNA λ esticada na taxa de fluxo de reação. Uma vez que o comprimento do DNA λ é conhecido (48.502 bp), você pode calibrar o número de pares de base / pixel de força experimental. Para maior precisão, subtrair a partir de vestígios de interesse um traço fundamental de um corda do grânulo que não é enzimaticamente alterada. Combine todas as medições individuais e taxa de enredo e distribuições processabilidade. Ajustar os dados utilizando as funções de Gauss e single-exponencial, respectivamente (Figura 3). <img src="/files/ftp_upload/1689/1689fig1.jpg" alt="Figura 1" /> Figura 1. Molécula única configuração experimental. (A) Duplex λ DNA (48,5 kb) está ligado à superfície da célula de fluxo através da extremidade 5 &#39;de uma fita usando uma interação biotina-estreptavidina, ea extremidade 3&#39; da fita mesmo é anexado a um cordão com um digoxigenina interação anti-digoxigenina. A forquilha de replicação está ferrado, formada na extremidade oposta o talão para permitir o carregamento da polimerase. (B) Bead-DNA conjuntos são distendidos com fluxo laminar de buffer e fotografada usando de campo amplo microscopia óptica. Ao rastrear as posições das contas ao longo do tempo, mantendo uma força constante de alongamento, os comprimentos das construções de DNA pode ser monitorado. (C) perfil de Extensão da ssDNA (círculo preenchido) e dsDNA (círculo aberto) sob forças baixo. A linha tracejada mostra duração cristalográfica da plena ds-DNA λ, 16,3 mM. A grande diferença de comprimento entre ssDNA e dsDNA em forças em torno de 3 pN permite uma observação direta de conversões entre ss-dsDNA e por acompanhar as alterações no comprimento do DNA. A visualização simultânea de um grande número de DNA-coupled contas permite o estudo de muitos replisomes individuais em um experimento. <img src="/files/ftp_upload/1689/1689fig2.jpg" alt="Figura 2" /> Figura 2 proteínas Bacteriófago T7 replicação:. DNA polimerase (complexo de GP5 e thioredoxin) e DNA helicase (gp4) sintetizar fita de DNA líder na presença de desoxirribonucleótidos e magnésio. Este processo é acompanhado pelo encurtamento da cadeia de DNA em atraso devido à enrolando. Conversão de dsDNA em ssDNA muda de posição do talão. Medir posição do talão permite a determinação precisa da velocidade e processabilidade de replicação do DNA. <img src="/files/ftp_upload/1689/1689fig3.jpg" alt="Figura 3" /> Figura 3. Exemplo de dados típicos de uma única molécula-líder fio-experimento de síntese. Processabilidade da replicação do DNA é igual a um comprimento total do DNA do início ao fim de um evento de encurtamento. A taxa de replicação do DNA é obtido pela montagem do enredo com uma regressão linear e calcular o declive. A taxa mostra inset e distribuições processabilidade que foram obtidos pela combinação de dados de uma série de medições. Os dados foram equipados com funções de Gauss e single-exponencial, respectivamente.

