Agradecemos Gordon Freeman para fornecer o anticorpo bloqueador anti-PD-L1. Agradecemos ao pessoal clínico e laboratorial no Hospital Geral de Massachusetts e de todos os participantes do estudo para o seu papel inestimável neste projeto. Este estudo foi financiado pelo Instituto Nacional de Alergia e Doenças Infecciosas dos Institutos Nacionais de Saúde (PO1 AI-080192; DEK), o National Heart Lung and Blood Institute dos Institutos Nacionais de Saúde (RO1 HL-092565; DEK). DEK é apoiado por uma Research Scholar Award Carreira do Fundo de Pesquisa em Saúde Quebec (FRQS). FP é apoiado por uma bolsa comunhão do Massachusetts General Hospital Comitê Executivo de Investigação e do Instituto de Saúde Global de Harvard (HGHI).

1. A exaustão e Isolamento de PBMC através Ficoll Separação <ol><li> Depleção das células T CD8 + por adição de células CD8 + humano Esgotamento cocktail de 50 ul / ml de sangue total. </li><li> Misturar bem e incubar durante 20 min à temperatura ambiente (18-25 ° C). </li><li> Depois de incubação, misturam sangue total com HBSS (Solução Salina Equilibrada de Hank sem Ca 2 + ou Mg 2 +) e camada sobre Histopaque. Gire a 340 rcf durante 30 min (sem freio, aceleração lenta). </li><li> Recolhe PBMC e transferir para um novo cónica 50ml. Lavar 2x com 45 ml de RPMI 1640 suplementado com 50 UI de penicilina, 50 ug / ml de estreptomicina, 2 mM de L-glutamina, e 1% de HEPES por centrifugação durante 10 min a 340 rcf. </li></ol> 2. Bloqueio de Anticorpos e estimulação antigênica específica das células <ol><li> Ressuspender as células em 2x10 6 por estado em meio RPMI 1640 contendo 10% de soro humano, suplementado com 50 UI de penicilina, 50 ug / ml de estreptomicina, 2 mM de L-glutamina, e 1% de HEPES,representando 500 ul por condição. </li><li> Alíquota de 500 ul de suspensão de células por tubo de FACS. </li><li> Dependendo da via de investigados, adicionar PD-L1, IL-10Rα anticorpos de bloqueio e / ou controlos de isotipo de 10 ug / ml e incubar durante 15 min a 37 ° C, 5% de CO 2. </li><li> Estimular as células com um conjunto de peptídeos de HIV-1 Gag a 1 ug / ml / péptido concentração final. Também incluem um controle &quot;nenhum estímulo&quot; para cada condição de bloqueio. Incubar a 37 ° C, 5% de CO 2 durante 48 horas. </li></ol> 3. Coleta e análise de sobrenadante <ol><li> Após 48 horas, girar tubos de FACS para 7 min a 340 rcf. </li><li> Cuidadosamente recolher 2 x 225 mL de sobrenadante em tubos Eppendorf para Luminex matrizes talão sem perturbar o sedimento. </li><li> Inactivar vírus no sobrenadante com 25 uL de 0,5% de PBS-Tween para obter uma concentração final de 0,05% de PBS-Tween. </li><li> Armazene coletadas sobrenadantes que não são immediately utilizado numa -80 ° C congelador. </li><li> Medir as concentrações de citocinas desejados usando kit Millipore Luminex acordo com o protocolo do fabricante. </li></ol> 4. Coleta e análise fenotípica das células através de Citometria de Fluxo <ol><li> Após recolha do sobrenadante, lavagem de células, em 3 ml de PBS. Gire células por 7 min a 340 rcf e decantar o excesso de lavagem. </li><li> Mancha para a viabilidade utilizando um Kit Stain celular Morto VIVO / MORTO fixável de acordo com o protocolo do fabricante. </li><li> Lavar as células em PBS durante 7 min a 340 rcf e a 4 ° C. Ressuspender em 100 ul de PBS, 1% de FBS. </li><li> Se coloração para monócitos ou outras células apresentadoras de antígenos, receptores Fc bloco adicionando 1,4 mL de reagente de bloqueio e FcR vórtice para misturar. </li><li> Incubar durante 10 minutos a 4 ° C. </li><li> Adicionar anticorpos de superfície, vórtice, e incubar durante 20 min a 4 ° C no escuro. </li><li> Lavar as células com PBS, 1% de FBS, decanta-se o excesso de lavagem, e adiciona-se 200 ul de paraformaldeido a 4%. Incubarà temperatura ambiente durante 20 min no escuro. </li><li> Lave as células com PBS 1% FBS, ressuspender em 250 mL PBS 1% FBS, e adquirir em uma Multilaser citômetro de fluxo (por exemplo, BD LSRII ou Fortessa). </li></ol> 5. A análise das células por meio de qRT-PCR <ol><li> Para as células não analisados ​​via citometria de fluxo: após a coleta do sobrenadante, as células lisam em 300 mL RLT Qiagen tampão contendo 1% de beta-mercaptoetanol. Se não continuar com o protocolo, as células podem ser congeladas a -80 ° C após este ponto. </li><li> Isolar ARN utilizando um kit de isolamento de ARN seguindo o protocolo do fabricante. </li><li> Sintetizar ADNc a partir de ARN usando um kit de síntese de cDNA, seguindo o protocolo do fabricante. </li><li> Realizar PCR quantitativa utilizando a tecnologia de SYBR Green. </li><li> Criar uma mistura de iniciadores para cada um dos iniciadores utilizados, incluindo genes de manutenção (por exemplo, IL-13, IL-10, IFN-γ, GAPDH) por adição de iniciadores a nucleases-livre de água para se obter uma concentração final de 10iM. Mantenha no gelo. </li><li> Criar um master mix para cada primer, adicionando 10,5 mL de água livre de nuclease, 12,5 mL SYBR verde, e 1 ml mistura de iniciadores por placa também. Mantenha no gelo. </li><li> Pipetar 24 ul de mistura principal em cada poço da placa que vai ser usado. </li><li> Adicionar 1 mL de cDNA para cada poço de acordo com modelo. </li><li> Tampe poços e placa de centrifugação por 3 min a 800 rcf. </li><li> Executar placa em uma máquina de qRT-PCR, por exemplo, um instrumento Stratagene Mx3005P. </li></ol> 6. Adaptação para o intracelular de citocinas Coloração em 48 horas Adicionar Brefeldina A monensina e 6 horas antes da coloração de citocinas intracelulares. Brefeldina é adicionado a uma concentração de 10 ug / ml, enquanto a monensina é adicionado de acordo com as instruções do fabricante. Por conveniência, Brefeldina pode ser adicionado 12 h antes de manchar a uma concentração de 5 ug / ml. <ol><li> Depois de mancha de superfície, lavar as células com PBS 1% FBS e mancha nocitocinas intracelular, tais como a IL-12, IFN-γ, e TNF-α usando um kit de fixação / Solução permeabilização e protocolo. </li><li> Lave as células, ressuspender em 250 mL PBS 1% FBS, e executado em um multilaser citômetro de fluxo (por exemplo, BD LSR II ou Fortessa). </li></ol> 7. Adaptação para Classificando Células <ol><li> 16 horas após a estimulação, mancha de viabilidade utilizando Kit Stain celular Morto VIVO / MORTO fixável de acordo com o protocolo do fabricante. Manter as células em gelo durante todo o procedimento. </li><li> Lavar as células com PBS, durante 7 min a 340 rcf e a 4 ° C. Ressuspender em 100 ul de PBS, 1% de FBS. </li><li> Adicionar anticorpos de superfície, vortex para misturar e incubar as células em gelo, no escuro, durante 20 min. </li><li> Lavar as células com PBS, 1% de FBS a 340 rcf e a 4 ° C e ressuspender em 500 ul de meio RPMI 1640 frio contendo 10% de soro fetal bovino, suplementado com 50 UI de penicilina, 50 ug / ml de estreptomicina, 2 mM de L-glutamina, e 1% HEPES. </li><li> Células do filtro com 5 ml poliestirenorene tubo de fundo redondo com tampa de Cell-filtro. </li><li> Preparar os tubos de recolha para classificar por adição de 200 ul de meio RPMI 1640 contendo 10% de soro fetal bovino, suplementado com 50 UI de penicilina, 50 ug / ml de estreptomicina, 2 mM de L-glutamina, e 1% de HEPES a cada tubo. Mantenha todos os tubos em gelo durante a classificação. </li><li> Vivo classificar os subconjuntos de células de interesse em um instrumento (por exemplo, BD FACS Aria II), localizado em uma instalação equipada para material de risco biológico. </li><li> Após as células foram classificadas, as células lugar de volta na incubadora por período de tempo desejado e seguir com a análise coleção sobrenadante / Luminex e análise coleção pellet celular / PCR. </li></ol>

