RSM reconhece financiamento do NSF Graduate Research Fellowship. MBN reconhece financiamento de um Lewis-Sigler Fellowship eo dom dotado de Peter Lewis. DB reconhece financiamento do NIH (GM046406) do Instituto Nacional de Ciências Médicas Gerais Centro de Biologia Quantitativa (GM071508). Reconhecemos Christina DeCoste para assistência com experimentos de citometria de fluxo.

A Figura 2 proporciona um esquema de secções de protocolo 1-3. 1. Criação de ATFs <ol><li> Criar iniciadores para amplificar por PCR o ADN do domínio de ligação de interesse. A homologia com o receptor de promotor ACT1 e hormona (tal como descrito nas Figuras 3 e 4) é adicionado por meio de PCR para facilitar a recombinação correcta na estirpe yMN15. </li><li> PCR amplificar DBD de interesse, utilizando uma polimerase de alta fidelidade. </li><li> Transform&gt; 1 ug de produto de PCR purificado em levedura usando o método do acetato de lítio 13. </li><li> Após a transformação, as células de rotação em alta velocidade por 15 segundos em microcentrífuga e remover mix de transformação. </li><li> Ressuspender em ~ 200 mL de água estéril e placa YPD. </li><li> No dia seguinte, a placa de YPD réplica em placas de 5-FOA (5-FOA placas são feitas, como descrito no Manual de levedura Cold Spring Harbor) 13. </li><li> Permitir o crescimento de 2-4 days, e restreak pelo menos 5-10 colónias em meio YPD. Realizar PCR de colónias, utilizando os iniciadores do quadro 1 e a sequência para verificar a inserção. </li></ol> 2. Criação de ATF plasmídeo repórter <ol><li> Determinar o sítio de ligação do ATF (maior probabilidade de vir a partir da literatura). </li><li> Ordem desejada região de ligação como oligos (ou Ultramers, se necessário). Encomende como superior e fios de fundo com saliências corretos para NotI e XbaI, como mostrado na Tabela 2. </li><li> Diluir oligos para concentrações equimolares (100 uM). </li><li> Fosforilar usando polinucleótido cinase de T4 e, em seguida, recozer num termociclador. As condições de reacção estão na Tabela 3. </li><li> Digest ~ 1-2 ug de pMN8 com NotI-XbaI de HF e durante 1 hora a 37 ° C (condições de reacção do Quadro 4). </li><li> Gel purificar a banda backbone. </li><li> Dilui-se a espinha dorsal purificada a 10 ng / mL. </li><li> Dilua a cadeia dupla, fosforilated local de ligação 5x a concentração molar da espinha dorsal por ul. </li><li> Utilizando ligase de ADN T4, ligadura dos sítios de ligação para o backbone digerida à temperatura ambiente durante 30 minutos (Quadro 5). </li><li> Para a transformação, adicione metade da reação de ligação para 50 mL de padrão, Escherichia coli quimicamente competentes, tais como XL1-Blue ou DH5-Alpha. </li><li> Células de choque térmico durante 45 segundos num banho de água a 42 C ° e, em seguida, colocar em gelo durante 2 min. </li><li> Adicionar 900 ul de meio SOC a reacção de transformação. </li><li> Crescer a 37 ° C durante 1 hora, num tambor de rolos. </li><li> Espalhe 100-200 células por uL de LB + Amp (100 ug / ml) da placa e incubar durante a noite. </li><li> Cresce E. coli em meio LB + AMP ADN plasmídeo líquido e colheita. Seqüência verificar novo plasmídeo repórter do colônias laqueadura com o primer 5&#39;-GTACCTTATATTGAATTTTC-3 &#39;. </li><li> Transformar novo plasmídeo repórter em contendo ATF levedura strain da Seção 1, usando a transformação acetato de lítio. </li></ol> 3. Quantificar o efeito da ATF indução na expressão do gene GFP Usando Reporter Preparação das amostras: <ol><li> Adicione 25 mM estoque β-estradiol (10 ml de etanol + 0,0681 g de β-estradiol). Mantenha refrigerado. </li><li> Crescer ATF + Reporter contendo tensão durante a noite em 5 ml SC-URA. </li><li> Obter nove frascos de 250 ml agitar e adicionar 25 ml SC-URA para cada um. </li><li> Adicionar 0 nM, 0,1 nM, 1 nM, 10 nM, 100 nM, 1 pM, ou 10 pM β-estradiol. Isso é mais facilmente feito através de diluições em série de 10 vezes de o estoque de β-estradiol 25 mM. Para uma concentração final de 10 uM β-estradiol, adicionar 10 ul de estoque β-estradiol a 25 mM e 25 ml de SC-URA. </li><li> Adicionar 125 ul de culturas de uma noite de frascos (1:200 de diluição). </li><li> Para os restantes dois frascos, inocular com uma produção de GFP strai constitutivan e uma estirpe sem GFP. Estes são necessários para a calibração do citómetro de fluxo. </li><li> Agitar a 200 rpm a 30 ° C durante 12-18 horas. Nota: O tempo de incubação óptimo é determinado pela identificação de indução GFP quando não altera a seguir à adição de β-estradiol. </li><li> Tome 500 mL de cada cultura e girar em tubos de 1,7 ml de microcentrífuga separados. </li><li> Aspirar SC-URA. </li><li> Lavar uma vez em 1 ml de PBS 0,1% Tween-20 e aspirado. </li><li> Adicionar 1 ml de PBS 0,1% Tween-20 e ressuspender. </li><li> Adicionar 1 ml de PBS 0,1% de Tween-20 para tubos Falcon. </li><li> Adicionar as células ressuspensas para tubos de 5 ml (volume final = 2 mL) (podem ser armazenados a 4 ° C durante vários dias). </li><li> Opcional: células sonicate levemente para separação quaisquer células agregada. A citometria de fluxo análise: Resumo: A fluorescência de 10.000-100.000 células normalmente é analisado por amostra. Os dados podem ser processadas em FlowJo ou usando scripts personalizados em MATLAB ouR. Certifique-se de calibrar a tensão do canal de GFP utilizando controles GFP positivos e negativos. Uma vez que os ficheiros de FCS são exportados, um roteiro tal como o mostrado na Figura 6, juntamente com as funções (fca_readfcs <a href="http://www.mathworks.com/matlabcentral/fileexchange/9608-fcs-data-reader">http://www.mathworks.com/matlabcentral/fileexchange/9608-fcs-data-reader</a> ) pode ser usado para processar o dados. </li><li> Realizar citometria de fluxo. <ol><li> Use dispersão frontal (FSC) e dispersão lateral (SSC) para identificar células de levedura. </li><li> Defina a taxa de fluxo para ~ 3.000 células / seg. </li><li> Meça GFP (canal ITCF). </li><li> Uma vez que os dados são coletados, de exportação. FCS arquivos </li></ol></li><li> Carregar MATLAB. </li><li> Mova os arquivos. FCS, fcs_readfcs.m, e um script semelhante ao da Figura 6 para a mesma pasta. </li><li> Alterar o atual diretório de trabalho para a pasta que contém os dados e scripts. </li><li> Execute o script a partir da Figura 6 (nota: olenda foi digitado manualmente para produzir o que é visto na Figura 7). </li></ol> 4. Quantificar o efeito da ATF indução no crescimento celular <ol><li> De estoques congelados, raia fora tanto (1) uma cepa contendo ATF e (2) uma cepa falta ATF (como yMN15) em placas de YPD separados. </li><li> Após 2 dias de crescimento, inocular tubos de cultura separados contendo 5 ml de meio YPD líquido com cada uma das estirpes e crescer durante a noite a 30 ° C. </li><li> Realizar 10 diluições em série de uma solução de estoque mM β-estradiol 0,25 até 10.000 vezes (0.025 uM β-estradiol) em etanol a 100%. </li><li> Adicionar 40 ul de culturas de uma noite de 10 ml de líquido de YPD (1-250 diluição). </li><li> Para cada estirpe, adicionar 96 ul de células diluídas para 18 cavidades de uma placa de 96 poços. </li><li> Adicionar 4 mL de β-estradiol para as células. Um ponto essencial é certificar-se cada poço tem a mesma quantidade de etanol total. (Alternativamente, um mo<html> re Estoque concentrado de β-estradiol podem ser utilizados e subsequentemente diluída até ao ponto do efeito do álcool sobre o crescimento não é mensurável). </li><li> Realiza-se em triplicado. Três dos poços para cada cepa deve ser de etanol somente controles. </li><li> Cobrir a placa de 96 poços na membrana permeável ao gás. </li><li> Monitorar o crescimento (OD 600) no leitor de placas. </li><li> Quantificar as taxas de crescimento, utilizando qualquer número de métodos standard, tais como encontrar o declive máximo. Nota: Nós tivemos um bom sucesso com o open source software grofit 14, que é executado no ambiente de programação R Vale ressaltar que, embora as taxas de crescimento calculadas a partir de ensaios de placa de 96 poços em relação a agitar-frascos (25 ml culturas). não são necessariamente os mesmos (devido a diferenças na fisiologia e na instrumentação), temos observado que as taxas de crescimento relativo são similares (embora isso nem sempre pode ser o caso). </li></ol>tle &quot;&gt; 5. Criar induzíveis Genomic alelos <ol><li> Obter pMN10, um plasmídeo com o promotor noncentromeric ATF-responsivo de pMN8 fundido com KanMX (na orientação oposta). </li><li> Restrição digerir a espinha dorsal do vetor e extrato de gel como na Seção 2. </li><li> Anneal, fosforilam e oligos ligadura contendo sítios de ligação apropriadas conforme descrito na Seção 2. </li><li> Sequência de verificar. Este plasmídeo será agora servir como um molde de ADN para criar o alelo indutível. </li><li> Obter a estirpe de levedura que expressa o ATF correspondente de interesse. </li><li> PCR amplificar a cassete KanMX-Promotor (~ 2 kb), utilizando os iniciadores a partir da Tabela 6. </li><li> Transformar o produto de PCR para a estirpe que expressa ATF usando o método do acetato de lítio. </li><li> Placa em YPD e placa réplica em YPD + G418 no dia seguinte. </li><li> Confirmar a inserção apropriada do promotor utilizando o iniciador directo (5&#39;-CTGCAGCGAGGAGCCGTAAT-3 &#39;) e um iniciador interno reverso para poe gene cujo promotor foi substituído. O iniciador reverso é tipicamente concebida para estar entre 200-300 pb a jusante do primeiro ATG 15. O produto de PCR final é de aproximadamente de 1,2 kb. </li></ol>