<ol>
	<li>Lee, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+primase+acts+as+a+molecular+brake+in+DNA+replication.">DNA primase acts as a molecular brake in DNA replication.</a> Nature. 439, 621-624 (2006).</li><li>Tanner, N. A., van Oijen, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+observation+of+prokaryotic+DNA+replication.">Single-molecule observation of prokaryotic DNA replication.</a> Methods Mol Biol. 521, 397-410 (2009).</li><li>Sofia, S. J., Premnath, V. V., Merrill, E. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Poly(ethylene+oxide)+Grafted+to+Silicon+Surfaces:+Grafting+Density+and+Protein+Adsorption.">Poly(ethylene oxide) Grafted to Silicon Surfaces: Grafting Density and Protein Adsorption.</a> Macromolecules. 31, 5059-5070 (1998).</li><li>Tanner, N. A., Loparo, J. J., van Oijen, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualizing+single-molecule+DNA+replication+with+fluorescence+microscopy.">Visualizing single-molecule DNA replication with fluorescence microscopy.</a> J Vis Exp. , (2009).</li><li>Hamdan, S. M., Loparo, J. J., Takahashi, M., Richardson, C. C., van Oijen, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamics+of+DNA+replication+loops+reveal+temporal+control+of+lagging-strand+synthesis.">Dynamics of DNA replication loops reveal temporal control of lagging-strand synthesis.</a> Nature. 457, 336-339 (2009).</li><li>van Oijen, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+kinetics+of+lambda+exonuclease+reveal+base+dependence+and+dynamic+disorder.">Single-molecule kinetics of lambda exonuclease reveal base dependence and dynamic disorder.</a> Science. 301, 1235-1238 (2003).</li></ol>

É importante assegurar que a força de arrasto exercida sobre contas pelo fluxo laminar não influencia atividades enzimáticas das proteínas de replicação. Por exemplo, uma força de 3 pN que corresponde a uma vazão de 0,012 ml / min não afetam a replicação do filamento de DNA de liderança. Isto, contudo, afetar as atividades enzimáticas que ocorrem durante a síntese de DNA coordenada, e, portanto, tem que ser reduzida para 1,5 pN. A força de arrasto pode ser facilmente controlado, alterando a taxa de fluxo...

<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">	
		
		<div>
		<table border="1">
		<thead>
		<tr>
		<th>Material Name</th>
		<th>Type</th>
		<th>Company</th>
		<th>Catalogue Number</th>
		<th>Comment</th>
		</tr>
		</thead>
		<tbody>
		
<tr>
<td>Bacteriophage &lambda; DNA</td>
<td>&nbsp;</td>
<td>New England Biolabs</td>
<td>N3011L</td>
<td>&nbsp;</td>
<tr>
<td>DNA Oligonucleotides</td>
<td>&nbsp;</td>
<td>Integrated DNA Technologies</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<tr>
<td>T4 DNA Ligase</td>
<td>&nbsp;</td>
<td>New England Biolabs</td>
<td>M0202L</td>
<td>&nbsp;</td>
<tr>
<td>T4 Polynucleotide Kinase</td>
<td>&nbsp;</td>
<td>New England Biolabs</td>
<td>M0201L</td>
<td>&nbsp;</td>
<tr>
<td>&alpha;-digoxigenin Fab</td>
<td>&nbsp;</td>
<td>Roche</td>
<td>11214667001</td>
<td>&nbsp;</td>
<tr>
<td>Tosyl Activated Beads</td>
<td>&nbsp;</td>
<td>Dynal/Invitrogen</td>
<td>142-03</td>
<td>&nbsp;</td>
<tr>
<td>Magnetic Separator</td>
<td>&nbsp;</td>
<td>Invitrogen</td>
<td>Dynal MPC</td>
<td>&nbsp;</td>
<tr>
<td>3-aminopropyl-triethoxysilane</td>
<td>&nbsp;</td>
<td>Sigma</td>
<td>A3648</td>
<td>Other aminosilanes can be used or mixed with non-amine reactive silanes for sparser surfaces</td>
</tr>
<tr>
<td>Succinimidyl propionate PEG</td>
<td>&nbsp;</td>
<td>Nektar</td>
<td>&nbsp;</td>
<td>Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc.</td>
</tr>
<tr>
<td>Biotin-PEG-NHS</td>
<td>&nbsp;</td>
<td>Nektar</td>
<td>&nbsp;</td>
<td>Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc.</td>
</tr>
<tr>
<td>Double-sided tape</td>
<td>&nbsp;</td>
<td>Grace BioLabs</td>
<td>SA-S-1L</td>
<td>100 &mu;m thickness</td>
</tr>
<tr>
<td>Quartz slide</td>
<td>&nbsp;</td>
<td>Technical Glass</td>
<td>20 mm (W)x 50 mm (L)x 1mm (H)</td>
<td>Size to fit on coverslips. Drill holes with diamond-tip drill bits (DiamondBurs.net)</td>
</tr>
<tr>
<td>Polyethylene tubing</td>
<td>&nbsp;</td>
<td>Becton Dickinson</td>
<td>427416</td>
<td>0.76 mm ID, 1.22 OD 
Other size tubing can be substituted.</td>
</tr>
<tr>
<td>Streptavidin</td>
<td>&nbsp;</td>
<td>Sigma</td>
<td>S4762</td>
<td>Make 1 mg/mL solution, 25 &mu;L aliquots in PBS pH 7.3</td>
</tr>
<tr>
<td>Deoxyribonucleotide triphosphate solution mix</td>
<td>&nbsp;</td>
<td>New England Biolabs</td>
<td>N0447</td>
<td>&nbsp;</td>
<tr>
<td>Inverted Optical Microscope with 10X Objective</td>
<td>&nbsp;</td>
<td>Olympus</td>
<td>Olympus IX-51</td>
<td>&nbsp;</td>
<tr>
<td>Permament rare-earth magnet</td>
<td>&nbsp;</td>
<td>National Imports</td>
<td>www.rare-earth-magnets.com</td>
<td>&nbsp;</td>
<tr>
<td>CCD Camera</td>
<td>&nbsp;</td>
<td>QImaging</td>
<td>Rolera-XR Fast 139</td>
<td>&nbsp;</td>
<tr>
<td>Syringe Pump</td>
<td>&nbsp;</td>
<td>Harvard Apparatus</td>
<td>11 Plus</td>
<td>Operate in refill mode to facilitate solution changes</td>
</tr>
<tr>
<td>Fiber Illuminator</td>
<td>&nbsp;</td>
<td>Thorlabs Inc.</td>
<td>OSL1</td>
<td>&nbsp;</td>		</tbody>
		</table>
		</div>