<ol>
	<li>Zajac, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+immune+evasion+due+to+persistence+of+activated+T+cells+without+effector+function.">Viral immune evasion due to persistence of activated T cells without effector function.</a> J. Exp. Med. 188, 2205-2213 (1998).</li><li>Wherry, E. J., Blattman, J. N., Murali-Krishna, K., vander Most, R., Ahmed, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+persistence+alters+CD8+T-cell+immunodominance+and+tissue+distribution+and+results+in+distinct+stages+of+functional+impairment.">Viral persistence alters CD8 T-cell immunodominance and tissue distribution and results in distinct stages of functional impairment.</a> J. Virol. 77, 4911-4927 (2003).</li><li>Kwon, D. S., Kaufmann, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protective+and+detrimental+roles+of+IL-10+in+HIV+pathogenesis.">Protective and detrimental roles of IL-10 in HIV pathogenesis.</a> Eur. Cytokine Netw. 21, 208-214 (2010).</li><li>Porichis, F., Kaufmann, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+PD-1+in+HIV+pathogenesis+and+as+target+for+therapy.">Role of PD-1 in HIV pathogenesis and as target for therapy.</a> Curr. HIV/AIDS Rep. 9, 81-90 (2012).</li><li>Wherry, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T+cell+exhaustion.">T cell exhaustion.</a> Nat. 12, 492-499 (2011).</li><li>Trautmann, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Upregulation+of+PD-1+expression+on+HIV-specific+CD8++T+cells+leads+to+reversible+immune+dysfunction.">Upregulation of PD-1 expression on HIV-specific CD8+ T cells leads to reversible immune dysfunction.</a> Nat. Med. 12, 1198-1202 (2006).</li><li>Day, C. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PD-1+expression+on+HIV-specific+T+cells+is+associated+with+T-cell+exhaustion+and+disease+progression.">PD-1 expression on HIV-specific T cells is associated with T-cell exhaustion and disease progression.</a> Nature. 443, 350-354 (2006).</li><li>Brockman, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IL-10+is+up-regulated+in+multiple+cell+types+during+viremic+HIV+infection+and+reversibly+inhibits+virus-specific+T+cells.">IL-10 is up-regulated in multiple cell types during viremic HIV infection and reversibly inhibits virus-specific T cells.</a> Blood. 114, 346-356 (2009).</li><li>Barber, D. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Restoring+function+in+exhausted+CD8+T+cells+during+chronic+viral+infection.">Restoring function in exhausted CD8 T cells during chronic viral infection.</a> Nature. 439, 682-687 (2006).</li><li>Zhang, J. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PD-1+up-regulation+is+correlated+with+HIV-specific+memory+CD8++T-cell+exhaustion+in+typical+progressors+but+not+in+long-term+nonprogressors.">PD-1 up-regulation is correlated with HIV-specific memory CD8+ T-cell exhaustion in typical progressors but not in long-term nonprogressors.</a> Blood. 109, 4671-4678 (2007).</li><li>Ndhlovu, Z. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-dimensional+immunomonitoring+models+of+HIV-1-specific+CD8+T-cell+responses+accurately+identify+subjects+achieving+spontaneous+viral+control.">High-dimensional immunomonitoring models of HIV-1-specific CD8 T-cell responses accurately identify subjects achieving spontaneous viral control.</a> Blood. 121, 801-811 (2013).</li><li>Porichis, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Responsiveness+of+HIV-specific+CD4+T+cells+to+PD-1+blockade.">Responsiveness of HIV-specific CD4 T cells to PD-1 blockade.</a> Blood. 118, 965-974 (2011).</li><li>Kwon, D. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD4++CD25++regulatory+T+cells+impair+HIV-1-specific+CD4+T+cell+responses+by+upregulating+interleukin-10+production+in+monocytes.">CD4+ CD25+ regulatory T cells impair HIV-1-specific CD4 T cell responses by upregulating interleukin-10 production in monocytes.</a> 86, 6586-6594 (2012).</li></ol>

