Somos gratos a Gianni Scimone para assistência excelente, com tomada de vídeo.

Manipulação de amostras de sangue contaminado pelo HIV requer algumas recomendações importantes. Todas as amostras de sangue devem ser transportados em robusta contentores estanques. É preciso ter cuidado ao coletar a amostra para evitar a contaminação do exterior do container e de qualquer documentação que acompanha a amostra. Todas as pessoas de processamento de sangue infectados devem usar luvas. As luvas devem ser mudadas e as mãos lavadas após a conclusão do processamento das amostras. Processamento de amostras de sangue infectado pelo HIV deve ser feito em uma capa de gabinete classe II de risco biológico. Mecânicos auxiliares de pipetagem deve ser usado. Uso de agulhas ou outros instrumentos cortantes (incluindo por exemplo, pipetas de vidro ou tubos capilares) deve ser limitada a situações em que não há alternativa. Superfícies de laboratório devem ser descontaminados com um desinfectante químico apropriado após um derramamento de sangue e quando as atividades são concluídas. Materiais contaminados utilizados devem ser descontaminados antes de reutilizar ou deve ser eliminado de forma correcta por via de resíduos hospitalares. Cada incidente sobre a exposição ocupacional a sangue ou fluidos potencialmente infectantes (ou seja, aqueles que requerem precauções universais) deve ser tratada como uma emergência médica, as intervenções devem ser iniciadas imediatamente para ser eficaz. O protocolo exige cinco dias para sua conclusão. O prazo é detalhado na Figura 1. Espécies bacterianas são identificados usando os métodos descritos na Figura 2. 1. Coleta de Amostras <ol><li> 9 ml de sangue total é desenhada em tubos contendo EDTA. </li><li> Os tubos são centrifugados a 2000 rpm por 10 minutos a RT para obter plasma. </li><li> O plasma é coletado em um 2 ml estéril Eppendorf-tubo. </li></ol> 2. Extração de DNA de amostras de plasma <ol><li> Desinfectar adequadamente capô, pipetas e materiais necessários para o experimento, a fim de garantir a esterilidade. </li><li> Posição de todos os materiais sob luzes UV por pelo menos 30 minutos. </li><li> Limpe as luvas com um desinfectante. </li><li> Molhe um papel toalha poucos em etanol e colocá-los sob o capô. Cada vez que uma dica é descartado limpe a pipeta sobre as toalhas de papel molhado. </li></ol> DNA é extraído usando um kit comercial, seguindo as instruções do fabricante (Easy-DNA Kit, Invitrogen, Carlsbad CA, EUA). <ol start="5"><li> 350 uL de plasma são colocados em um tubo eppendorf estéril de 2ml. </li><li> 350 mL de água ultrapura filtrados são usados ​​como controle negativo. </li><li> Adicionar 10 mL de lisozima (1mg/ml) com as amostras. </li><li> Incubar por 30 minutos a 37 ° C. </li><li> Adicione 500 ml de solução de Lise e misture delicadamente com as amostras. </li><li> Incubar durante 7 minutos a 65 ° C. </li><li> Adicionar 900 mL de clorofórmio para as amostras. </li><li> Vortex vigorosamente até que as amostras são uniformemente viscosa. </li><li> Adicione 200 ml de solução-precipitação e vortex vigorosamente. </li><li> Centrifugar as amostras a 10.500 rpm por 10 minutos a RT para separar as fases e formam a interface. </li><li> Transferir a fase superior aquosa para um tubo de microcentrífuga fresco contendo 1 ml de etanol 100%. </li><li> Centrifugar as amostras a 10.500 rpm por 10 minutos a 4 ° C. </li><li> Remover o etanol. </li><li> Adicionar 1 ml de etanol 70%. </li><li> Centrifugar amostras na velocidade máxima por 10 minutos a 4 ° C. </li><li> Remover o etanol. O etanol residual deve ser removida com uma pipettator. </li><li> Ressuspender o sedimento em 50 mL de água ultrapura. </li><li> Leia concentração de DNA com um espectrofotômetro. </li></ol> 3. Gene 16S rRNA PCR Amplificação por PCR é realizado como descrito anteriormente 9. <ol><li> Amplificar DNA em uma mistura de reação de 100 L com 10 mL de tampão PCR 10X, 5 mL de 25 mM MgCl2, 5 mL de 2 mM dNTPs total, 1 mL de 50 mM de primer RW01 (AACTGGAGGAAGGTGGGGAT), 1 mL de 50 mM de primer DG74 (AGGAGGTGATCCAACCGCA), 34 mL de H20 e 0,5 mL de Taq polimerase (AmpliTaq Gold, Applied Biosystem, Foster City, CA, EUA). </li><li> Transfira a mistura da PCR em filtros para evitar possível contaminação por Taq polimerase bacteriana. </li><li> Filtros de centrifugação (microcontrolador, Millipore, Billerica, MA, EUA) por 30 minutos a 500 rcf a 4 ° C. </li><li> Mix alíquota do PCR de acordo com o número de amostras que precisam ser amplificados (controles positivos e negativos de PCR, amostras de água e extraído). </li><li> Use as seguintes condições termociclador: 94 ° C por 10 minutos, 40 vezes por 1 minuto cada vez que a 94 ° C, 55 ° C e 72 ° C e 10 min a 72 ° C. </li><li> Visualize o produto da PCR em um gel de agarose 2%. Use 100 bp DNA ladder. PCR tamanho do produto é de aproximadamente 360 ​​pb (Figura 3). </li></ol> 4. PCR Purification produto Só PCR amostras positivas devem ser purificada. Purificação é realizada utilizandoinstruções de um fabricante de kit de seguir comercial (PureLink PCR MICROKIT, Invitrogen, Carlsbad CA, EUA). <ol><li> Adicionar 4 volumes de tampão de ligação contendo isopropanol por um volume de produto da PCR. </li><li> Transferência de produto de PCR com tampão de ligação a uma coluna. </li><li> Centrifugar por 1 minuto a 10,000 rcf na RT. </li><li> Lavar coluna com tampão de lavagem contendo etanol. </li><li> Centrifugar por 1 minuto a 10,000 rcf na RT. </li><li> Centrifugar a