<ol>
	<li>McIsaac, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+gene+expression+perturbation+systems+with+rapid,+tunable,+single-gene+specificity+in+yeast.">Synthetic gene expression perturbation systems with rapid, tunable, single-gene specificity in yeast.</a> Nucleic acids res. 41, e57 (2013).</li><li>McIsaac, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast-acting+and+nearly+gratuitous+induction+of+gene+expression+and+protein+depletion+in+Saccharomyces+cerevisiae.">Fast-acting and nearly gratuitous induction of gene expression and protein depletion in Saccharomyces cerevisiae.</a> Mol. Biol. cell. 22, 4447-4459 (2011).</li><li>Louvion, J. F., Havaux-Copf, B., Picard, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fusion+of+GAL4-VP16+to+a+steroid-binding+domain+provides+a+tool+for+gratuitous+induction+of+galactose-responsive+genes+in+yeast.">Fusion of GAL4-VP16 to a steroid-binding domain provides a tool for gratuitous induction of galactose-responsive genes in yeast.</a> Gene. 131, 129-134 (1993).</li><li>Littlewood, T. D., Hancock, D. C., Danielian, P. S., Parker, M. G., Evan, G. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+modified+oestrogen+receptor+ligand-binding+domain+as+an+improved+switch+for+the+regulation+of+heterologous+proteins.">A modified oestrogen receptor ligand-binding domain as an improved switch for the regulation of heterologous proteins.</a> Nucleic acids res. 23, 1686-1690 (1995).</li><li>McIsaac, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+and+Analysis+of+mRNA+Molecules+Using+Fluorescence+In+Situ+Hybridization+in+Saccharomyces+cerevisiae.">Visualization and Analysis of mRNA Molecules Using Fluorescence In Situ Hybridization in Saccharomyces cerevisiae.</a> J. Vis. Exp. (76), e50382 (2013).</li><li>McIsaac, R. S., Petti, A. A., Bussemaker, H. J., Botstein, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Perturbation-based+analysis+and+modeling+of+combinatorial+regulation+in+the+yeast+sulfur+assimilation+pathway.">Perturbation-based analysis and modeling of combinatorial regulation in the yeast sulfur assimilation pathway.</a> Mol. Biol. cell. 23, 2993-3007 (2012).</li><li>Belli, G., Gari, E., Piedrafita, L., Aldea, M., Herrero, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+activator/repressor+dual+system+allows+tight+tetracycline-regulated+gene+expression+in+budding+yeast.">An activator/repressor dual system allows tight tetracycline-regulated gene expression in budding yeast.</a> Nucleic acids res. 26, 942-947 (1998).</li><li>Baron, U., Bujard, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tet+repressor-based+system+for+regulated+gene+expression+in+eukaryotic+cells:+principles+and+advances.">Tet repressor-based system for regulated gene expression in eukaryotic cells: principles and advances.</a> Meth. Enzymol. 327, 401-421 (2000).</li><li>Kodama, S., Okada, K., Akimoto, K., Inui, H., Ohkawa, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recombinant+aryl+hydrocarbon+receptors+for+bioassay+of+aryl+hydrocarbon+receptor+ligands+in+transgenic+tobacco+plants.">Recombinant aryl hydrocarbon receptors for bioassay of aryl hydrocarbon receptor ligands in transgenic tobacco plants.</a> Plant Biotechnol. J. 7, 119-128 (2009).</li><li>Hickman, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coordinated+regulation+of+sulfur+and+phospholipid+metabolism+reflects+the+importance+of+methylation+in+the+growth+of+yeast.">Coordinated regulation of sulfur and phospholipid metabolism reflects the importance of methylation in the growth of yeast.</a> Mol. Biol. cell. 22, 4192-4204 (2011).</li><li>Taxis, C., Stier, G., Spadaccini, R., Knop, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+protein+depletion+by+genetically+controlled+deprotection+of+a+dormant+N-degron.">Efficient protein depletion by genetically controlled deprotection of a dormant N-degron.</a> Mol. Syst. Biol. 5, 267 (2009).</li><li>Nishimura, K., Fukagawa, T., Takisawa, H., Kakimoto, T., Kanemaki, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+auxin-based+degron+system+for+the+rapid+depletion+of+proteins+in+nonplant+cells.">An auxin-based degron system for the rapid depletion of proteins in nonplant cells.</a> Nat. methods. 6, 917-922 (2009).</li><li>Burke, D. J., Amberg, D. C., Strathern, J. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual. , (2005).</li><li>Kahm, M., Hasenbrink, G., Lichtenberg-Frate, H., Ludwig, J., Kschischo, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=grofit:+Fitting+Biological+Growth+Curves+with+R.">grofit: Fitting Biological Growth Curves with R.</a> J. Stat. Softw. 33, 1-21 (2010).</li><li>Rozen, S., Skaletsky, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primer3+on+the+WWW+for+general+users+and+for+biologist+programmers.">Primer3 on the WWW for general users and for biologist programmers.</a> Methods Mol. Biol. 132, 365-386 (2000).</li><li>Khalil, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+synthetic+biology+framework+for+programming+eukaryotic+transcription+functions.">A synthetic biology framework for programming eukaryotic transcription functions.</a> Cell. 150, 647-658 (2012).</li><li>Chockalingam, K., Chen, Z., Katzenellenbogen, J. A., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+specific+receptor-ligand+pairs+for+use+in+the+creation+of+gene+switches.">Directed evolution of specific receptor-ligand pairs for use in the creation of gene switches.</a> Proceedings of the National Academy of Sciences of the United States of America. 102, 5691-5696 (2005).</li><li>McLachlan, M. J., Chockalingam, K., Lai, K. C., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+orthogonal+ligand+specificity+in+a+single+scaffold.">Directed evolution of orthogonal ligand specificity in a single scaffold.</a> Angewandte Chemie. 48, 7783-7786 (2009).</li><li>Jorgensen, P., Nishikawa, J. L., Breitkreutz, B. J., Tyers, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+identification+of+pathways+that+couple+cell+growth+and+division+in+yeast.">Systematic identification of pathways that couple cell growth and division in yeast.</a> Science. 297, 395-400 (2002).</li><li>Sopko, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+pathways+and+phenotypes+by+systematic+gene+overexpression.">Mapping pathways and phenotypes by systematic gene overexpression.</a> Mol. cell. 21, 319-330 (2006).</li><li>Shimizu-Sato, S., Huq, E., Tepperman, J. M., Quail, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+light-switchable+gene+promoter+system.">A light-switchable gene promoter system.</a> Nat. biotechnol. 20, 1041-1044 (2002).</li><li>Polstein, L. R., Gersbach, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Light-inducible+spatiotemporal+control+of+gene+activation+by+customizable+zinc+finger+transcription+factors.">Light-inducible spatiotemporal control of gene activation by customizable zinc finger transcription factors.</a> J. Am. Chem. Soc. 134, 16480-16483 (2012).</li><li>Losi, A., Gartner, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Old+chromophores,+new+photoactivation+paradigms,+trendy+applications:+flavins+in+blue+light-sensing+photoreceptors.">Old chromophores, new photoactivation paradigms, trendy applications: flavins in blue light-sensing photoreceptors.</a> Photochem. Photobiol. 87, 491-510 (2011).</li><li>Boyden, E. S., Zhang, F., Bamberg, E., Nagel, G., Deisseroth, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Millisecond-timescale,+genetically+targeted+optical+control+of+neural+activity.">Millisecond-timescale, genetically targeted optical control of neural activity.</a> Nat. Neurosci. 8, 1263-1268 (2005).</li><li>Gradinaru, V., Mogri, M., Thompson, K. R., Henderson, J. M., Deisseroth, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optical+deconstruction+of+parkinsonian+neural+circuitry.">Optical deconstruction of parkinsonian neural circuitry.</a> Science. 324, 354-359 (2009).</li><li>Milias-Argeitis, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+silico+feedback+for+in+vivo+regulation+of+a+gene+expression+circuit.">In silico feedback for in vivo regulation of a gene expression circuit.</a> Nat. biotechnol. 29, 1114-1116 (2011).</li></ol>