Os autores declaram que não têm interesses financeiros concorrentes.

Coleção sobrenadante é uma parte fundamental deste projeto experimental. Quando a colher os sobrenadantes para o ensaio de Luminex, as alíquotas foram feitos e mantidos a -80 ° C para evitar a degradação das proteínas devido a ciclos de congelação-descongelação. Congelamento e descongelamento pode ser processos duras para proteínas e minimizando congelar-degelo, o sinal será maximizado em ensaios. Portanto, é mais fácil obter dados repetitivo e mais precisa quando se trabalha a partir de aliquotas que fo...

Durante infecções virais persistentes, as células-T específicos do vírus adquirir defeitos funcionais em um processo conhecido como T exaustão celular. No início de estudos in vivo no modelo murino de LCMV infecção viral crônica indicaram que as células específicas do vírus exaustos T reduziram função citolítica contra as células infectadas por vírus, perdem a capacidade de proliferar e ter a sua capacidade reduzida para produzir citocinas como IL-2, TNF- α e IFN-γ 1,2. Uma rede complexa de vias imunoreguladores, tais como DP-1 e IL-10, são regulados positivamente durante infecções crónicas e contribuem para a disfunção de células T (revisto em 3,4). Administração in vivo de anticorpos bloqueadores contra estas vias inibitórias no rato LCMV função das células específicas do vírus exaustos T e depuração viral reforçada modelo restaurado, indicando que células T exaustão é um fenômeno parcialmente reversível (revisto em 5). Achados no the modelo LCMV foram rapidamente estendido para infecções virais crônicas humanas, tais como HBV, HCV e HIV 5. Na infecção crónica pelo HIV-1, DP-1 e IL-10 são as vias regulada em indivíduos infectados e correlacionam com os parâmetros de progressão da doença, directamente com a carga viral e inversamente com a contagem de CD4 6-8. Anticorpo bloqueio dos PD-1 ou IL-10 in vitro vias restaurada a proliferação de células T CD4 e CD8 específicas para o HIV, indicando que, tal como o modelo de rato de LCMV, t exaustão de células em seres humanos é um fenómeno é totalmente reversível. No entanto, devido à natureza delicada de experimentos em amostras humanas, bem como limitações na sensibilidade dos ensaios in vitro, investigação completa dos perfis de restauração funcionais obtidos por essas intervenções é notavelmente ausente. Ensaios de proliferação têm sido, até agora, a única no ensaio confiável vitro testado na maioria dos estudos, ainda não há uma notável falta de evidências sobre o impacto dessas interintervenções em: 1) a capacidade de morte de células T citotóxicas, 2) o efeito antiviral de células T na replicação viral, 3) o perfil de secreção de citoquinas, e 4) o efeito sobre a ajuda das células T CD4 + em outros subconjuntos de células. Citocina coloração intracelular (ICS) é um fluxo muito útil e amplamente utilizado o ensaio baseado citometria que é usado para detectar a produção de citocinas em vários tipos de células em ambos os ratos e os seres humanos. Também tem sido utilizada para investigar o efeito de anticorpos de bloqueio de vias inibitórias. Em ensaios de ICS, a secreção de citocinas é bloqueada pela adição de Brefeldina e / ou monensina. Citocinas presos no interior das células são, então, detectados com anticorpos fluorescentes utilizando citometria de fluxo policromática. A duração do ensaio é normalmente limitada a 6 ou 12 horas após a estimulação de antigénio e uma vez que ambos Brefeldina A monensina, que são tipicamente adicionados a cerca de 2 horas de adição de antigénio, são tóxicos para as células. O ensaio ICS é uma técnica poderosa que tem sido útil in o estudo sobre o efeito da administração in vivo de bloqueio intervenção anticorpo em ratinhos em que as células foram extraídas após um certo período de tempo após a exposição ao anticorpo 9. No entanto, há várias limitações para a aplicação desta abordagem experimental para avaliar o impacto do bloqueamento dos receptores inibitórios em amostras humanas. Ao realizar as intervenções de anticorpos de vias inibitórias em um estimulação de 6 ou 12 horas in vitro (tipicamente o caso com amostras humanas), o bloqueio dos receptores inibitórios na maioria dos casos, não altera a frequência de resposta de células T específicas de antigénio, como medida por ensaios padrão ICS 6, 7. Medidas de produção por célula de citocinas, medidas pela intensidade média ou mediana de fluorescência deram resultados inconsistentes 6, 7, 10. Por outro lado, quando o ICS é realizada a um ponto final de tempo após a estimulação (isto é, seis dias), as alterações no número de secretoras de citocinas cvaras podem ser observados. As diferenças são um efeito combinado da proliferação alterada, a sobrevivência, e alterações na função efetora que se acumulam ao longo do período de tempo especificado 6. Uma maneira de superar parcialmente estas limitações é a incubar durante mais longos períodos de tempo (por exemplo, 36 hr, 60 hr, etc.) Com o antigénio antes da adição do bloqueador de secreção de citoquinas, sem esperar pela proliferação de ocorrer. Nós utilizamos com sucesso este método para determinar a cinética da secreção de citoquinas por células T CD4 e CD8 específicas para o HIV 11,12; no entanto, esta abordagem não é capaz de detectar pequenas respostas e não dará um resultado integrado da secreção total de citocina ocorrendo dado que a estimulação. Portanto, o ICS não é um método sensível para detectar o impacto de bloqueio de vias inibitórias sobre a quantidade de citoquinas produzidas por células T activadas em comparação com citocina quantificação de ARNm ou medições da secreção de citocinas no supernatant no mesmo intervalo de tempo. Além disso, a maioria das citocinas produzidas por células T activadas agir de maneira autócrina ao contribuir para o feedback positivo ou negativo circula através da interacção com as células apresentadoras de antigénios. Portanto, a adição de Brefeldina A monensina ou durante o ensaio ICS impede a secreção de citocinas e, assim, a estimulação de células T não é óptima. Finalmente, a detecção de várias citocinas com o ICS é limitada pela disponibilidade e sensibilidade dos anticorpos para a detecção de citocinas com citometria de fluxo, bem como por limitações no número de fluorocromos que podem ser utilizados em simultâneo, em qualquer dado painel. Desenvolvemos uma abordagem experimental in vitro, altamente sensível para avaliar o impacto de vias imunorreguladores na regulação da secreção de citoquinas por células T CD4 + específicas para o HIV e subsequentemente auxílio de CD4 de células apresentadoras de antígenos (APCs) e células assassinas naturais (células NK). Este método também pode ser utilizado para avaliar o impact do bloqueio de moléculas inibidoras sobre a função das células T CD8 por esgotar as células T CD4 de PBMC ou estimulando com peptídeos ideais que são reconhecidos apenas por células T CD8. Em contraste com os ensaios de coloração de citocinas intracelulares, decidimos não interferir com a secreção de citoquinas por células T CD4 + específicas para o HIV, a fim de ser capaz de: 1) realizar uma quantificação mais precisa dos níveis de citocinas produzidos, 2) investigar um painel mais alargado de citocinas ou moléculas efectoras, e 3) avaliar o impacto de citoquinas produzidos por células específicas para o HIV T CD4 em outros subconjuntos de células. Nós estimular CD8 PBMC esgotadas com um HIV-1 Gag conjunto de peptídeos na presença de anticorpos bloqueadores da via imunorregulador de interesse. Após o tempo desejado de incubação, geralmente 48 horas, coletamos os sobrenadantes para medir a secreção de citocinas com matrizes de contas e recolher as pelotas de células, quer para análise fenotípica das diferentes subpopulações de células ou para a análise da transcrição. De nota, em tseu ponto 48 hr tempo, nós não detectar uma população significativa de proliferação de células T 12. Esta é uma abordagem flexível e várias adaptações deste projeto pode ser aplicado para analisar as diferentes hipóteses. Por exemplo, os subconjuntos de células individuais (tais como as células T CD4 + específicas para o HIV ou DP-1 de células T CD4 elevadas, etc.) Podem ser classificados após 12 horas de incubação, antes de nova incubação durante 36 horas seguida por recolha dos sobrenadantes e peletes de células investigar mais especificamente o impacto das intervenções de bloqueio na secreção de citocinas por subpopulações definidas de PBMC.