velocidade máxima durante 1 minuto a RT para secar a membrana de sílica e remover qualquer tampão de lavagem residual com etanol. </li><li> Adicionar 10 mL de água ultrapura. </li><li> Incubar por 1 minuto à temperatura ambiente. </li><li> Centrifugar a velocidade máxima por 2 minutos em temperatura ambiente para coletar o DNA purificado. </li></ol> 5. Clonagem Lisogenia Caldo (LB) Preparação da placa <ol><li> Dissolver 25 gr de mistura LB em aproximadamente 800 ml de água. </li><li> Trazer o volume final para 1 L. </li><li> Adicionar 15 gr de Bactoagar. </li><li> Autoclave por 20 minutos. </li><li> Após autoclavagem, vigorosamente redemoinho da solução no frasco para misturar agar derretido. </li><li> Arrefecer a solução à 50 ° C. </li><li> Adicionar Ampicilina (50 mg / ml) e agite até que se dissolva. </li><li> Preparar placas a uma profundidade de aproximadamente 3mm. </li><li> Deixar as placas em temperatura ambiente. </li><li> Spread X-Gal (40mg/ml) e IPTG (100 mM) em cada placa LB e incubar a 37 ° C até que esteja pronto para uso. </li></ol> Transformação de células competentes Transformação é feita usando instruções de um fabricante de kit de seguir comercial (Topo TA cloning kit, Invitrogen, Carlsbad CA, EUA). <ol><li> Prepare a mistura de reacção clonagem (1-4 mL do produto da PCR fresco, 1 mL de solução salina, 1 mL do vetor e água se necessário). </li><li> Mistura de reacção gentilmente e incubar por 5-10 minutos em temperatura ambiente. </li><li> Coloque a reação no gelo. </li><li> Adicione 2 mL da reação de clonagem em um frasco de células competentes e misture delicadamente. </li><li> Incubar no gelo por 30 minutos. </li><li> De choque térmico as células por 30 segundos a 42 ° C. </li><li> Transferir imediatamente o tubo em gelo. </li><li> Adicionar 250 mL de meio. </li><li> Tampe o tubo e agitar tighly o tubo horizontalmente a 37 ° C por 1 hora. </li><li> Spread 50 mL de cada transformação em uma placa pré-aquecida seletivo. </li><li> Incubar durante a 37 ° C. </li></ol> Após a incubação, colônias brancas e azuis se desenvolvem em placas. Colônias brancas são positivos para PCR de inserção de produtos e colônias azuis são negativas para a PCR de inserção do produto. 6. Análise de seqüenciamento Reação de sequenciamento <ol><li> A mistura é feita com estes reagentes: 2,5 mL de DNA, uma cartilha mL (5pmol / mL) 1,1 mL Big Dye (Applied Biosystem, Foster City, CA, EUA). </li><li> Condições térmicas cycler: 96 ° C por 1 minuto, 25 vezes para 96 ​​° C por 10 segundos, 55 ° C por 15 segundos e 60 ° C por 4 min. </li></ol> Purificação coluna <ol><li> Para cada reação, prepare uma coluna MicroSpin (Qiagen, Milan, Itália). </li><li> Inverter coluna e vórtice de mistura de resina. </li><li> Pressão fora da parte inferior da coluna, afrouxe a tampa ¼ de volta, e coloque em uma coluna de tubo de microcentrífuga. </li><li> Centrífuga 3200 rpm por 1 minuto. </li><li> Transferência de coluna para um tubo de microcentrífuga limpo. </li><li> Pipeta cuidadosamente a reação de seqüenciamento toda PCR para o centro da coluna. </li><li> Centrífuga 3200 rpm por 1 minuto. </li><li> DNA purificado vai eluite no tubo (20 l de água ultrapura). </li></ol> Análise de seqüenciamento <ol><li> Carregar a amostra purificada (20 l) em 96 com vários poços da placa. </li><li> Carregue a placa para o seqüenciador. Sequenciadores de DNA automatizados gerar um cromatograma de quatro cores mostrando os resultados da execução do seqüenciamento. </li><li> De entrada a seqüência de nucleotídeos como uma consulta nos bancos de dados seqüência de público. A pesquisa é realizada nas bases de dados NCBI e servidores, com a ferramenta de pesquisa local Alinhamento Básico (BLAST). </li><li> Considere as bactérias apenas com homologias 98-100%. </li></ol> 7. Resultados representante <img src="/files/ftp_upload/2830/2830fig1.jpg" alt="Figura 1" /> Figura 1. Timeline do procedimento. <img src="/files/ftp_upload/2830/2830fig2.jpg" alt="Figura 2" /> Figura 2. Fluxogramas dos processo de identificação bacteriana inteira. <img src="/files/ftp_upload/2830/2830fig3.jpg" alt="Figura 3" /> Figura 3. Gel agarose 2% mostrando 16S rRNA gene ampla gama de produtos PCR. Raia 1 contém uma escada de DNA 100bp, pista 2 contém o controle de PCR positiva, pista 3 mostra o controle PCR negativo. Faixa 4 mostra as amostras de um paciente HIV-positivo, e lane 5 contém água. Faixa 6 shows amostras de um indivíduo saudável e uma reação de PCR negativo; lane 7 contém água. Somente os pacientes HIV positivos exibe uma amplificação PCR positivo. Água ultrapura utilizada como controle negativo durante a etapa de extração, indica que nenhuma contaminação ocorreu. <img src="/files/ftp_upload/2830/2830fig4.jpg" alt="Figura 4" /> Figura 4. Gel 0,7% agarose mostrando plasmídeo extraído com o procedimento miniprep. Raia 1 contém um 1 escada de DNA kilobase, pista 2 contém a colônia de controle azul, faixas de 3 a 12 contêm colônias brancas. O plasmídeo da colônia azul não contém a bula do produto da PCR. Todas as 10 colônias brancas contêm plasmídeo com a inserção correta. <img src="/files/ftp_upload/2830/2830fig5.jpg" alt="Figura 5" /> Figura 5. Mostra um exemplo de análise de seqüenciamento de bactérias no plasma de um indivíduo HIV-positivo. Nossos resultados mostram que a translocação microbiana em HIV doença envolve uma flora polimicrobic, que não é visto em HIV-negativos assuntos, sugerindo falha substancial de imunidade intestinal no controle da translocação bacteriana.