McIsaac, Noyes, e Botstein (com os outros) apresentaram parte desse sistema como uma divulgação de Patentes.

Os interruptores com base de hormonas aqui descritas ter múltiplas aplicações, a partir do estudo da biologia celular nativo para testar a capacidade de um domínio de ligação ao ADN de interesse para alvejar uma sequência de ADN in vivo. O sistema tem muitas características desejáveis, incluindo uma resposta graduada para indutor, ação rápida, e regulação apertada (ie. Leakiness não mensurável, ver Figura 7). No entanto, ainda há espaço para melhorias e expansão. Trabalhos recentes em biologia sintética tem enfatizado sistemas sintéticos de multiplexação e ampliando o repertório de bem caracterizados, peças de DNA programáveis ​​16. Independente expressão condicional de genes-alvo distintos requer ambos os vários indutores e domínios de ligação ao DNA que não têm sobreposição de especificidade. A disponibilidade de receptores de engenharia e naturais fornece um grande conjunto de peças com as quais a desenvolver novos fatores de transcrição artificial. Expansão darepertório de interruptores ortogonais entre si, foi muito facilitada pela evolução dirigida aproxima 17,18. Os esforços actuais para reprogramar a especificidade de ligação ao ligando dos nossos factores de transcrição artificiais serão apresentados no futuro. Anteriormente, as conseqüências fenotípicas de gene exclusão / superexpressão têm sido extensivamente estudadas em leveduras 19,20. No entanto, isso não tem sido fácil para estudar o efeito da expressão em diferentes fenótipos longo de uma gama de níveis de expressão. Uma característica principal do sistema aqui apresentado é a sua natureza graduada (Figura 8). Embora muitas vezes assumida, a relação entre a expressão dos genes e fenótipos de interesse pode não ser necessariamente monótona. Fatores de transcrição artificiais, como Z e Z 3 EV 4 EV vai tornar a tarefa de ensaiar as respostas fenotípicas para mudanças na expressão gênica direta. Finalmente, os protocolos de discutired no texto são em engenharia e caracterizar factores de transcrição artificiais que respondem a β-estradiol, no entanto, uma importante alternativa para domínios quimicamente sensíveis é a utilização de domínios de luz que respondem a (tais como o PhyB/Pif3, LOV e BLUF), cujas atividades são reversíveis sem ter que perturbar o meio de crescimento da cultura 21-23. Sistemas baseados em Luz facilitar o controle espaço-temporal da expressão gênica, interações proteína-proteína, transporte de íons, e atividade enzimática, que já provaram poderoso 21-26. Em conclusão, nós apresentamos os métodos para a rápida construção de factores de transcrição indutíveis, artificiais em levedura. Este protocolo fornece um modelo para a construção em conjunto com os repórteres GFP cognato, bem como métodos para a análise dos dados repórter usando citometria de fluxo e ensaio do efeito de activação de ATF em crescimento.

Desenvolvimento de interruptores genéticos em leveduras é de grande interesse na pesquisa, tanto acadêmica e industrial. No caso ideal, interruptores genéticos pode ser usado para activar um gene particular (ou o conjunto de genes) apenas quando desejado pelo experimentador. Uma sequência de codificação do gene colocado a jusante de um promotor sintético que não é expressa na ausência de uma molécula de indução: depois da adição do indutor do gene deve ser expresso rapidamente. Foi recentemente demonstrado que uma tal mudança pode ser manipulada em levedura, em que, na ausência do indutor, a estirpe exibe um fenótipo de supressão, mas na presença de indutor, a expressão é activada em proporção com o nível de indutor em todas as células 1,2. Historicamente, os sistemas de expressão condicional em leveduras têm dependido pesadamente sobre seqüências de DNA em nutrientes sensível, incluindo o MET, PHO, e promotores GAL (cujas atividades são sensíveis aos níveis extracelulares de metionina, fosfato egalactose, respectivamente). Enquanto expressão condicional pode ser alcançado, ele vem com o custo de efeitos pleiotrópicos significativos. Receptores hormonais, tais como os receptores de estrogênio humanos provaram ser eficazes interruptores em eucariotos 3,4. Na ausência de hormona, uma proteína fundida a um receptor hormonal pode ser sequestrado no citoplasma onde interage com o complexo Hsp90 chaperone. Após a ligação do ligando apropriado, o receptor sofre uma alteração conformacional, fazendo com que seja libertada a partir do complexo Hsp90 chaperone e revelando um sinal de localização nuclear. Para observar a dinâmica de localização de uma determinada proteína contendo o receptor da hormona, foi criada uma fusão C-terminal do Gal4dbd.ER.VP16 (GEV, um factor de transcrição sintética, contendo o domínio de ligação ao ADN Gal4p, o domínio de ligação ao ligando do receptor estrogénio humano , e VP16) com GFP 2. A localização nuclear foi observada a cerca de 8 minutos após a adição dequantidades saturantes do indutor, ß-estradiol, para o tipo selvagem de levedura é completamente inerte. Por esta altura, a maioria das células têm sítios de transcrição activas claramente visíveis para os genes alvo (GEV ensaiadas através de hibridação in situ fluorescente), bem como os ARNm totalmente maduros 2,5. Genes-alvo GEV aumento na expressão&gt; 2 vezes dentro de 2,5 min 2,6 (medido utilizando microarrays), demonstrando que leva &lt;2,5 min para o activador quimérico para translocar para o núcleo, ligar ao ADN e activar a transcrição. Enquanto vários outros on-chaves foram aplicadas em leveduras que utilizam várias moléculas pequenas ou drogas (incluindo as opções de base em doxiciclina clássicos da Escherichia coli 7,8 e um switch baseado em indigo 9 de Arabidopsis thaliana), nenhum alcançaram a velocidade, especificidade, ou aperto da regulação exibida pelos interruptores à base de hormônios. Vale ressaltar tchapéu rápida fora dos interruptores, também têm sido desenvolvidas na levedura, e normalmente funcionam por fusão de um gene para uma protease ou ubiquitina ligase sequência de direccionamento 2,10,11,12. A capacidade de remover rapidamente uma proteína alvo a partir da célula facilita o estudo de genes essenciais, bem como os genes que são propensas a supressão genético quando apagados 10. Os métodos descritos neste protocolo são para a construção e caracterização sintética on-chaves em levedura. Primeiro, vamos mostrar como gerar rapidamente as proteínas de fusão genomically integrados constituídos por um domínio de ligação ao DNA de interesse, a ligação do ligante de domínio do receptor de estrógeno humano e VP16 (DBD-EV). Conforme o protocolo, a proteína de fusão é expressa a partir de um promotor ACT1. Em seguida, mostramos como criar um plasmídeo repórter cognato para o ATF e testar sua funcionalidade usando citometria de fluxo. Embora prevemos estes plasmídeos repórter sendo usado com novas ATFs (Figura 1), que pode be utilizado como repórteres para um activador da transcrição nativo bem. Finalmente, os detalhes para testar o efeito de activação do ATF no crescimento celular em placas de 96 poços e para a engenharia de alelos genómicas indutíveis são fornecidos.