<table border="1">
		<tbody>
		 <tr>
			<td>Name of Reagent/Material</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		 </tr>
		 <tr>
			<td>Hanks Balanced Salt Solution without Ca2+ or Mg2+</td>
			<td>Sigma</td>
			<td>H9394</td>
			<td></td>
		 </tr>
		 <tr>
			<td>RPMI 1640</td>
			<td>Sigma</td>
			<td>R0883</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Histopaque-1077</td>
			<td>Sigma</td>
			<td>10771</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Human Serum AB</td>
			<td>Gemini BioProducts</td>
			<td>100-512</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Penicillin/Streptomycin</td>
			<td>Mediatech</td>
			<td>30 001 CI</td>
			<td></td>
		 </tr>
		 <tr>
			<td>L-glutamine</td>
			<td>Mediatech</td>
			<td>25 005 CI</td>
			<td></td>
		 </tr>
		 <tr>
			<td>HEPES buffer</td>
			<td>Mediatech</td>
			<td>25060CI</td>
			<td></td>
		 </tr>
		 <tr>
			<td>FcR blocking reagent, human</td>
			<td>Miltenyi</td>
			<td>130-059-901</td>
			<td></td>
		 </tr>
		 <tr>
			<td>RosetteSep Human CD8+ Depletion Cocktail </td>
			<td>Stem Cell </td>
			<td>15663</td>
			<td></td>
		 </tr>
		 <tr>
			<td>LIVE/DEAD Fixable Dead Cell Stain Kit, for UV excitation</td>
			<td>Invitrogen</td>
			<td>L23105</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Rneasy Mini Kit</td>
			<td>Qiagen</td>
			<td>74104</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Improm-II Reverse Transcription System</td>
			<td>Promega</td>
			<td>A3800</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Brilliant II SYBR qPCR Low Rox Master Mix</td>
			<td>Agilent</td>
			<td>600830</td>
			<td></td>
		 </tr>
		 <tr>
			<td>BD Cytofix/Cytoperm Fixation/Permeabilization Solution Kit</td>
			<td>BD</td>
			<td>554714</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Tween-20</td>
			<td>Fisher</td>
			<td>BP337100</td>
			<td></td>
		 </tr>
		 <tr>
			<td>IFN-&gamma; primer</td>
			<td>Invitrogen</td>
			<td></td>
			<td>FOR: CGAGATGACTTCGAAAAGCTGA REV: TCTTCGACCTCGAAACAGCA</td>
		 </tr>
		 <tr>
			<td>GAPDH primer</td>
			<td>Invitrogen</td>
			<td></td>
			<td>FOR: TCATCATCTCTGCCCCCTCT REV: AGTGATGGCATGGACTGTGG</td>
		 </tr>
		</tbody>
 </table>

in vitro assay to evaluate the impact of immunoregulatory pathways on hiv-specific cd4 t cell effector function