direct observation of enzymes replicating dna using a single-molecule dna stretching assay

Nós descrevemos um método para observar a replicação em tempo real de moléculas de DNA individual mediada por proteínas do sistema de replicação bacteriófago. Linearizada λ DNA é modificada para ter um biotina na extremidade de um fio, e uma porção digoxigenina na outra extremidade do fio mesmo. O fim biotinilado é anexado a uma lamela de vidro funcionalizadas eo fim digoxigeninated para uma pequena pérola. A montagem destas amarras DNA-pérola sobre a superfície de uma célula de fluxo permite um fluxo laminar para ser aplicado a exercer uma força de arrasto na esfera. Como resultado, o DNA é esticada próximo e paralelo à superfície da lamínula, a uma força que é determinado pela taxa de fluxo (Figura 1). O comprimento do DNA é medida através do monitoramento da posição do talão. Diferenças de comprimento entre o DNA de um único e double-stranded são utilizados para obter informações em tempo real sobre a atividade das proteínas de replicação na bifurcação. Medir a posição do talão permite a determinação precisa das taxas e processivities de DNA descontrair e polimerização (Figura 2).

Watch this Scientific Journal Video about Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay at JoVE.com

Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay

Nós descrevemos um método para observar a replicação em tempo real de moléculas de DNA individual mediada por proteínas do sistema de replicação bacteriófago.

A observação direta de Enzimas DNA Replicação Usando um DNA molécula única Alongamento Assay

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system. ...

direct-observation-enzymes-replicating-dna-using-single-molecule-dna

Research

JoVE Journal

Biology

18.6K visualizações.  Harvard Medical School. Nós descrevemos um método para observar a replicação em tempo real de moléculas de DNA individual mediada por proteínas do sistema de replicação bacteriófago.