<table border="0" cellpadding="0" cellspacing="0" width="352">
	<colgroup>
		<col span="4" />
	</colgroup>
	<tbody>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Name of the Reagent</td>
			<td style="width:88px;">Company</td>
			<td style="width:88px;">Catalogue Number</td>
			<td style="width:88px;">Comments&#160;</td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:88px;">Expand High Fidelity PCR System</td>
			<td style="width:88px;">Roche</td>
			<td style="width:88px;">11 732 650 001</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">T4 DNA Ligase</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">M0202S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Competent E. coli</td>
			<td style="width:88px;">Life Technologies</td>
			<td style="width:88px;">18258-012</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Estradiol</td>
			<td style="width:88px;">Tocris Biosciences</td>
			<td style="width:88px;">2824</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Ampicillin</td>
			<td style="width:88px;">Fisher Scientific</td>
			<td style="width:88px;">BP1760-5</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:88px;">T4 Polynucleotide Kinase</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">M0201</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">PBS</td>
			<td style="width:88px;">Life Technologies</td>
			<td style="width:88px;">10010-23</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">Tween-20</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">9005-64-5</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">clonNAT</td>
			<td style="width:88px;">Jena Bioscience</td>
			<td style="width:88px;">AB-102L</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">XbaI</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">R0145S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">NotI-HF</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">R3189S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">CutSmart Buffer</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">B7204S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Glucose</td>
			<td style="width:88px;">Fisher Scientific</td>
			<td style="width:88px;">D15-500</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Bacto-Peptone</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">211677</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Yeast Extract</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">210929</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Agarose</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">214010</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">100% Ethanol</td>
			<td style="width:88px;">Decon Laboratories</td>
			<td style="width:88px;">04-355-222</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">G418</td>
			<td style="width:88px;">Life Technologies</td>
			<td style="width:88px;">11811-031</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">QIAprep Spin Miniprep Kit</td>
			<td style="width:88px;">QIAGEN</td>
			<td style="width:88px;">27104</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:88px;">Lithium acetate dihydrate</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">L-6883</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Salmon sperm DNA</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">93283</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">PEG 3350</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">P-3640</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="69">
			<td height="69" style="height:69px;width:88px;">Plasmids pMN8 and pMN10; yeast strain yMN15</td>
			<td style="width:88px;">Noyes or Botstein labs</td>
			<td style="width:88px;"></td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">Luria Broth</td>
			<td>Sigma-Aldrich</td>
			<td>L3397</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EQUIPMENT:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Material Name</td>
			<td style="width:88px;">Company</td>
			<td style="width:88px;">Catalogue Number</td>
			<td style="width:88px;">Comments (optional)</td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">LSRII Flow Cyometer&#160;</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">Various Models</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="103">
			<td height="103" style="height:103px;width:88px;">MATLAB or FlowJo</td>
			<td style="width:88px;">MATLAB or FlowJo</td>
			<td style="width:88px;"></td>
			<td style="width:88px;">Software for analyzing .FCS files from flow cytometry experiments</td>
		</tr>
		<tr height="69">
			<td height="69" style="height:69px;width:88px;">R</td>
			<td style="width:88px;">Open Source</td>
			<td style="width:88px;"></td>
			<td style="width:88px;">For analyzing growth-rate data from plate reader.&#160;</td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Falcon Tubes</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">352052</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="52">
			<td height="52" style="height:52px;width:88px;">1.7 ml Eppendorf&#160; Tubes</td>
			<td style="width:88px;">GeneMate</td>
			<td style="width:88px;">C3262-1</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">250 ml Shake Flasks</td>
			<td style="width:88px;">Corning</td>
			<td style="width:88px;">4446-250</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">96-well, flat-bottom plates</td>
			<td style="width:88px;">Costar</td>
			<td style="width:88px;">3635</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="69">
			<td height="69" style="height:69px;width:88px;">Plate Reader (Synergy H1 Multi-Mode Plate Reader)</td>
			<td style="width:88px;">BioTek</td>
			<td style="width:88px;">H1MG</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Breathe-Easy Membranes</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">Z380059-1PAK</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Thermocycler</td>
			<td style="width:88px;">various companies</td>
			<td style="width:88px;">Various models</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">SC-Ura powder</td>
			<td style="width:88px;">MP Biomedicals</td>
			<td style="width:88px;">114410622</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">5-FOA</td>
			<td style="width:88px;">Zymo Research</td>
			<td style="width:88px;">F9001-1</td>
			<td style="width:88px;"></td>
		</tr>
	</tbody>
</table>

rapid synthesis and screening of chemically activated transcription factors with gfp-based reporters

A biologia sintética visa racionalmente projetar e construir circuitos sintéticos com propriedades quantitativas desejadas, bem como fornecer ferramentas para interrogar a estrutura dos circuitos de controle de origem. Em ambos os casos, a capacidade de programar a expressão do gene de uma forma rápida e sintonizável, sem efeitos fora do alvo, podem ser úteis. Foram construídas estirpes de levedura contendo o promotor a montante ACT1 de uma cassete URA3 seguido pelo domínio de ligação ao ligando do receptor estrogénio humano e VP16. Ao transformar essa tensão, com um produto de PCR linear contendo um domínio de ligação ao ADN e de selecção contra a presença de URA3, um factor de transcrição artificial constitutivamente expresso (ATF) podem ser gerados por recombinação homóloga. ATFs modificadas desta forma podem activar um gene alvo único, na presença de indutor, eliminando assim tanto a activação fora do alvo e das condições de crescimento não fisiológicas encontrados com condiciona utilizadaOs sistemas de expressão de genes onal. Um método simples para a rápida construção de plasmídeos repórter GFP que respondem especificamente a um factor de transcrição nativo ou artificial de interesse também é fornecido.