T exaustão celular é um fator importante na depuração patógeno falhou durante infecções virais crônicas. Vias imunoreguladores, tais como DP-1 e IL-10, são regulados positivamente em cima desta exposição do antigénio em curso e contribuir para a perda de proliferação, uma redução da função citolítica e auditivos produção de citoquinas por células T CD4 e CD8. No modelo murino de infecção por LCMV, a administração de anticorpos bloqueadores contra estas duas vias aumentou a resposta de células T. No entanto, não há atualmente nenhum ensaio in vitro para medir o impacto de tal bloqueio na secreção de citocinas em células de amostras humanas. Nosso protocolo ea abordagem experimental nos permitir quantificar de forma precisa e eficiente a restauração da produção de citocinas por células específicas para o HIV CD4 T de indivíduos infectados por VIH. Aqui, retratam um delineamento experimental in vitro que permite medições de secreção de citocinas por células específicas para o HIV T CD4 e seu impacto no outro cell subconjuntos. Células CD8 T foram esgotadas de sangue total e PBMC restantes foram isolados através do método de separação com Ficoll. As PBMC esgotadas-CD8 foram então incubadas com anticorpos bloqueadores contra a PD-L1 e / ou IL-10Rα e, após a estimulação com um conjunto de peptídeos Gag de HIV-1, as células foram incubadas a 37 ° C, 5% de CO 2. Após 48 horas, o sobrenadante foi coletado para análise de citocinas por contas de matrizes e pellets celulares foram recolhidos para qualquer análise fenotípica por citometria de fluxo ou análise transcricional usando qRT-PCR. Para análise mais pormenorizada, as populações de células diferentes foram obtidos por depleção selectiva subconjunto de PBMC ou por triagem utilizando citometria de fluxo antes de ser avaliado nos mesmos ensaios. Estes métodos proporcionam uma abordagem altamente sensível e específico para determinar a modulação da produção de citoquinas por células T auxiliares específicas para o antigénio e para determinar as interacções funcionais entre as diferentes populações de células imunitárias.

Para as medições de citocinas utilizando este sistema in vitro, é essencial ser capaz de distinguir as respostas específicas de antigénio, em comparação com o controlo sem estimulação. De uma maneira geral, considerou-se respostas positivas como os valores da estimulação antigénica que dão aumento de, pelo menos, três vezes nos níveis de citocinas em comparação com o controlo sem estimulação e que estavam dentro do intervalo linear do ensaio. Estamos usando alta sensibilidade ensaios matriz t...

Watch this Scientific Journal Video about In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function at JoVE.com

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

Foi desenvolvido um ensaio in vitro para investigar o papel das vias de imunorreguladores na regulação da secreção de citoquinas por células T CD4 + específicas para o HIV.

In Vitro Ensaio para avaliar o impacto da imunorreguladora Pathways on específica para o HIV CD4 T efetoras celular Função

T cell exhaustion is a major factor in failed pathogen clearance during chronic viral infections. Immunoregulatory pathways, such as PD-1 and IL-10, are ...

in-vitro-assay-to-evaluate-impact-immunoregulatory-pathways-on-hiv

Research

JoVE Journal

Immunology and Infection

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

14.0K visualizações.  The Ragon Institute of MGH, MIT and Harvard.  Foi desenvolvido um ensaio in vitro para investigar o papel das vias de imunorreguladores na regulação da secreção de citoquinas por células T CD4 + específicas para o HIV. 

Vídeo: In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

Isolation and Th17 Differentiation of Na&iuml;ve CD4 T Lymphocytes

Th17 cells are a distinct subset of T cells that have been found to produce interleukin 17 (IL-17), and differ in function from the other T cell subsets including Th1, Th2, and regulatory T cells. Th17 cells have emerged as a central culprit in overzealous inflammatory immune responses associated with many autoimmune disorders. In this method we purify T lymphocytes from the spleen and lymph nodes of C57BL/6 mice, and stimulate purified CD4+ T cells under control and Th17-inducing environments. The Th17-inducing environment includes stimulation in the presence of anti-CD3 and anti-CD28 antibodies, IL-6, and TGF-&#946;. After incubation for at least 72 hours and for up to five days at 37 &#176;C, cells are subsequently analyzed for the capability to produce IL-17 through flow cytometry, qPCR, and ELISAs. Th17 differentiated CD4+CD25- T cells can be utilized to further elucidate the role that Th17 cells play in the onset and progression of autoimmunity and host defense. Moreover, Th17 differentiation of CD4+CD25- lymphocytes from distinct murine knockout/disease models can contribute to our understanding of cell fate plasticity.

Isolation and Th17 Differentiation of Na&amp;#239;ve CD4 T Lymphocytes

With effector functions distinct from other T cell subsets, Th17 cells have been centrally implicated in inflammatory autoimmunity. This in vitro Th17 differentiation protocol provides a means to determine whether na&#239;ve CD4+ T lymphocytes can differentiate into Th17 cells, and to further examine their role in autoimmunity and host response.

Isolamento e Th17 Diferenciação de Linfócitos T CD4 Naïve

Th17 cells are a distinct subset of T cells that have been found to produce interleukin 17 (IL-17), and differ in function from the other T cell subsets ...