Vídeo: Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay

Visualizing Single-molecule DNA Replication with Fluorescence Microscopy

We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA template is attached to a functionalized glass coverslip and replicated extensively after introduction of replication proteins and nucleotides (Figure 1). The growing product double-strand DNA (dsDNA) is extended with laminar flow and visualized by using an intercalating dye. Measuring the position of the growing DNA end in real time allows precise determination of replication rate (Figure 2). Furthermore, the length of completed DNA products reports on the processivity of replication. This experiment can be performed very easily and rapidly and requires only a fluorescence microscope with a reasonably sensitive camera.


This protocol demonstrates a simple single-molecule fluorescence microscopy technique for visualizing DNA replication by individual replisomes in real time.

Replicação de DNA visualizar Único molécula com microscopia de fluorescência

We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA ...

Biologia

DNA Stable-Isotope Probing (DNA-SIP)

DNA stable-isotope probing (DNA-SIP) is a powerful technique for identifying active microorganisms that assimilate particular carbon substrates and nutrients into cellular biomass. As such, this cultivation-independent technique has been an important methodology for assigning metabolic function to the diverse communities inhabiting a wide range of terrestrial and aquatic environments. Following the incubation of an environmental sample with stable-isotope labelled compounds, extracted nucleic acid is subjected to density gradient ultracentrifugation and subsequent gradient fractionation to separate nucleic acids of differing densities. Purification of DNA from cesium chloride retrieves labelled and unlabelled DNA for subsequent molecular characterization (e.g. fingerprinting, microarrays, clone libraries, metagenomics). This JoVE video protocol provides visual step-by-step explanations of the protocol for density gradient ultracentrifugation, gradient fractionation and recovery of labelled DNA. The protocol also includes sample SIP data and highlights important tips and cautions that must be considered to ensure a successful DNA-SIP analysis.

DNA Stable-Isotope Probing DNA-SIP

DNA stable-isotope probing is a cultivation-independent method to identify and characterize active communities of microorganisms that are capable of utilizing specific substrates. Assimilation of substrate enriched in heavy isotope leads to incorporation of labelled atoms into microbial biomass. Density gradient ultracentrifugation retrieves labelled DNA for downstream molecular analyses.

DNA-Stable Isotope Probing (DNA-SIP)

DNA stable-isotope probing (DNA-SIP) is a powerful technique for identifying active microorganisms that assimilate particular carbon substrates and ...

Generation of RNA/DNA Hybrids in Genomic DNA by Transformation using RNA-containing Oligonucleotides

Synthetic short nucleic acid polymers, oligonucleotides (oligos), are the most functional and widespread tools of molecular biology. Oligos can be produced to contain any desired DNA or RNA sequence and can be prepared to include a wide variety of base and sugar modifications. Moreover, oligos can be designed to mimic specific nucleic acid alterations and thus, can serve as important tools to investigate effects of DNA damage and mechanisms of repair. We found that Thermo Scientific Dharmacon RNA-containing oligos with a length between 50 and 80 nucleotides can be particularly suitable to study, in vivo, functions and consequences of chromosomal RNA/DNA hybrids and of ribonucleotides embedded into DNA. RNA/DNA hybrids can readily form during DNA replication, repair and transcription, however, very little is known about the stability of RNA/DNA hybrids in cells and to which extent these hybrids can affect the genetic integrity of cells. RNA-containing oligos, therefore, represent a perfect vector to introduce ribonucleotides into chromosomal DNA and generate RNA/DNA hybrids of chosen length and base composition. Here we present the protocol for the incorporation of ribonucleotides into the genome of the eukaryotic model system yeast /Saccharomyces cerevisiae/. Yet, our lab has utilized Thermo Scientific Dharmacon RNA-containing oligos to generate RNA/DNA hybrids at the chromosomal level in different cell systems, from bacteria to human cells.

This work shows how to form an RNA/DNA hybrid at the chromosomal level and reveal transfer of genetic information from RNA to genomic DNA in yeast cells.