<html> A Figura 5 mostra a indução de GFP por Z 3 EV, Z 4 VE, ou GEV ao longo do tempo. Notar o aumento na produção de GFP em resposta aos ATFs contendo ADN nonyeast domínios de ligação. Recentemente, especulou que isto resulta a partir destes factores alcançar especificidade de um único gene no genoma de levedura 1. GEV indução por si só conduz à activação / repressão de centenas de genes, enquanto que Z 3 e Z 4 VE VE apenas activar a expressão de um gene alvo colocado a jusante de um promotor sintético que contém os locais de ligação adequados (5&#39;-GCGTGGGCG-3 &#39;e 5&#39;- GCGGCGGAGGAG-3 &#39;, respectivamente), 1. Figura 7 demonstra a regulação apertada do sistema (não há resultados indutor em não detectável GFP) e todas as células que se induzida em resposta ao indutor A capacidade de Z 3 EV para induzir GFP através de uma variedade de concentrações β-estradiol é mostrado na Figura 8. <html> ent &quot;fo: manter-together.within-page =&quot; always &quot;&gt; <img alt="Figura 1" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig1highres.jpg" src="/files/ftp_upload/51153/51153fig1.jpg" /> Figura 1. Factores de transcrição artificiais interagir com Hsp90 na ausência de β-estradiol. Quando β-estradiol se liga com o ATF, Hsp90 dissocia, permitindo que o ATF para entrar no núcleo e activar a expressão a partir do plasmídeo repórter. <img alt="Figura 2" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig2highres.jpg" src="/files/ftp_upload/51153/51153fig2.jpg" /> Figura 2. Esquemática do protocolo para as estirpes de engenharia que contêm fatores de transcrição artificiais e construção / testando repórteres GFP cognatos. load/51153/51153fig3highres.jpg &quot;src =&quot; / files/ftp_upload/51153/51153fig3.jpg &quot;/&gt; Figura 3. A sequência ACT1pr-URA3-VE na estirpe yMN15 no locus LEU2. <img alt="Figura 4" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig4highres.jpg" src="/files/ftp_upload/51153/51153fig4.jpg" /> Figura 4. Desenho de primers de PCR para a amplificação de um domínio de ligação de ADN de interesse com uma homologia de sequência adicional para gerar uma nova proteína de fusão quando transformado com sucesso em yMN15. <img alt="Figura 5" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig5highres.jpg" src="/files/ftp_upload/51153/51153fig5.jpg" /> Figura 5. Indução GFP por três pares de ATF-promotores diferentes em resposta a 1 uM β-estradiol. &lt;/ P&gt; <img alt="Figura 6" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig6highres.jpg" src="/files/ftp_upload/51153/51153fig6.jpg" /> Figura 6. Um script MATLAB para o fluxo de processamento de dados de citometria. Este roteiro foi adaptado de <a href="http://openwetware.org/wiki/McClean:_Matlab_Code_for_Analyzing_FACS_Data">http://openwetware.org/wiki/McClean:_Matlab_Code_for_Analyzing_FACS_Data</a> . <img alt="Figura 7" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig7highres.jpg" src="/files/ftp_upload/51153/51153fig7.jpg" /> Figura 7. Indução de GFP por Z 3 EV em resposta a 0 μ M β-estradiol e 1 uM β-estradiol seguinte de 18 horas de indução. Fluorescência foi também meamedido a partir de células sem GFP para ilustrar a forte regulamentação do sistema Z 3 EV. Esta figura foi gerada usando o código na Figura 6. <img alt="Figura 8" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig8highres.jpg" src="/files/ftp_upload/51153/51153fig8.jpg" /> Figura 8. A relação entre a concentração de indutor e saída de expressão é classificada com um coeficiente de Hill de 1 ~. (A) As distribuições de expressão da GFP como uma função da concentração de β-estradiol. (B) O valor médio de fluorescência das distribuições de (A). Os dados foram ajustados à função G (D) = L + min (L-L max min) D n / (n + K D n) onde D é a dose β-estradiol, L min e G são o máximo e mínimo valores máximos GFP, respectivamente, n é o coeficiente de Hill, e K é a dose β-estradiol que produz ½ (L max + L min). <table border="0" cellpadding="0" cellspacing="0" fo:keep-together.within-page="always" width="176"><tbody><tr><td> Seqüência de oligonucleotídeos </td><td> Nome </td></tr><tr><td> 5&#39;-TTGAAACCA AACTCGCCTCT-3 &#39; </td><td> DBD Verifique Encaminhar </td></tr><tr><td> 5&#39;-tccagagac ttcagggtgct-3 &#39; </td><td> DBD check Reversa </td></tr></tbody></table> Tabela 1. Primers para confirmar fusão correcta de DBD de interesse para o receptor de estrogênio. O iniciador directo é homóloga do promotor ACT1 e o iniciador reverso é homólogo ao receptor de estrogénio. Para DBDs típicas (~ 300 pb), o produto de PCR é &lt;1,5 kb. <table border="0" cellpadding="0" cellspacing="0" width="176"><tbody><tr><td> Seqüência de oligonucleotídeos </td><td> Nome </td></tr><tr><td> 5&#39;-ggccgc ... Local binging DBD ... t-3 &#39; </td><td> Top oligo </td></tr><tr><td> 5&#39;-ctaga ... sítio de ligação do DNA reverter ... gc-3 &#39; </td><td> Oligo inferior </td></tr><tr><td> 5&#39;-gcc gcGTGGGCG T GCGTGGGCG G G CGTGGGCG T GCGTGGGCG G GCGTG GGCG T GCGTGGGCG t-3 &#39; </td><td> Top oligo + 6x Zif268 Sites Encadernação </td></tr><tr><td> 5&#39;-ctagaCGCCCACGCACGCCCACGCC CGCCCACGCACGCCCACGCCCGCC CACGCACGCCCACgc-3 &#39; </td><td> Oligo inferior + 6x Zif268 Sites Encadernação </td></tr></tbody></table> Tabela 2. STRUTURA de primers para a criação de dsDNA contendo sítios de ligação de interesse. Para criar a Z 3 EV-responsive promotor, os oligonucleotídeos Top oligo + 6x Zif268 sítios de ligação e oligo inferior + 6x Zif268 foram usados ​​Binding.Seqüências para criar as saliências de DNA corretas estão em minúsculas. O sítio de ligação consenso Zif268, GCGTGGGCG, é sublinhado no top oligo. <table border="0" cellpadding="0" cellspacing="0" width="176"><tbody><tr><td> Reagente </td><td> Quantidade </td></tr><tr><td> Tampão de quinase de polinucleótido T4 </td><td> 5 ul </td></tr><tr><td> Polinucleotídeo cinase de T4 (@ 10.000 unidades / ml) </td><td> 1 ul </td></tr><tr><td> Topo de oligo (100 uM) </td><td> 1,5 mL </td></tr><tr><td> Oligo inferior (100 uM) </td><td> 1,5 mL </td></tr><tr><td> Água </td><td> 41 mL </td></tr></tbody></table> Tabela 3. Fosforilar e iniciadores de recozimento em um termociclador utilizando 50 ul de reacção descrito acima. Existem duas etapas termociclador. Passo 1: 37 ° C, 30 min (fosforilar), e Passo 2: 95 ° C 30 seg (descer 1 ° C em cada 30 segundos até a 4 ° C; hibridação). <table border="0" cellpadding="0" cellspacing="0" width="176"><tbody><tr><td> Reagente </td><td> Quantidade </td></tr><tr><td> XbaI </td><td> 1 ul </td></tr><tr><td> Notl-HF </td><td> 1 ul </td></tr><tr><td> O DNA de plasmídeo </td><td> 5 ul (1-2 ug) </td></tr><tr><td> 10x Cut inteligente de buffer </td><td> 5 ul </td></tr><tr><td> Água </td><td> 38 mL </td></tr></tbody></table> Tabela 4. Digestão de restrição do plasmídeo pMN8 com Xbal e Notl. <table border="0" cellpadding="0" cellspacing="0" width="176"><tbody><tr height="22" style="height:16.5pt"><td class="xl65" height="22" style="height:16.5pt;width:66pt" width="88"> Reagente </td><td class="xl66" style="width:66pt" width="88"> Quantidade </td></tr><tr height="43" style="height:32.25pt"><td> T4 ligase Buffer </td><td> 2 ul </td></tr><tr height="22" style="height:16.5pt"><td> T4 ligase </td><td> 0,2 mL </td></tr><tr height="43" style="height:32.25pt"><td> Backbone @ 10 ng / mL </td><td> 1 ul </td></tr><tr height="106" style="height:79.5pt"><td> Encadernação Seqüências @ 5x molar concentração / mL </td><td> 1 ul </td></tr><tr height="22" style="height:16.5pt"><td> Água </td><td> 15,8 mL </td></tr></tbody></table> Tabela 5. Ligadura sítios de ligação para o DNA de plasmídeo. <table border="0" cellpadding="0" cellspacing="0" width="176"><tbody><tr><td> Cartilha </td><td> Descrição </td></tr><tr><td> ~ 40 pb a montante do ATG + CGCACTTAACTTCGCATCTG-3 &#39; </td><td> Cartilha para a frente para amplificar KanMX-Promoter </td></tr><tr><td> 5&#39;-inversa do complemento (ATG + ~ 37BP) + TATAGTTTTTTCTCCTTGACG-3 &#39; </td><td> Reverter primer para amplificar KanMX-Promoter </td></tr><tr><td> 5&#39;-caatttgtctgctcaagaaaataaa ttaaatacaaataaaCGCAC TTAACTTCGCATCTG-3 &#39; </td><td> Cartilha para a frente para fazer troca GCN4 promotor. </td></tr><tr><td> 5&#39;-tggatttaaagcaaataaacttgg ctgatattcggacatTATAGTT TTTTCTCCTTGACG-3 &#39; </td><td> Reverter cartilha para fazer troca GCN4 promotor. </td></tr></tbody></table> Tabela 6. Amplificar por PCR KanMX-Promotor para fazer alelo titratible.