<ol>
	<li>Hooper, L. V., Macpherson, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+adaptations+that+maintain+homeostasis+with+the+intestinal+microbiota.">Immune adaptations that maintain homeostasis with the intestinal microbiota.</a> Nat Rev Immunol. 10, 159-169 (2010).</li><li>Macpherson, A. J., Harris, N. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactions+between+commensal+intestinal+bacteria+and+the+immune+system.">Interactions between commensal intestinal bacteria and the immune system.</a> Nat Rev Immunol. 4, 478-485 (2004).</li><li>Kanauchi, O., Mitsuyama, K., Araki, Y., Andoh, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modification+of+intestinal+flora+in+the+treatment+of+inflammatory+bowel+disease.">Modification of intestinal flora in the treatment of inflammatory bowel disease.</a> Curr Pharm Des. 9, 333-346 (2003).</li><li>Brenchley, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+translocation+is+a+cause+of+systemic+immune+activation+in+chronic+HIV+infection.">Microbial translocation is a cause of systemic immune activation in chronic HIV infection.</a> Nat Med. 12, 1365-1371 (2006).</li><li>Brenchley, J. M., Price, D. A., Douek, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HIV+disease:+fallout+from+a+mucosal+catastrophe.">HIV disease: fallout from a mucosal catastrophe.</a> Nat Immunol. 7, 235-239 (2006).</li><li>Jiang, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasma+levels+of+bacterial+DNA+correlate+with+immune+activation+and+the+magnitude+of+immune+restoration+in+persons+with+antiretroviral-treated+HIV+infection.">Plasma levels of bacterial DNA correlate with immune activation and the magnitude of immune restoration in persons with antiretroviral-treated HIV infection.</a> J Infect Dis. 199, 1177-1185 (2009).</li><li>Marchetti, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+translocation+is+associated+with+sustained+failure+in+CD4++T-cell+reconstitution+in+HIV-infected+patients+on+long-term+highly+active+antiretroviral+therapy.">Microbial translocation is associated with sustained failure in CD4+ T-cell reconstitution in HIV-infected patients on long-term highly active antiretroviral therapy.</a> AIDS. 22, 2035-2038 (2008).</li><li>Marchetti, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+Microbial+Translocation+and+Immune+Hyperactivation+in+Disease+Progression+of+HIV++Patients+with+Preserved+CD4+Count+in+the+Absence+of+ART.">Role of Microbial Translocation and Immune Hyperactivation in Disease Progression of HIV+ Patients with Preserved CD4 Count in the Absence of ART.</a> , (2010).</li><li>Greisen, K., Loeffelholz, M., Purohit, A., Leong, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR+primers+and+probes+for+the+16S+rRNA+gene+of+most+species+of+pathogenic+bacteria,+including+bacteria+found+in+cerebrospinal+fluid.">PCR primers and probes for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria found in cerebrospinal fluid.</a> J Clin Microbiol. 32, 335-351 (1994).</li></ol>

Não há conflitos de interesse declarados.