Imunologia e Infecção

Transplantation of Tail Skin to Study Allogeneic CD4 T Cell Responses in Mice

The study of T cell responses and their consequences during allo-antigen recognition requires a model that enables one to distinguish between donor and host T cells, to easily monitor the graft, and to adapt the system in order to answer different immunological questions. Medawar and colleagues established allogeneic tail-skin transplantation in mice in 1955. Since then, the skin transplantation model has been continuously modified and adapted to answer specific questions. The use of tail-skin renders this model easy to score for graft rejection, requires neither extensive preparation nor deep anesthesia, is applicable to animals of all genetic background, discourages ischemic necrosis, and permits chemical and biological intervention. 
In general, both CD4+ and CD8+ allogeneic T cells are responsible for the rejection of allografts since they recognize mismatched major histocompatibility antigens from different mouse strains. Several models have been described for activating allogeneic T cells in skin-transplanted mice. The identification of major histocompatibility complex (MHC) class I and II molecules in different mouse strains including C57BL/6 mice was an important step toward understanding and studying T cell-mediated alloresponses. In the tail-skin transplantation model described here, a three-point mutation (I-Abm12) in the antigen-presenting groove of the MHC-class II (I-Ab) molecule is sufficient to induce strong allogeneic CD4+ T cell activation in C57BL/6 mice. Skin grafts from I-Abm12 mice on C57BL/6 mice are rejected within 12-15 days, while syngeneic grafts are accepted for up to 100 days. The absence of T cells (CD3-/- and Rag2-/- mice) allows skin graft acceptance up to 100 days, which can be overcome by transferring 2 x 104 wild type or transgenic T cells. Adoptively transferred T cells proliferate and produce IFN-&#947; in I-Abm12-transplanted Rag2-/- mice.

Tail-skin transplantation is a powerful model for studying T cell-dependent rejection and tolerance induction during allogeneic immune responses in mice. The advantages of this protocol are minor invasive surgery, and ease of monitoring with no need to sacrifice the recipient mouse.

O transplante de pele da cauda para estudar as respostas das células T CD4 alogênico em camundongos

The study of T cell responses and their consequences during allo-antigen recognition requires a model that enables one to distinguish between donor and ...

Image-based Flow Cytometry Technique to Evaluate Changes in Granulocyte Function In Vitro

Granulocytes play a key role in the body&#8217;s innate immune response to bacterial and viral infections. While methods exist to measure granulocyte function, in general these are limited in terms of the information they can provide. For example, most existing assays merely provide a percentage of how many granulocytes are activated following a single, fixed length incubation. Complicating matters, most assays focus on only one aspect of function due to limitations in detection technology. This report demonstrates a technique for simultaneous measurement of granulocyte phagocytosis of bacteria and oxidative burst. By measuring both of these functions at the same time, three unique phenotypes of activated granulocytes were identified: 1) Low Activation (minimal phagocytosis, no oxidative burst), 2) Moderate Activation (moderate phagocytosis, some oxidative burst, but no co-localization of the two functional events), and 3) High Activation (high phagocytosis, high oxidative burst, co-localization of phagocytosis and oxidative burst). A fourth population that consisted of inactivated granulocytes was also identified. Using assay incubations of 10, 20, and 40-min the effect of assay incubation duration on the redistribution of activated granulocyte phenotypes was assessed. A fourth incubation was completed on ice as a control. By using serial time incubations, the assay may be able to able to detect how a treatment spatially affects granulocyte function. All samples were measured using an image-based flow cytometer equipped with a quantitative imaging (QI) option, autosampler, and multiple lasers (488, 642, and 785 nm).

Image-based Flow Cytometry Technique to Evaluate Changes in Granulocyte Function In Vitro

This method demonstrates a technique for assessing granulocyte function by simultaneously measuring phagocytosis of bacteria and oxidative burst. Image-based flow cytometry allowed for the identification of three distinct subsets of activated granulocytes that all differed in their relative functional capacity.

Baseada em imagem Técnica de Citometria de Fluxo para avaliar as mudanças na função de granulócitos<em&gt; In Vitro</em

Granulocytes play a key role in the body&#8217;s innate immune response to bacterial and viral infections. While methods exist to measure granulocyte ...

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

There are many different animal models available for studying the pathogenesis of human inflammatory bowel diseases (IBD), each with its own advantages and disadvantages. We describe here an experimental colitis model that is initiated by adoptive transfer of syngeneic splenic CD4+CD45RBhigh T cells into T and B cell deficient recipient mice. The CD4+CD45RBhigh T cell population that largely consists of na&#239;ve effector cells is capable of inducing chronic intestinal inflammation, closely resembling key aspects of human IBD. This method can be manipulated to study aspects of disease onset and progression. Additionally it can be used to study the function of innate, adaptive, and regulatory immune cell populations, and the role of environmental exposures, i.e., the microbiota, in intestinal inflammation. In this article we illustrate the methodology for inducing colitis with a step-by-step protocol. This includes a video demonstration of key technical aspects required to successfully develop this murine model of experimental colitis for research purposes.

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

Here, we present a protocol to induce colonic inflammation in mice by adoptive transfer of syngeneic CD4+CD45RBhigh T cells into T and B cell deficient recipients. Clinical and histopathological features mimic human inflammatory bowel diseases. This method allows the study of the initiation of colonic inflammation and progression of disease.

Indução de Murino inflamação intestinal por transferência adotiva de Effector CD4<sup&gt; +</sup&gt; CD45RB<sup&gt; Alta</sup&gt; Células T em imunodeficientes Mice

There are many different animal models available for studying the pathogenesis of human inflammatory bowel diseases (IBD), each with its own advantages ...