Watch this Scientific Journal Video about Rapid Synthesis and Screening of Chemically Activated Transcription Factors with GFP-based Reporters at JoVE.com

Rapid Synthesis and Screening of Chemically Activated Transcription Factors with GFP-based Reporters

Este protocolo descreve o procedimento experimental para a rápida construção de factores de transcrição artificiais (ATFs) com repórteres GFP cognatas e quantificação da capacidade ATFs para estimular a expressão de GFP por meio de citometria de fluxo.

Síntese rápida e Triagem de fatores de transcrição ativada quimicamente com jornalistas baseados em GFP

Synthetic biology aims to rationally design and build synthetic circuits with desired quantitative properties, as well as provide tools to interrogate the ...

rapid-synthesis-screening-chemically-activated-transcription-factors

Research

Education

JoVE Journal

JoVE Core

Molecular Biology

Biology

Unit 1

Transcription: DNA to RNA

SCIENTISTS IN ACTION

14.4K visualizações.  Princeton University.  Este protocolo descreve o procedimento experimental para a rápida construção de factores de transcrição artificiais (ATFs) com repórteres GFP cognatas e quantificação da capacidade ATFs para estimular a expressão de GFP por meio de citometria de fluxo. 

Vídeo: Rapid Synthesis and Screening of Chemically Activated Transcription Factors with GFP-based Reporters

Generation of Human CD40-activated B cells

CD40-activated B cells (CD40-B cells) have been identified as an alternative source of immuno-stimulatory antigen-presenting cells (APC) for cancer immunotherapy 1-3. Compared to Dendritic cells (DCs), the best characterized APC, CD40-B cells have several distinct biological and technical properties. Similar to DCs, B cells show an increased expression of MHC and co-stimulatory molecules (Fig.1b), exhibit a strong migratory capacity and present antigen presentation efficiently to T cells, after stimulation with interleukin-4 and CD40 ligand (CD40L). However, in contrast to immature or mature DCs, CD40-B cells express the full lymph node homing triad consisting of CD62L, CCR7/CXCR4, and leukocyte function antigen-1 (LFA1, CD11a/CD18), necessary for homing to secondary lymphoid organs (Fig.1a) 3. CD40-B cells can be generated without difficulties from very small amounts of peripheral blood which can be further expanded in vitro to very large amounts of highly-pure CD40-B cells (&gt;109 cells per patient) from healthy donors as well as cancer patients (Fig.1c,d) 1,4. 
In this protocol we demonstrate how to obtain fully activated CD40-B cells from human PBMC. Key molecules for the cell culture are CD40 ligand, interleukin-4 (IL-4) and cyclosporin A (CsA), which are replenished in a 3-4 day culture cycle. For laboratory purposes CD40-stimulation is provided by NIH/3T3 cells expressing recombinant human CD40 ligand (tCD40L NIH/3T3) 5. To avoid contamination with non-transfected cells, expression of the human CD40 ligand on the transfectants has to be checked regularly (Fig.2). 
After 14 days CD40-B cell cultures consist of more than 95% pure B cells and an expansion of CD40-B cells over 65 days is frequently possible without any loss of function 1, 4. CD40-B cells efficiently take up, process and present antigens to T cells 6. They do not only prime na&#970;ve, but also expand memory T cells 7,8. CD40-activated B cells can be used to study B-cell activation, differentiation and function. Moreover, they represent a promising tool for therapeutic or preventive vaccination against tumors 9.

In this video we present the ex vivo generation and expansion of human CD40-activated B cells (CD40-B) from peripheral blood mononuclear cells (PBMC) by stimulation with CD40 ligand and interleukin-4.

Geração de humanos CD40-activated células B

CD40-activated B cells (CD40-B cells) have been identified as an alternative source of immuno-stimulatory antigen-presenting cells (APC) for cancer ...

Biologia

Fluorescence Activated Cell Sorting of Plant Protoplasts

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental stimuli in any multicellular organism. In situ hybridization and reporter gene visualization can to a limited extent be used to this end but for high resolution quantitative RT-PCR or high-throughput transcriptome-wide analysis the isolation of RNA from particular cell types is requisite. Cellular dissociation of tissue expressing a fluorescent protein marker in a specific cell type and subsequent Fluorescence Activated Cell Sorting (FACS) makes it possible to collect sufficient amounts of material for RNA extraction, cDNA synthesis/amplification and microarray analysis.
An extensive set of cell type-specific fluorescent reporter lines is available to the plant research community. In this case, two marker lines of the Arabidopsis thaliana root are used: PSCR::GFP (endodermis and quiescent center) and PWOX5::GFP (quiescent center). Large numbers (thousands) of seedlings are grown hydroponically or on agar plates and harvested to obtain enough root material for further analysis. Cellular dissociation of plant material is achieved by enzymatic digestion of the cell wall. This procedure makes use of high osmolarity-induced plasmolysis and commercially available cellulases, pectinases and hemicellulases to release protoplasts into solution.
FACS of GFP-positive cells makes use of the visualization of the green versus the red emission spectra of protoplasts excited by a 488 nm laser. GFP-positive protoplasts can be distinguished by their increased ratio of green to red emission. Protoplasts are typically sorted directly into RNA extraction buffer and stored for further processing at a later time.
This technique is revealed to be straightforward and practicable. Furthermore, it is shown that it can be used without difficulty to isolate sufficient numbers of cells for transcriptome analysis, even for very scarce cell types (e.g. quiescent center cells). Lastly, a growth setup for Arabidopsis seedlings is demonstrated that enables uncomplicated treatment of the plants prior to cell sorting (e.g. for the cell type-specific analysis of biotic or abiotic stress responses). Potential supplementary uses for FACS of plant protoplasts are discussed.

A method for isolating specific cell types from plant material is demonstrated. This technique employs transgenic marker lines expressing fluorescent proteins in particular cell types, cellular dissociation and Fluorescence Activated Cell Sorting. Additionally, a growth setup is established here that facilitates treatment of Arabidopsis thaliana seedlings prior to cell sorting.

Separação de células de fluorescência Activated de Protoplastos Usina

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental ...