<p class="jove_content"&gt; Vimos por este meio mostrar um protocolo de PCR / seqüenciamento para caracterizar a translocação de bactérias no sangue periférico de indivíduos infectados pelo HIV.</p&gt;<p class="jove_content"&gt; Resultados mais confiáveis ​​são obtidos quando se utiliza plasma coletadas em tubos contendo EDTA. Após coleta de sangue, plasma deve ser separado por centrifugação dentro de 03/02 horas, para evitar hemólise e degradação fragmento de DNA. As amostras são armazenadas primeiro em -20 ° C por aproxima...

<table border="1"><tbody><tr><th> Nome do reagente </th><th> Companhia </th><th> Número Catálogo </th><th> Comentários (opcional) </th></tr><tr><td> Easty DNA-Kit </td><td> Invitrogen </td><td> K 180001 </td><td></td></tr><tr><td> Clorofórmio </td><td> Sigma-Aldrich </td><td> C2432 </td><td></td></tr><tr><td> Etanol </td><td> Sigma-Aldrich </td><td> E7203 </td><td></td><tr/><tr><td> UltraPure Waer </td><td> Invitrogen </td><td> 10977049 </td><td></td></tr><tr><td> Lisozima </td><td> Fluka </td><td> 62970 </td><td> 10 mcg / mL em água destilada </td></tr><tr><td> AmpliTaq Gold </td><td> Applied Biosystem </td><td> 26478701 </td><td></td></tr><tr><td> Microcontrolador 100 </td><td> Millipore </td><td> 42413 </td><td></td></tr><tr><td> PCR </td><td> Invitrogen </td><td></td><td></td></tr><tr><td> Agarose </td><td> Eppendorf </td><td> C1343 </td><td></td></tr><tr><td> Escada de DNA </td><td> Invitrogen </td><td> 15628019 </td><td></td></tr><tr><td> Purelink PCR micro kit </td><td> Invitrogen </td><td> K310050 </td><td></td></tr><tr><td> LB Agar em pó, </td><td> Invitrogen </td><td> 22700025 </td><td></td></tr><tr><td> Bactoagar </td><td> Invitrogen </td><td></td><td></td></tr><tr><td> Ampicilina </td><td> Invitrogen </td><td> 11593027 </td><td> 10 mg / mL em água destilada </td></tr><tr><td> X-gal </td><td> Invitrogen </td><td> 15520034 </td><td> 40mg/ml em DMF </td></tr><tr><td> IPTG </td><td> Invitrogen </td><td> 15529019 </td><td> 100mM em água destilada </td></tr><tr><td> Topo TA cloning kit </td><td> Invitrogen </td><td> K450002 </td><td></td></tr><tr><td> Purelink rápida kit Miniprep Plasmid </td><td> Invitrogen </td><td> K210010 </td><td></td></tr><tr><td> Big dye </td><td> Applied Biosystem </td><td> 4337455 </td><td></td></tr><tr><td> DyeEx 2,0 spin-kit </td><td> Qiagen </td><td> 63204 </td><td></td></tr></tbody></table>

sequencing of bacterial microflora in peripheral blood: our experience with hiv-infected patients

O trato gastrointestinal saudável é fisiologicamente colonizada por uma grande variedade de micróbios comensais que influenciam o desenvolvimento do sistema 1,2 humoral e celular imune da mucosa. Microbiota é protegido do sistema imunológico através de uma forte barreira mucosa. Infecções e antibióticos são conhecidos por alterar tanto a barreira do trato gastrointestinal normal ea composição das bactérias residentes, o que pode resultar em possíveis alterações imunológicas 3. HIV causa uma brecha na barreira gastrointestinal com insuficiência progressiva da imunidade da mucosa e vazamento para a circulação sistêmica de bioprodutos bacteriana, como lipopolissacarídeos e fragmentos de DNA de bactérias, que contribuem para a ativação imune sistêmica 4-7. Translocação microbiana está implicado em HIV / AIDS imunopatogênese e resposta à terapia 4,8. Nosso objetivo foi caracterizar a composição de bactérias translocação no sangue periférico de pacientes infectados pelo HIV. A perseguir o nosso objectivo é criar uma reação de PCR para o gene 16S panbacteric ribosomial seguido por uma análise de seqüenciamento. Resumidamente, o sangue total de ambos os sujeitos infectados pelo HIV e saudável é usado. Dado que os indivíduos saudáveis ​​apresentam homeostase intestinal normal não translocação de microflora é esperado nesses pacientes. Após a colheita de sangue total por punção venosa e separação do plasma, o DNA é extraído do plasma e usado para executar uma ampla gama reação de PCR para o gene 16S panbacteric ribosomial 9. Análises de purificação seguinte produto PCR, clonagem e sequenciamento são executadas.