Geração de RNA / DNA híbrido em DNA genômico por transformação por meio de RNA contendo Oligonucleotídeos

Synthetic short nucleic acid polymers, oligonucleotides (oligos), are the most functional and widespread tools of molecular biology. Oligos can be ...

Visualization of DNA Replication in the Vertebrate Model System DT40 using the DNA Fiber Technique

Maintenance of replication fork stability is of utmost importance for dividing cells to preserve viability and prevent disease. The processes involved not only ensure faithful genome duplication in the face of endogenous and exogenous DNA damage but also prevent genomic instability, a recognized causative factor in tumor development.
Here, we describe a simple and cost-effective fluorescence microscopy-based method to visualize DNA replication in the avian B-cell line DT40. This cell line provides a powerful tool to investigate protein function in vivo by reverse genetics in vertebrate cells1. DNA fiber fluorography in DT40 cells lacking a specific gene allows one to elucidate the function of this gene product in DNA replication and genome stability. Traditional methods to analyze replication fork dynamics in vertebrate cells rely on measuring the overall rate of DNA synthesis in a population of pulse-labeled cells. This is a quantitative approach and does not allow for qualitative analysis of parameters that influence DNA synthesis. In contrast, the rate of movement of active forks can be followed directly when using the DNA fiber technique2-4. In this approach, nascent DNA is labeled in vivo by incorporation of halogenated nucleotides (Fig 1A). Subsequently, individual fibers are stretched onto a microscope slide, and the labeled DNA replication tracts are stained with specific antibodies and visualized by fluorescence microscopy (Fig 1B). Initiation of replication as well as fork directionality is determined by the consecutive use of two differently modified analogues. Furthermore, the dual-labeling approach allows for quantitative analysis of parameters that influence DNA synthesis during the S-phase, i.e. replication structures such as ongoing and stalled forks, replication origin density as well as fork terminations. Finally, the experimental procedure can be accomplished within a day, and requires only general laboratory equipment and a fluorescence microscope.

DT40, a model vertebrate genetic system, provides a powerful tool to analyze protein function. Here we describe a simple method that allows qualitative analysis of parameters that influence DNA synthesis during the S-phase in DT40 cells at the single molecule level.

Visualização de replicação de DNA no DT40 Vertebrados Modelo de Sistema utilizando a técnica de DNA Fibra

Maintenance of replication fork stability is of utmost importance for dividing cells to preserve viability and prevent disease. The processes involved not ...

Preparation of DNA-crosslinked Polyacrylamide Hydrogels

Mechanobiology is an emerging scientific area that addresses the critical role of physical cues in directing cell morphology and function. For example, the effect of tissue elasticity on cell function is a major area of mechanobiology research because tissue stiffness modulates with disease, development, and injury. Static tissue-mimicking materials, or materials that cannot alter stiffness once cells are plated, are predominately used to investigate the effects of tissue stiffness on cell functions. While information gathered from static studies is valuable, these studies are not indicative of the dynamic nature of the cellular microenvironment in vivo. To better address the effects of dynamic stiffness on cell function, we developed a DNA-crosslinked polyacrylamide hydrogel system (DNA gels). Unlike other dynamic substrates, DNA gels have the ability to decrease or increase in stiffness after fabrication without stimuli. DNA gels consist of DNA crosslinks that are polymerized into a polyacrylamide backbone. Adding and removing crosslinks via delivery of single-stranded DNA allows temporal, spatial, and reversible control of gel elasticity. We have shown in previous reports that dynamic modulation of DNA gel elasticity influences fibroblast and neuron behavior. In this report and video, we provide a schematic that describes the DNA gel crosslinking mechanisms and step-by-step instructions on the preparation DNA gels.

Our laboratory has developed DNA-crosslinked polyacrylamide hydrogels, a dynamic hydrogel system, to better understand the effects of modulating tissue stiffness on cell function. Here, we provide schematics, descriptions, and protocols to prepare these hydrogels.