High-throughput Screening and Biosensing with Fluorescent C. elegans Strains

High-throughput screening (HTS) is a powerful approach for identifying chemical modulators of biological processes. However, many compounds identified in screens using cell culture models are often found to be toxic or pharmacologically inactive in vivo1-2. Screening in whole animal models can help avoid these pitfalls and streamline the path to drug development.
C. elegans is a multicellular model organism well suited for HTS. It is small (&lt;1 mm) and can be economically cultured and dispensed in liquids. C. elegans is also one of the most experimentally tractable animal models permitting rapid and detailed identification of drug mode-of-action3.
We describe a protocol for culturing and dispensing fluorescent strains of C. elegans for high-throughput screening of chemical libraries or detection of environmental contaminants that alter the expression of a specific gene. Large numbers of developmentally synchronized worms are grown in liquid culture, harvested, washed, and suspended at a defined density. Worms are then added to black, flat-bottomed 384-well plates using a peristaltic liquid dispenser. Small molecules from a chemical library or test samples (e.g., water, food, or soil) can be added to wells with worms. In vivo, real-time fluorescence intensity is measured with a fluorescence microplate reader. This method can be adapted to any inducible gene in C. elegans for which a suitable reporter is available. Many inducible stress and developmental transcriptional pathways are well defined in C. elegans and GFP transgenic reporter strains already exist for many of them4. When combined with the appropriate transgenic reporters, our method can be used to screen for pathway modulators or to develop robust biosensor assays for environmental contaminants. 
We demonstrate our C. elegans culture and dispensing protocol with an HTS assay we developed to monitor the C. elegans cap &#x2018;n&#x2019; collar transcription factor SKN-1. SKN-1 and its mammalian homologue Nrf2 activate cytoprotective genes during oxidative and xenobiotic stress5-10. Nrf2 protects mammals from numerous age-related disorders such as cancer, neurodegeneration, and chronic inflammation and has become a major chemotherapeutic target11-13.Our assay is based on a GFP transgenic reporter for the SKN-1 target gene gst-414, which encodes a glutathione-s transferase6. The gst-4 reporter is also a biosensor for xenobiotic and oxidative chemicals that activate SKN-1 and can be used to detect low levels of contaminants such as acrylamide and methyl-mercury15-16.

High-throughput Screening and Biosensing with Fluorescent C. elegans Strains

A procedure for liquid-based culturing and dispensing of C. elegans strains expressing fluorescent reporter proteins is described that does not require expensive sorting equipment. This approach can be applied to numerous inducible C. elegans genes for drug discovery or biosensing of contaminants.

Alto rendimento Triagem e Biossensoriais com Fluorescente C. elegans Cepas

High-throughput screening (HTS) is a powerful approach for identifying chemical modulators of biological processes.  However, many compounds identified in ...

Monitoring of Ubiquitin-proteasome Activity in Living Cells Using a Degron (dgn)-destabilized Green Fluorescent Protein (GFP)-based Reporter Protein

Proteasome is the main intracellular organelle involved in the proteolytic degradation of abnormal, misfolded, damaged or oxidized proteins 1, 2. Maintenance of proteasome activity was implicated in many key cellular processes, like cell's stress response 3, cell cycle regulation and cellular differentiation 4 or in immune system response 5. The dysfunction of the ubiquitin-proteasome system has been related to the development of tumors and neurodegenerative diseases 4, 6. Additionally, a decrease in proteasome activity was found as a feature of cellular senescence and organismal aging 7, 8, 9, 10. Here, we present a method to measure ubiquitin-proteasome activity in living cells using a GFP-dgn fusion protein. To be able to monitor ubiquitin-proteasome activity in living primary cells, complementary DNA constructs coding for a green fluorescent protein (GFP)&#x2013;dgn fusion protein (GFP&#x2013;dgn, unstable) and a variant carrying a frameshift mutation (GFP&#x2013;dgnFS, stable 11) are inserted in lentiviral expression vectors. We prefer this technique over traditional transfection techniques because it guarantees a very high transfection efficiency independent of the cell type or the age of the donor. The difference between fluorescence displayed by the GFP&#x2013;dgnFS (stable) protein and the destabilized protein (GFP-dgn) in the absence or presence of proteasome inhibitor can be used to estimate ubiquitin-proteasome activity in each particular cell strain. These differences can be monitored by epifluorescence microscopy or can be measured by flow cytometry.

Monitoring of Ubiquitin-proteasome Activity in Living Cells Using a Degron dgn-destabilized Green Fluorescent Protein GFP-based Reporter Protein

A method to monitor ubiquitin-proteasome activity in living cells is described. A degron-destabilized GFP- (GFP-dgn) and a stable GFP-dgnFS fusion protein are generated and transduced into the cell using a lentiviral expression vector. This technique allows to generate a stable GFP-dgn/GFP-dgnFS expressing cell line in which ubiquitin-proteasome activity can be easily assessed using epifluorescence or flow cytometry.

Monitoramento da ubiquitina-proteassoma Atividade em células vivas Usando um Degron (dgn) desestabilizado Green Fluorescent Protein Protein Repórter (GFP) com base em

Proteasome is the main intracellular organelle involved in the proteolytic degradation of abnormal, misfolded, damaged or oxidized proteins 1, 2. ...

Synthesis of Nine-atom Deltahedral Zintl Ions of Germanium and their Functionalization with Organic Groups

Although the first studies of Zintl ions date between the late 1890's and early 1930's they were not structurally characterized until many years later.1,2 Their redox chemistry is even younger, just about ten years old, but despite this short history these deltahedral clusters ions E9n- (E = Si, Ge, Sn, Pb; n = 2, 3, 4) have already shown interesting and diverse reactivity and have been at the forefront of rapidly developing and exciting new chemistry.3-6 Notable milestones are the oxidative coupling of Ge94- clusters to oligomers and infinite chains,7-19 their metallation,14-16,20-25 capping by transition-metal organometallic fragments,26-34 insertion of a transition-metal atom at the center of the cluster which is sometimes combined with capping and oligomerization,35-47 addition of main-group organometallic fragments as exo-bonded substituents,48-50 and functionalization with various organic residues by reactions with organic halides and alkynes.51-58 
This latter development of attaching organic fragments directly to the clusters has opened up a new field, namely organo-Zintl chemistry, that is potentially fertile for further synthetic explorations, and it is the step-by-step procedure for the synthesis of germanium-divinyl clusters described herein. The initial steps outline the synthesis of an intermetallic precursor of K4Ge9 from which the Ge94- clusters are extracted later in solution. This involves fused-silica glass blowing, arc-welding of niobium containers, and handling of highly air-sensitive materials in a glove box. The air-sensitive K4Ge9 is then dissolved in ethylenediamine in the box and then alkenylated by a reaction with Me3SiC&equiv;CSiMe3. The reaction is followed by electrospray mass spectrometry while the resulting solution is used for obtaining single crystals containing the functionalized clusters [H2C=CH-Ge9-CH=CH2]2-. For this purpose the solution is centrifuged, filtered, and carefully layered with a toluene solution of 18-crown-6. Left undisturbed for a few days, the so-layered solutions produced orange crystalline blocks of [K(18-crown-6)]2[Ge9(HCCH2)2]&bull;en which were characterized by single-crystal X-ray diffraction. 
The process highlights standard reaction techniques, work-up, and analysis towards functionalized deltahedral Zintl clusters. It is hoped that it will help towards further development and understanding of these compounds in the community at large.

We present the high-temperature synthesis of intermetallic precursors K4Ge9, their dissolution in ethylenediamine to form Ge94- deltahedral Zintl ions, and the reaction of the clusters with alkynes to form organo-Zintl ions. The latter are characterized by electrospray mass spectrometry in solutions and by single-crystal X-ray diffraction in the solid state.

Síntese dos Nove átomo-Deltahedral Íons Zintl de germânio e sua funcionalização com grupos orgânicos

Although the first studies of Zintl ions date between the late 1890's and early 1930's they were not structurally characterized until many years later.1,2 ...