Watch this Scientific Journal Video about Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients at JoVE.com

Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients

Nossa experiência vai mostrar como realizar uma análise de seqüenciamento de translocação de espécies bacterianas no sangue periférico de pacientes HIV positivos.

Seqüenciamento da microflora bacteriana no sangue periférico: a nossa experiência com pacientes infectados pelo HIV

The healthy gastrointestinal tract is physiologically colonized by a large variety of commensal microbes that influence the development 
	of the humoral ...

sequencing-bacterial-microflora-peripheral-blood-our-experience-with

Research

JoVE Journal

Medicine

12.2K visualizações.  San Paolo Hospital University of Milan, Italy. Nossa experiência vai mostrar como realizar uma análise de seqüenciamento de translocação de espécies bacterianas no sangue periférico de pacientes HIV positivos.

Vídeo: Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients

Modeling Intracerebral Hemorrhage in Mice: Injection of Autologous Blood or Bacterial Collagenase

Spontaneous intracerebral hemorrhage (ICH) defines a potentially life-threatening neurological malady that accounts for 10-15% of all stroke-related hospitalizations and for which no effective treatments are available to date1,2. Because of the heterogeneity of ICH in humans, various preclinical models are needed to thoroughly explore prospective therapeutic strategies3. Experimental ICH is commonly induced in rodents by intraparenchymal injection of either autologous blood or bacterial collagenase4. The appropriate model is selected based on the pathophysiology of hemorrhage induction and injury progression. The blood injection model mimics a rapidly progressing hemorrhage. Alternatively, bacterial collagenase enzymatically disrupts the basal lamina of brain capillaries, causing an active bleed that generally evolves over several hours5. Resultant perihematomal edema and neurofunctional deficits can be quantified from both models. In this study, we described and evaluated a modified double injection model of autologous whole blood6 as well as an ICH injection model of bacterial collagenase7, both of which target the basal ganglia (corpus striatum) of male CD-1 mice. We assessed neurofunctional deficits and brain edema at 24 and 72 hr after ICH induction. Intrastriatal injection of autologous blood (30 &mu;l) or bacterial collagenase (0.075U) caused reproducible neurofunctional deficits in mice and significantly increased brain edema at 24 and 72 hr after surgery (p&lt;0.05). In conclusion, both models yield consistent hemorrhagic infarcts and represent basic methods for preclinical ICH research.

Clinically relevant animal models of intracerebral hemorrhage (ICH) are needed to extend our knowledge of hemorrhagic stroke and to examine novel therapeutic strategies. In this study, we describe and evaluate two ICH models that implement unilateral injections of either autologous whole blood or bacterial collagenase into the basal ganglia (corpus striatum) of mice.

Hemorragia modelagem intracerebral em camundongos: Injeção de sangue autólogo ou colagenase bacteriana

Spontaneous intracerebral hemorrhage (ICH) defines a potentially life-threatening neurological malady that accounts for 10-15% of all stroke-related ...

Medicina

Measuring Frailty in HIV-infected Individuals. Identification of Frail Patients is the First Step to Amelioration and Reversal of Frailty

A simple, validated protocol consisting of a battery of tests is available to identify elderly patients with frailty syndrome. This syndrome of decreased reserve and resistance to stressors increases in incidence with increasing age. In the elderly, frailty may pursue a step-wise loss of function from non-frail to pre-frail to frail. We studied frailty in HIV-infected patients and found that ~20% are frail using the Fried phenotype using stringent criteria developed for the elderly1,2. In HIV infection the syndrome occurs at a younger age.
HIV patients were checked for 1) unintentional weight loss; 2) slowness as determined by walking speed; 3) weakness as measured by a grip dynamometer; 4) exhaustion by responses to a depression scale; and 5) low physical activity was determined by assessing kilocalories expended in a week's time. Pre-frailty was present with any two of five criteria and frailty was present if any three of the five criteria were abnormal.
The tests take approximately 10-15 min to complete and they can be performed by medical assistants during routine clinic visits. Test results are scored by referring to standard tables. Understanding which of the five components contribute to frailty in an individual patient can allow the clinician to address relevant underlying problems, many of which are not evident in routine HIV clinic visits.

Frailty syndrome is commonly seen in the aged and reflects multi-system physiological change. However, with reduced functional reserve and resilience frailty is also known to be common in the HIV infected population. This study outlined an easily administered screening test to identify HIV patients with frailty. When significant components of frailty are identified, clinicians will be able to focus on amelioration of the problem and promote reversion to the pre-frail state.