Preparação de ADN de poliacrilamida reticulada-hidrogéis

Mechanobiology is an emerging scientific area that addresses the critical role of physical cues in directing cell morphology and function. For example, ...

Combining Single-molecule Manipulation and Imaging for the Study of Protein-DNA Interactions

The paper describes the combination of optical tweezers and single molecule fluorescence detection for the study of protein-DNA interaction. The method offers the opportunity of investigating interactions occurring in solution (thus avoiding problems due to closeby surfaces as in other single molecule methods), controlling the DNA extension and tracking interaction dynamics as a function of both mechanical parameters and DNA sequence. The methods for establishing successful optical trapping and nanometer localization of single molecules are illustrated. We illustrate the experimental conditions allowing the study of interaction of lactose repressor (lacI), labeled with Atto532, with a DNA molecule containing specific target sequences (operators) for LacI binding. The method allows the observation of specific interactions at the operators, as well as one-dimensional diffusion of the protein during the process of target search. The method is broadly applicable to the study of protein-DNA interactions but also to molecular motors, where control of the tension applied to the partner track polymer (for example actin or microtubules) is desirable.

Here we describe the instrumentation and methods for detecting single fluorescently-labeled protein molecules interacting with a single DNA molecule suspended between two optically trapped microspheres.

Combinando uma única molécula de Manipulação e imagem para o estudo das interações proteína-DNA

The paper describes the combination of optical tweezers and single molecule fluorescence detection for the study of protein-DNA interaction. The method ...

Real-time Imaging of Single Engineered RNA Transcripts in Living Cells Using Ratiometric Bimolecular Beacons

The growing realization that both the temporal and spatial regulation of gene expression can have important consequences on cell function has led to the development of diverse techniques to visualize individual RNA transcripts in single living cells. One promising technique that has recently been described utilizes an oligonucleotide-based optical probe, ratiometric bimolecular beacon (RBMB), to detect RNA transcripts that were engineered to contain at least four tandem repeats of the RBMB target sequence in the 3&#8217;-untranslated region. RBMBs are specifically designed to emit a bright fluorescent signal upon hybridization to complementary RNA, but otherwise remain quenched. The use of a synthetic probe in this approach allows photostable, red-shifted, and highly emissive organic dyes to be used for imaging. Binding of multiple RBMBs to the engineered RNA transcripts results in discrete fluorescence spots when viewed under a wide-field fluorescent microscope. Consequently, the movement of individual RNA transcripts can be readily visualized in real-time by taking a time series of fluorescent images. Here we describe the preparation and purification of RBMBs, delivery into cells by microporation and live-cell imaging of single RNA transcripts.

Ratiometric bimolecular beacons (RBMBs) can be used to image single engineered RNA transcripts in living cells. Here, we describe the preparation and purification of RBMBs, delivery of RBMBs into cells by microporation and fluorescent imaging of single RNA transcripts in real-time.

Imagens em tempo real de uma única Engineered RNA transcritos em células vivas usando raciométrica Bimolecular Beacons

The growing realization that both the temporal and spatial regulation of gene expression can have important consequences on cell function has led to the ...

Studying DNA Looping by Single-Molecule FRET

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA.

This study presents a detailed experimental procedure to measure looping dynamics of double-stranded DNA using single-molecule Fluorescence Resonance Energy Transfer (FRET). The protocol also describes how to extract the looping probability density called the J factor.

Estudar DNA Looping por Single-Molecule FRET

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into ...