Chromatin Interaction Analysis with Paired-End Tag Sequencing (ChIA-PET) for Mapping Chromatin Interactions and Understanding Transcription Regulation

Genomes are organized into three-dimensional structures, adopting higher-order conformations inside the micron-sized nuclear spaces 7, 2, 12. Such architectures are not random and involve interactions between gene promoters and regulatory elements 13. The binding of transcription factors to specific regulatory sequences brings about a network of transcription regulation and coordination 1, 14. 
Chromatin Interaction Analysis by Paired-End Tag Sequencing (ChIA-PET) was developed to identify these higher-order chromatin structures 5,6. Cells are fixed and interacting loci are captured by covalent DNA-protein cross-links. To minimize non-specific noise and reduce complexity, as well as to increase the specificity of the chromatin interaction analysis, chromatin immunoprecipitation (ChIP) is used against specific protein factors to enrich chromatin fragments of interest before proximity ligation. Ligation involving half-linkers subsequently forms covalent links between pairs of DNA fragments tethered together within individual chromatin complexes. The flanking MmeI restriction enzyme sites in the half-linkers allow extraction of paired end tag-linker-tag constructs (PETs) upon MmeI digestion. As the half-linkers are biotinylated, these PET constructs are purified using streptavidin-magnetic beads. The purified PETs are ligated with next-generation sequencing adaptors and a catalog of interacting fragments is generated via next-generation sequencers such as the Illumina Genome Analyzer. Mapping and bioinformatics analysis is then performed to identify ChIP-enriched binding sites and ChIP-enriched chromatin interactions 8. 
We have produced a video to demonstrate critical aspects of the ChIA-PET protocol, especially the preparation of ChIP as the quality of ChIP plays a major role in the outcome of a ChIA-PET library. As the protocols are very long, only the critical steps are shown in the video.

Chromatin Interaction Analysis with Paired-End Tag Sequencing ChIA-PET for Mapping Chromatin Interactions and Understanding Transcription Regulation

Chromatin Interaction Analysis by Paired-End Tag Sequencing (ChIA-PET) is a method for de novo detection of chromatin interactions, for better understanding of transcriptional control.

Cromatina Análise de Interação com Emparelhados Fim-Tag Sequencing (Chia-PET) para mapeamento Interações cromatina e Compreensão regulação da transcrição

Genomes are organized into three-dimensional structures, adopting higher-order conformations inside the micron-sized nuclear spaces 7, 2, 12. Such ...

Using Coculture to Detect Chemically Mediated Interspecies Interactions

In nature, bacteria rarely exist in isolation; they are instead surrounded by a diverse array of other microorganisms that alter the local environment by secreting metabolites. These metabolites have the potential to modulate the physiology and differentiation of their microbial neighbors and are likely important factors in the establishment and maintenance of complex microbial communities. We have developed a fluorescence-based coculture screen to identify such chemically mediated microbial interactions. The screen involves combining a fluorescent transcriptional reporter strain with environmental microbes on solid media and allowing the colonies to grow in coculture. The fluorescent transcriptional reporter is designed so that the chosen bacterial strain fluoresces when it is expressing a particular phenotype of interest (i.e. biofilm formation, sporulation, virulence factor production, etc.) Screening is performed under growth conditions where this phenotype is not expressed (and therefore the reporter strain is typically nonfluorescent). When an environmental microbe secretes a metabolite that activates this phenotype, it diffuses through the agar and activates the fluorescent reporter construct. This allows the inducing-metabolite-producing microbe to be detected: they are the nonfluorescent colonies most proximal to the fluorescent colonies. Thus, this screen allows the identification of environmental microbes that produce diffusible metabolites that activate a particular physiological response in a reporter strain. This publication discusses how to: a) select appropriate coculture screening conditions, b) prepare the reporter and environmental microbes for screening, c) perform the coculture screen, d) isolate putative inducing organisms, and e) confirm their activity in a secondary screen. We developed this method to screen for soil organisms that activate biofilm matrix-production in Bacillus subtilis; however, we also discuss considerations for applying this approach to other genetically tractable bacteria.

Bacteria produce secreted compounds that have the potential to affect the physiology of their microbial neighbors. Here we describe a coculture screen that allows detection of such chemically mediated interspecies interactions by mixing soil microbes with fluorescent transcriptional reporter strains of Bacillus subtilis on solid media.

Usando Coculture detectar quimicamente mediada interespécies Interações

In nature, bacteria rarely exist in isolation; they are instead surrounded by a diverse array of other microorganisms that alter the local environment by ...

Rapid and Efficient Zebrafish Genotyping Using PCR with High-resolution Melt Analysis

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic tools have been introduced, including multiple strategies for inducing mutations and generating transgenic lines. However, large-scale screening is limited by traditional genotyping methods, which are time-consuming and labor-intensive. Here we describe a technique to analyze zebrafish genotypes by PCR combined with high-resolution melting analysis (HRMA).&#160;This approach is rapid, sensitive, and inexpensive, with lower risk of contamination artifacts.&#160;Genotyping by PCR with HRMA can be used for embryos or adult fish, including in high-throughput screening protocols.

PCR combined with high-resolution melt analysis (HRMA) is demonstrated as a rapid and efficient method to genotype zebrafish.

Rápida e eficiente Zebrafish Genotipagem Usando PCR com alta resolução Análise Melt

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic ...

High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays focus on transcriptional regulation, being essentially aimed at the identification of promoter-targeting molecules. As a result, post-transcriptional mechanisms are largely uncovered by gene expression targeted drug development. Here we describe a cell-based assay aimed at investigating the role of the 3&#39; untranslated region (3&#8217; UTR) in the modulation of the fate of its mRNA, and at identifying compounds able to modify it. The assay is based on the use of a luciferase reporter construct containing the 3&#8217; UTR of a gene of interest stably integrated into a disease-relevant cell line. The protocol is divided into two parts, with the initial focus on the primary screening aimed at the identification of molecules affecting luciferase activity after 24 hr of treatment. The second part of the protocol describes the counter-screening necessary to discriminate compounds modulating luciferase activity specifically through the 3&#8217; UTR. In addition to the detailed protocol and representative results, we provide important considerations about the assay development and the validation of the hit(s) on the endogenous target. The described cell-based reporter gene assay will allow scientists to identify molecules modulating protein levels via post-transcriptional mechanisms dependent on a 3&#8217; UTR.

Here we describe a cell-based reporter gene assay as a valuable tool to screen chemical libraries for compounds modulating post-transcriptional control mechanisms exerted through 3&#8217; UTR.

Rastreio de alto rendimento para moduladores químicos de Genes Post-transcriptionally Regulamentados

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays ...

Flexible Measurement of Bioluminescent Reporters Using an Automated Longitudinal Luciferase Imaging Gas- and Temperature-optimized Recorder (ALLIGATOR)

Luciferase-based reporters of cellular gene expression are in widespread use for both longitudinal and end-point assays of biological activity. In circadian rhythms research, for example, clock gene fusions with firefly luciferase give rise to robust rhythms in cellular bioluminescence that persist over many days. Technical limitations associated with photomultiplier tubes (PMT) or conventional microscopy-based methods for bioluminescence quantification have typically demanded that cells and tissues be maintained under quite non-physiological conditions during recording, with a trade-off between sensitivity and throughput. Here, we report a refinement of prior methods that allows long-term bioluminescence imaging with high sensitivity and throughput which supports a broad range of culture conditions, including variable gas and humidity control, and that accepts many different tissue culture plates and dishes. This automated longitudinal luciferase imaging gas- and temperature-optimized recorder (ALLIGATOR) also allows the observation of spatial variations in luciferase expression across a cell monolayer or tissue, which cannot readily be observed by traditional methods. We highlight how the ALLIGATOR provides vastly increased flexibility for the detection of luciferase activity when compared with existing methods.

Flexible Measurement of Bioluminescent Reporters Using an Automated Longitudinal Luciferase Imaging Gas- and Temperature-optimized Recorder ALLIGATOR

Genetically encoded luciferase is a popular non-invasive reporter of gene expression. Use of an automated longitudinal luciferase imaging gas- and temperature-optimized recorder (ALLIGATOR) enables longitudinal recording from bioluminescent cells under a wide range of conditions. Here we show how ALLIGATOR may be used in the context of circadian rhythms research.

Medição flexível de repórteres bioluminescentes usando um Luciferase Longitudinal automatizado de imagem gravador de gás e temperatura-otimizado (jacaré)