Medindo fragilidade em indivíduos infectados pelo HIV. Identificação de pacientes frágeis é o primeiro passo para a Melhoria e Reversão de fragilidade

A simple, validated protocol consisting of a battery of tests is available to identify elderly patients with frailty syndrome. This syndrome of decreased ...

Computerized Dynamic Posturography for Postural Control Assessment in Patients with Intermittent Claudication

Computerized dynamic posturography with the EquiTest is an objective technique for measuring postural strategies under challenging static and dynamic conditions. As part of a diagnostic assessment, the early detection of postural deficits is important so that appropriate and targeted interventions can be prescribed. The Sensory Organization Test (SOT) on the EquiTest determines an individual&#39;s use of the sensory systems (somatosensory, visual, and vestibular) that are responsible for postural control. Somatosensory and visual input are altered by the calibrated sway-referenced support surface and visual surround, which move in the anterior-posterior direction in response to the individual&#39;s postural sway. This creates a conflicting sensory experience. The Motor Control Test (MCT) challenges postural control by creating unexpected postural disturbances in the form of backwards and forwards translations. The translations are graded in magnitude and the time to recover from the perturbation is computed.
Intermittent claudication, the most common symptom of peripheral arterial disease, is characterized by a cramping pain in the lower limbs and caused by muscle ischemia secondary to reduced blood flow to working muscles during physical exertion. Claudicants often display poor balance, making them susceptible to falls and activity avoidance. The Ankle Brachial Pressure Index (ABPI) is a noninvasive method for indicating the presence of peripheral arterial disease and intermittent claudication, a common symptom in the lower extremities. ABPI is measured as the highest systolic pressure from either the dorsalis pedis or posterior tibial artery divided by the highest brachial artery systolic pressure from either arm. This paper will focus on the use of computerized dynamic posturography in the assessment of balance in claudicants.

Individuals with intermittent claudication exhibit poor balance compared to healthy controls. Computerized dynamic posturography is an objective method for measuring an individual's postural responses to balance disturbances. This provides an objective reflection of the person&#x2019;s ability to respond to situations under which sensory stimuli are altered and unexpected perturbations occur.

Posturografia Dinâmica Computadorizada para Avaliação do controle postural em pacientes com claudicação intermitente

Computerized dynamic posturography with the EquiTest is an objective technique for measuring postural strategies under challenging static and dynamic ...

Assessment of Vascular Function in Patients With Chronic Kidney Disease

Patients with chronic kidney disease (CKD) have significantly increased risk of cardiovascular disease (CVD) compared to the general population, and this is only partially explained by traditional CVD risk factors. Vascular dysfunction is an important non-traditional risk factor, characterized by vascular endothelial dysfunction (most commonly assessed as impaired endothelium-dependent dilation [EDD]) and stiffening of the large elastic arteries. While various techniques exist to assess EDD and large elastic artery stiffness, the most commonly used are brachial artery flow-mediated dilation (FMDBA) and aortic pulse-wave velocity (aPWV), respectively. Both of these noninvasive measures of vascular dysfunction are independent predictors of future cardiovascular events in patients with and without kidney disease. Patients with CKD demonstrate both impaired FMDBA, and increased aPWV. While the exact mechanisms by which vascular dysfunction develops in CKD are incompletely understood, increased oxidative stress and a subsequent reduction in nitric oxide (NO) bioavailability are important contributors. Cellular changes in oxidative stress can be assessed by collecting vascular endothelial cells from the antecubital vein and measuring protein expression of markers of oxidative stress using immunofluorescence. We provide here a discussion of these methods to measure FMDBA, aPWV, and vascular endothelial cell protein expression.

The degree of vascular dysfunction and contributing physiological mechanisms can be assessed in patients with chronic kidney disease by measuring brachial artery flow-mediated dilation, aortic pulse-wave velocity, and vascular endothelial cell protein expression.

Avaliação da função vascular em pacientes com doença renal crônica

Patients with chronic kidney disease (CKD) have significantly increased risk of cardiovascular disease (CVD) compared to the general population, and this ...

Orthotopic Implantation and Peripheral Immune Cell Monitoring in the II-45 Syngeneic Rat Mesothelioma Model

The enormous upsurge of interest in immune-based treatments for cancer such as vaccines and immune checkpoint inhibitors, and increased understanding of the role of the tumor microenvironment in treatment response, collectively point to the need for immune-competent orthotopic models for pre-clinical testing of these new therapies. This paper demonstrates how to establish an orthotopic immune-competent rat model of pleural malignant mesothelioma. Monitoring disease progression in orthotopic models is confounded by the internal location of the tumors. To longitudinally monitor disease progression and its effect on circulating immune cells in this and other rat models of cancer, a single tube flow cytometry assay requiring only 25 &#181;l whole blood is described. This provides accurate quantification of seven immune parameters: total lymphocytes, monocytes and neutrophils, as well as the T-cell subsets CD4 and CD8, B-cells and Natural Killer cells. Different subsets of these parameters are useful in different circumstances and models, with the neutrophil to lymphocyte ratio having the greatest utility for monitoring disease progression in the mesothelioma model. Analyzing circulating immune cell levels using this single tube method may also assist in monitoring the response to immune-based treatments and understanding the underlying mechanisms leading to success or failure of treatment.