Mouse Na&#239;ve CD4+ T Cell Isolation and In vitro Differentiation into T Cell Subsets

Antigen inexperienced (na&#239;ve) CD4+ T cells undergo expansion and differentiation to effector subsets at the time of T cell receptor (TCR) recognition of cognate antigen presented on MHC class II. The cytokine signals present in the environment at the time of TCR activation are a major factor in determining the effector fate of a na&#239;ve CD4+ T cell. Although the cytokine environment during na&#239;ve T cell activation may be complex and involve both redundant and opposing signals in vivo, the addition of various cytokine combinations during naive CD4+ T cell activation in vitro can readily promote the establishment of effector T helper lineages with hallmark cytokine and transcription factor expression. Such differentiation experiments are commonly used as a first step for the evaluation of targets believed to promote or inhibit the development of certain CD4+ T helper subsets. The addition of mediators, such as signaling agonists, antagonists, or other cytokines, during the differentiation process can also be used to study the influence of a particular target on T cell differentiation. Here, we describe a basic protocol for the isolation of na&#239;ve T cells from mouse and the subsequent steps necessary for polarizing na&#239;ve cells to various T helper effector lineages in vitro.

Mouse Na&amp;#239;ve CD4+ T Cell Isolation and In vitro Differentiation into T Cell Subsets

Na&#239;ve CD4+ T cells polarize to various subsets depending on the environment at the time of activation. The differentiation of na&#239;ve CD4+ T cells to various effector subsets can be achieved in vitro through the addition of T cell receptor stimuli and specific cytokine signals.

Rato Naïve CD4<sup&gt; +</sup&gt; Isolamento de células T e<em&gt; In vitro</em&gt; Diferenciação em subpopulações de células T

Antigen inexperienced (na&#239;ve) CD4+ T cells undergo expansion and differentiation to effector subsets at the time of T cell receptor (TCR) recognition ...

Application of Long-term cultured Interferon-&#947; Enzyme-linked Immunospot Assay for Assessing Effector and Memory T Cell Responses in Cattle

Effector and memory T cells are generated through developmental programing of na&#239;ve cells following antigen recognition. If the infection is controlled up to 95 % of the T cells generated during the expansion phase are eliminated (i.e., contraction phase) and memory T cells remain, sometimes for a lifetime. In humans, two functionally distinct subsets of memory T cells have been described based on the expression of lymph node homing receptors. Central memory T cells express C-C chemokine receptor 7 and CD45RO and are mainly located in T-cell areas of secondary lymphoid organs. Effector memory T cells express CD45RO, lack CCR7 and display receptors associated with lymphocyte homing to peripheral or inflamed tissues. Effector T cells do not express either CCR7 or CD45RO but upon encounter with antigen produce effector cytokines, such as interferon-&#947;. Interferon-&#947; release assays are used for the diagnosis of bovine and human tuberculosis and detect primarily effector and effector memory T cell responses. Central memory T cell responses by CD4+ T cells to vaccination, on the other hand, may be used to predict vaccine efficacy, as demonstrated with simian immunodeficiency virus infection of non-human primates, tuberculosis in mice, and malaria in humans. Several studies with mice and humans as well as unpublished data on cattle, have demonstrated that interferon-&#947; ELISPOT assays measure central memory T cell responses. With this assay, peripheral blood mononuclear cells are cultured in decreasing concentration of antigen for 10 to 14 days (long-term culture), allowing effector responses to peak and wane; facilitating central memory T cells to differentiate and expand within the culture.

Application of Long-term cultured Interferon-&amp;#947; Enzyme-linked Immunospot Assay for Assessing Effector and Memory T Cell Responses in Cattle

Long-term cultured interferon-&#947; enzyme-linked immunospot assay is used as a measure of central memory responses and correlates with protective anti-mycobacterial vaccine responses. With this assay, peripheral blood mononuclear cells are stimulated with mycobacterial antigens and interleukin-2 for 14 days, enabling differentiation and expansion of central memory T cells.

Aplicação de longo prazo cultivadas Interferon-γ Enzyme-linked Immunospot Ensaio para a Avaliação e efetoras de memória T respostas de células em gado

Effector and memory T cells are generated through developmental programing of na&#239;ve cells following antigen recognition. If the infection is ...

Imaging CD4 T Cell Interstitial Migration in the Inflamed Dermis

The ability of CD4 T cells to carry out effector functions is dependent upon the rapid and efficient migration of these cells in inflamed peripheral tissues through an as-yet undefined mechanism. The application of multiphoton microscopy to the study of the immune system provides a tool to measure the dynamics of immune responses within intact tissues. Here we present a protocol for non-invasive intravital multiphoton imaging of CD4 T cells in the inflamed mouse ear dermis. Use of a custom imaging platform and a venous catheter allows for the visualization of CD4 T cell dynamics in the dermal interstitium, with the ability to interrogate these cells in real-time via the addition of blocking antibodies to key molecular components involved in motility. This system provides advantages over both in vitro models and surgically invasive imaging procedures. Understanding the pathways used by CD4 T cells for motility may ultimately provide insight into the basic function of CD4 T cells as well as the pathogenesis of both autoimmune diseases and pathology from chronic infections.

The mechanisms that govern the interstitial motility of CD4 effector T cells at sites of inflammation are relatively unknown. We present a non-invasive approach to visualize and manipulate in vitro-primed CD4 T cells in the inflamed ear dermis, allowing for study of the dynamic behavior of these cells in situ.

Migração intersticial imagens de células CD4 T na derme inflamadas

The ability of CD4 T cells to carry out effector functions is dependent upon the rapid and efficient migration of these cells in inflamed peripheral ...