Reduced-gravity Environment Hardware Demonstrations of a Prototype Miniaturized Flow Cytometer and Companion Microfluidic Mixing Technology

Until recently, astronaut blood samples were collected in-flight, transported to earth on the Space Shuttle, and analyzed in terrestrial laboratories. If humans are to travel beyond low Earth orbit, a transition towards space-ready, point-of-care (POC) testing is required. Such testing needs to be comprehensive, easy to perform in a reduced-gravity environment, and unaffected by the stresses of launch and spaceflight. Countless POC devices have been developed to mimic laboratory scale counterparts, but most have narrow applications and few have demonstrable use in an in-flight, reduced-gravity environment. In fact, demonstrations of biomedical diagnostics in reduced gravity are limited altogether, making component choice and certain logistical challenges difficult to approach when seeking to test new technology. To help fill the void, we are presenting a modular method for the construction and operation of a prototype blood diagnostic device and its associated parabolic flight test rig that meet the standards for flight-testing onboard a parabolic flight, reduced-gravity aircraft. The method first focuses on rig assembly for in-flight, reduced-gravity testing of a flow cytometer and a companion microfluidic mixing chip. Components are adaptable to other designs and some custom components, such as a microvolume sample loader and the micromixer may be of particular interest. The method then shifts focus to flight preparation, by offering guidelines and suggestions to prepare for a successful flight test with regard to user training, development of a standard operating procedure (SOP), and other issues. Finally, in-flight experimental procedures specific to our demonstrations are described.

Spaceflight blood diagnostics need innovation. Few demonstrations have been published illustrating in-flight, reduced-gravity health diagnostic technology. Here we present a method for construction and operation of a parabolic flight test rig for a prototype point-of-care flow-cytometry design, with components and preparation strategies adaptable to other setups.

De gravidade reduzida Manifestações ambiente de hardware de uma tecnologia de mistura de fluxo Cytometer e Companion microfluídicos Prototype Miniaturized

Until recently, astronaut blood samples were collected in-flight, transported to earth on the Space Shuttle, and analyzed in terrestrial laboratories. If ...

A Proteoliposome-Based Efflux Assay to Determine Single-molecule Properties of Cl- Channels and Transporters

The last 15 years have been characterized by an explosion in the ability to overexpress and purify membrane proteins from prokaryotic organisms as well as from eukaryotes. This increase has been largely driven by the successful push to obtain structural information on membrane proteins. However, the ability to functionally interrogate these proteins has not advanced at the same rate and is often limited to qualitative assays of limited quantitative value, thereby limiting the mechanistic insights that they can provide. An assay to quantitatively investigate the transport activity of reconstituted Cl- channels or transporters is described. The assay is based on the measure of the efflux rate of Cl- from proteoliposomes following the addition of the K+ ionophore valinomycin to shunt the membrane potential. An ion sensitive electrode is used to follow the time-course of ion efflux from proteoliposomes reconstituted with the desired protein. The method is highly suited for mechanistic studies, as it allows for the quantitative determination of key properties of the reconstituted protein, such as its unitary transport rate, the fraction of active protein and the molecular mass of the functional unit. The assay can also be utilized to determine the effect of small molecule compounds that directly inhibit/activate the reconstituted protein, as well as to test the modulatory effects of the membrane composition or lipid-modifying reagents. Where possible, direct comparison between results obtained using this method were found to be in good agreement with those obtained using electrophysiological approaches. The technique is illustrated using CLC-ec1, a CLC-type H+/Cl- exchanger, as a model system. The efflux assay can be utilized to study any Cl- conducting channel/transporter and, with minimal changes, can be adapted to study any ion-transporting protein.

A Proteoliposome-Based Efflux Assay to Determine Single-molecule Properties of Cl- Channels and Transporters

Proteoliposomes are used to study purified channels and transporters reconstituted in a well-defined biochemical environment. An experimental procedure to measure efflux mediated by these proteins is illustrated. The steps to prepare proteoliposomes, perform the recordings, and analyze data to quantitatively determine the functional properties of the reconstituted protein are described.

A proteolipossoma-Based Efluxo Ensaio para determinar as propriedades de uma única molécula de Cl<sup&gt; -</sup&gt; Canais e Transportadores

The last 15 years have been characterized by an explosion in the ability to overexpress and purify membrane proteins from prokaryotic organisms as well as ...