The generation of an orthotopic rat model of pleural malignant mesothelioma by implantation of II-45 mesothelioma cells into the pleural cavity of immune competent rats is presented. A flow cytometric method to analyze seven immune cell subsets in these animals from a 25 &#181;l&#160;blood sample is also described.

Orthotopic Implantação e Acompanhamento Peripheral Imune celular no Modelo II-45 Rat Singênico mesotelioma

The enormous upsurge of interest in immune-based treatments for cancer such as vaccines and immune checkpoint inhibitors, and increased understanding of ...

Endotoxin Activity Assay for the Detection of Whole Blood Endotoxemia in Critically Ill Patients

Lipopolysaccharide, also known as endotoxin, is a fundamental component of gram-negative bacteria and plays a crucial role in the development of sepsis and septic shock. The early identification of an infectious process that is rapidly evolving to a critical illness might prompt a quicker and more intensive treatment, thereby potentially leading to better patient outcomes. The Endotoxin Activity (EA) assay can be used at the bedside as a reliable biomarker of systemic endotoxemia. The detection of elevated endotoxin activity levels has been repeatedly shown to be associated with an increased disease severity in patients with sepsis and septic shock. The assay is quick and easy to perform. Briefly, after sampling, an aliquot of whole blood is mixed with an anti-endotoxin antibody and with added LPS. Endotoxin activity is measured as the relative oxidative burst of primed neutrophils as detected by chemioluminescence. The assay&#39;s output is expressed on a scale from 0 (absent) to 1 (maximal) and categorized as &#8220;low&#8221; (&#60;0.4 units), &#8220;intermediate&#8221; (0.4&#8211;0.59 units), or &#8220;high&#8221; (&#8805;0.6 units). The detailed methodology and rationale for the implementation of the EA assay are reported in this manuscript.

We hereby present a protocol to measure at the bedside the endotoxin activity of human whole blood samples. The Endotoxin Activity assay is a simple test to perform and may be a useful biomarker in critically ill patients with sepsis.

Ensaio da atividade da endotoxina para a deteção do endotoxemia do sangue inteiro em pacientes criticamente doentes

Lipopolysaccharide, also known as endotoxin, is a fundamental component of gram-negative bacteria and plays a crucial role in the development of sepsis ...

Digital Handwriting Analysis of Characters in Chinese Patients with Mild Cognitive Impairment

An increasing amount of evidence shows that cognitive deficits and movement dysfunctions are not separated. Patients with mild cognitive impairment (MCI) can manifest fine motor disorders of the upper extremities. Handwriting is a complex and unique human activity involving both motor and cognitive coordination. Researchers from western countries have discovered that patients with MCI have abnormal handwriting features. However, no relevant studies have been conducted in the Chinese population. Owing to the cross-culture phenomenon of handwriting, the aim of this study is to find new handwriting tasks to demonstrate the differences in handwriting features between elderly patients with MCI and age-matched healthy individuals.

This study proposed a digital handwriting analysis of characters in individuals with mild cognitive impairment to find more information than is revealed by traditional pencil&#8211;paper handwriting analysis.

Análise de Caligrafia Digital de Personagens em Pacientes Chineses com Prejuízo Cognitivo Leve

An increasing amount of evidence shows that cognitive deficits and movement dysfunctions are not separated. Patients with mild cognitive impairment (MCI) ...

Fertility Preservation in Patients with Severe Ovarian Dysfunction

Ovarian function progressively declines during aging and in some pathophysiological conditions including karyotype abnormality, autoimmune diseases, chemo- and radiation-therapies, as well as ovarian surgeries. In unmarried women with severe ovarian dysfunction, fertility preservation is important for future pregnancies. Although oocyte cryopreservation is an established method for fertility preservation, these patients could only preserve a limited number of oocytes even after ovarian hyperstimulation, leading to repeated stimulations to ensure sufficient oocytes to guarantee future pregnancy. To solve this issue, we have recently developed a drug-free in vitro activation (IVA) procedure, which enable us to stimulate early stages of ovarian follicles to develop to the preantral follicle stage. These preantral follicles can respond to the unique protocol of gonadotropin stimulation, resulting in increased number of retrieved oocytes per ovarian stimulation for cryopreservation. The drug-free IVA comprised from the surgical approach and ovarian stimulation. We removed a part of cortex from one or both ovaries from patients under laparoscopic surgery. The ovarian cortical tissues were cut into small cubes to disrupt the Hippo signaling pathway and stimulate the development of early stage follicles. These cubes were grafted orthotropically into remaining ovaries as well as beneath the serosa of both Fallopian tubes. We have already published the surgical procedure of the drug-free IVA and the protocol of subsequent ovarian stimulation, but herein we present the details of laboratory methods required for drug-free IVA.