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction

Breakdown of the blood-brain barrier (BBB) is a critical step in the development of autoimmune diseases such as multiple sclerosis (MS) and its animal model experimental autoimmune encephalomyelitis (EAE). This process is characterized by the transmigration of activated T cells across brain endothelial cells (ECs), the main constituents of the BBB. However, the consequences on brain EC function upon interaction with such T cells are largely unknown. Here we describe an assay that allows for the evaluation of primary mouse brain microvascular EC (MBMEC) function and barrier integrity during the interaction with T cells over time. The assay makes use of impedance cell spectroscopy, a powerful tool for studying EC monolayer integrity and permeability, by measuring changes in transendothelial electrical resistance (TEER) and cell layer capacitance (Ccl). In direct contact with ECs, stimulated but not na&#239;ve T cells are capable of inducing EC monolayer dysfunction, as visualized by a decrease in TEER and an increase in Ccl. The assay records changes in EC monolayer integrity in a continuous and automated fashion. It is sensitive enough to distinguish between different strengths of stimuli and levels of T cell activation and it enables the investigation of the consequences of a targeted modulation of T cell-EC interaction using a wide range of substances such as antibodies, pharmacological reagents and cytokines. The technique can also be used as a quality control for EC integrity in in vitro T-cell transmigration assays. These applications make it a versatile tool for studying BBB properties under physiological and pathophysiological conditions.

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction

Here, we describe an in vitro murine model of the blood-brain barrier that makes use of impedance cell spectroscopy, with a focus on the consequences on endothelial cell integrity and permeability upon interaction with activated T cells.

A<em&gt; In Vitro</em&gt; Modelo da barreira sangue-cérebro que usa espectroscopia de impedância: Um foco na interação celular T Cell-endotelial

Breakdown of the blood-brain barrier (BBB) is a critical step in the development of autoimmune diseases such as multiple sclerosis (MS) and its animal ...

Assessing Retinal Microglial Phagocytic Function In Vivo Using a Flow Cytometry-based Assay

Microglia are the tissue resident macrophages of the central nervous system (CNS) and they perform a variety of functions that support CNS homeostasis, including phagocytosis of damaged synapses or cells, debris, and/or invading pathogens. Impaired phagocytic function has been implicated in the pathogenesis of diseases such as Alzheimer's and age-related macular degeneration, where amyloid-&#946; plaque and drusen accumulate, respectively. Despite its importance, microglial phagocytosis has been challenging to assess in vivo. Here, we describe a simple, yet robust, technique for precisely monitoring and quantifying the in vivo phagocytic potential of retinal microglia. Previous methods have relied on immunohistochemical staining and imaging techniques. Our method uses flow cytometry to measure microglial uptake of fluorescently labeled particles after intravitreal delivery to the eye in live rodents. This method replaces conventional practices that involve laborious tissue sectioning, immunostaining, and imaging, allowing for more precise quantification of microglia phagocytic function in just under six hours. This procedure can also be adapted to test how various compounds alter microglial phagocytosis in physiological settings. While this technique was developed in the eye, its use is not limited to vision research.

Assessing Retinal Microglial Phagocytic Function In Vivo Using a Flow Cytometry-based Assay

Microglial phagocytosis is critical for the maintenance of tissue homeostasis and inadequate phagocytic function has been implicated in pathology. However, assessing microglia function in vivo is technically challenging. We have developed a simple but robust technique for precisely monitoring and quantifying the phagocytic potential of microglia in a physiological setting.

Avaliando Retinal microglia fagocítica Função<em&gt; In Vivo</em&gt; Usando um ensaio baseado em citometria de fluxo

Microglia are the tissue resident macrophages of the central nervous system (CNS) and they perform a variety of functions that support CNS homeostasis, ...

In Vitro Differentiation of Human CD4+FOXP3+ Induced Regulatory T Cells (iTregs) from Na&#239;ve CD4+ T Cells Using a TGF-&#946;-containing Protocol

Regulatory T cells (Tregs) are an integral part of peripheral tolerance, suppressing immune reactions against self-structures and thus preventing autoimmune diseases. Clinical approaches to adoptively transfer Tregs, or to deplete Tregs in cancer, are underway with promising first outcomes. 
Because the number of naturally occurring Tregs (nTregs) is very limited, studying certain Treg features using in vitro induced Tregs (iTregs) can be advantageous. To date, the best although not absolutely specific protein marker to delineate Tregs is the transcription factor FOXP3. Despite the importance of Tregs including non-redundant roles of peripherally induced Tregs, the protocols to generate iTregs are currently controversial, particularly for human cells. This protocol therefore describes the in vitro differentiation of human CD4+FOXP3+ iTregs from human na&#239;ve T cells using a range of Treg-inducing factors (TGF-&#946; plus IL-2 only, or their combination with retinoic acid, rapamycin or butyrate) in parallel. It also describes the phenotyping of these cells by flow cytometry and qRT-PCR. 
These protocols result in reproducible expression of FOXP3 and other Treg signature genes and enable the study of general FOXP3-regulatory mechanisms as well as protocol-specific effects to delineate the impact of certain factors. iTregs can be utilized to study various phenotypic aspects as well as molecular mechanisms of Treg induction. Detailed molecular studies are facilitated by relatively large cell numbers that can be obtained. 
A limitation for the application of iTregs is the relative instability of FOXP3 expression in these cells compared to nTregs. iTregs generated by these protocols can also be used for functional assays such as studying their suppressive function, in which iTregs induced by TGF-&#946; plus retinoic acid and rapamycin display superior suppressive activity. However, the suppressive capacity of iTregs can differ from nTregs and the use of appropriate controls is crucial.

&lt;em&gt;In Vitro&lt;/em&gt; Differentiation of Human CD4&lt;sup&gt;+&lt;/sup&gt;FOXP3&lt;sup&gt;+&lt;/sup&gt; Induced Regulatory T Cells (iTregs) from Na&amp;#239;ve CD4&lt;sup&gt;+&lt;/sup&gt; T Cells Using a TGF-&amp;#946;-containing Protocol

This protocol describes the reproducible generation and phenotyping of human induced regulatory T cells (iTregs) from na&#239;ve CD4+ T cells in vitro. Different protocols for FOXP3 induction allow for the study of specific iTreg phenotypes obtained with respective protocols.

Na diferenciação in vitro de células T CD4 + humano FOXP3 + Induzida T reguladoras (iTregs) a partir de células naive T CD4 + usando um protocolo de TGF-β contendo