We present details of laboratory procedures for drug-free in vitro activation (IVA) of ovarian follicles for patients with severe ovarian dysfunction. This method could increase the number of retrievable oocytes per ovarian hyperstimulation and benefit fertility preservation for those patients.

Preservação da fertilidade em pacientes com disfunção ovariana grave

Ovarian function progressively declines during aging and in some pathophysiological conditions including karyotype abnormality, autoimmune diseases, ...

Evaluation of a Point-of-Care Testing Analyzer for Measuring Peripheral Blood Leukocytes

White blood cell (WBC) is an important indicator of inflammation in the body, and it can help distinguish between bacterial and viral infections. At present, most primary medical institutions in China have a poor percentage of adoption of blood-testing technology, and a hematology detection system with a high price to performance ratio and easy operation is urgently needed in primary healthcare centers. This paper introduces the principle and operation procedures of a point-of-care testing (POCT) card-based leukocyte analyzer (evaluated system), which was used to detect WBC indexes such as neutrophils, lymphocytes, and intermediate group cells (including eosinophils, basophils, and monocytes) in whole blood. The results from the evaluated system were compared to those from two commercial automatic hematology analyzers (reference system). The correlation and consistency between the evaluated system and the commercial reference systems were analyzed. The results showed that WBC count and number of granulocytes detected by the evaluated and reference systems showed a strong positive correlation (rs = 0.972 and 0.973, respectively), while the number of lymphocytes showed a relatively low correlation (rs = 0.851). A Bland-Altman plot showed that the major difference between the values detected by the evaluated system and the reference systems is within 95% limits of agreement (LoA), indicating that the two systems are in good agreement. In conclusion, the evaluated system has an excellent correlation, robust consistency, and a reliable comparison with the results of the widely used automatic hematology analyzers. It is ideal for WBC detection in primary medical institutions where a full-automatic five-category hematology analyzer is unavailable, especially during the COVID-19 normalized prevention and control period.

A protocol to measure peripheral blood leukocytes using a POCT card-based leukocyte analyzer is presented here. Same blood samples were tested by two automated hematology analyzers to evaluate the consistency and accuracy of the results. The results showed that the evaluated analyzer had a good correlation with the reference system.

Avaliação de um analisador de teste de ponto de cuidado para medir leucócitos sanguíneos periféricos

White blood cell (WBC) is an important indicator of inflammation in the body, and it can help distinguish between bacterial and viral infections. At ...

Cox-Maze IV Procedure Concomitant with Valvular Surgery In Situs Inversus Dextrocardia: A Single-Center Experience in China

Atrial fibrillation (AF) is the most common cardiac arrhythmia. The use of ablation technologies made the Cox-Maze IV procedure (CMP-IV) technically easier, faster, becoming the gold standard for the surgical treatment of AF. However, the efficacy and safety of CMP-IV in situs inversus dextrocardia are largely unknown. This paper summarizes the CMP-IV procedure performed concomitantly with valvular surgery in patients with situs inversus dextrocardia at this institution.
From February 2016 to September 2020, three dextrocardia patients with persistent AF and valvular diseases were referred to this institution for valvular and CMP-IV surgery. CMP-IV was performed using either cryoablation with a nitrous oxide (N2O)-based cryoprobe or a bipolar radiofrequency clamp and bipolar radiofrequency pen. Mechanical valve replacement or mitral vavuloplasty was performed in another patient in addition to tricuspid annuloplasty. Transmurality of the ablated atrial tissues was evaluated by electron microscopy. Heart function was assessed by transthoracic echocardiography. Cardiac rhythm was monitored by 24 h Holter at 3, 6, 12, 18, 24, and 48 months follow-up. 
All the AF was successfully eliminated in the ablation procedure without recurrence or other complications during hospitalization. The mean bypass and crossclamp times were similar in all the patients. The postoperative ventilator support time, the duration of stay in the ICU, and postoperative residence time were also not significantly different among the patients. Transmural atrial necrosis was detected in the ablated atrial tissues. Sinus rhythm maintenance was achieved at 3, 6, 12, 18, 24, and 48 months follow-up in all the patients. All valve protheses switched freely; no tricuspid regurgitation was observed. The results of the present study demonstrate that the CMP-IV is safe and effective in eliminating AF in dextrocardia patients concomitant with valvular surgery.

We summarize the Cox-Maze IV procedure concomitant with valvular surgery performed in patients with situs inversus dextrocardia at this institution.

Procedimento Cox-Maze IV Concomitante com Cirurgia Valvular In Situs Inversus Dextrocardia: Uma Experiência de Centro Único na China

Atrial fibrillation (AF) is the most common cardiac arrhythmia. The use of ablation technologies made the Cox-Maze IV procedure (CMP-IV) technically ...