Muito obrigado a Silke Kipper, Sarah Kiefer, Michael Weiss, Conny Bartsch e Silke Voigt-Heucke para coleta de amostras entusiasmado no campo, para Janett Birkenfeld de assistência continuada, para Ulla Kobalz para as belas géis e Tobias Krause para dar apoio moral.

Todos os procedimentos foram realizados em conformidade com a lei alemã para a protecção dos animais (TierSchG). 1. Preparação de reagentes e consumíveis <ol><li> Prepare a 5% (w / w) de Chelex-100 em solução de água de grau molecular. Preparar alíquotas de 200 ul em tubos de reacção de 1,5 ml de padrão. Como a resina Chelex precipita rapidamente a partir da suspensão, é necessário re-homogeneizar a suspensão constante durante a preparação das aliquotas. É aconselhável preparar 50 ml ou mais de uma só vez e manter a suspensão homogeneizada usando um agitador magnético. A solução de Chelex pode ser armazenado durante anos em condições ambientais. </li><li> Cortar pedaços de papel Whatman com uma largura menor do que a largura do bico de pássaros a serem testados. O comprimento do papel depende do método de levar a amostra: <ol><li> Utilizando uma pinça, a peça deve ser suficientemente longo para permitir a coleta de amostras sem a pinça sendo inseridos no bico da ave. Comoestimativa aproximada, para um comprimento de 0,5 cm bico um pedaço de papel com o comprimento de 1 cm deve ser fino. </li><li> Se não, utilizando um fórceps, a peça deve ser maior, mas a rigidez da peça deve ainda permitir que a amostragem de células epiteliais. </li></ol></li><li> Prepare uma alíquota da PCR pré-mistura para cada amostra a ser analisada. Para a técnica de PCR num volume total de 25 ul da mistura de dNTPs 0,18 mM contém, 2 mM de MgCl 2, 70 mM Tris-HCl, sulfato de amónio 17,25 mM, 0,1% de Tween-20, 0,32 uM de iniciadores P2 (TCTGCATCGCTAAATCCTTT), P8 0,32 fiM iniciador com polimerase (CTCCCAAGGATGAGRAAYTG) 16 e 2 unidades de Taq. Caseiro Taq polimerase 17 pode ser usado. Para permitir a adição da quantidade máxima de solução de ADN, uma pré-mistura de 6 uL pode ser preparada e armazenada a -20 ° C durante várias semanas. </li></ol> 2. Coleta de Amostras O uso de luvas não é essencial para a determinação do sexo das aves como os iniciadores de PCR não pode hibridar com o ADN humano. Paraoutros fins de genotipagem pode ser aconselhável. <ol><li> Capture a ave de interesse e gentilmente segure-o numa mão, por exemplo, com o &quot;aperto de campainha &#39;18. Certifique-se de não apertar o pássaro. </li><li> Segure um pedaço de papel Whatman com uma pinça e passe-o várias vezes em toda a parte interna das bochechas, da língua e da coana. Normalmente as amostras são obtidas em menos de 30 segundos. <ol><li> Animais adultos: dependendo da espécie, pode ser difícil conseguir o pássaro para abrir seu bico. Normalmente tocar no lado do bico e aplicando uma ligeira pressão vai trabalhar. </li><li> Filhotes: Amostragem de filhotes ou filhotes é especialmente fácil, utilizando esta técnica, como o seu comportamento implorando proporciona fácil acesso ao interior do bico. Pode até ser possível obter a amostra sem manuseá-los em tudo, como eles prontamente implorar por exemplo, quando seu ninho é aberto. </li></ol></li><li> Imediatamente armazenar o papel em uma preparados contai tubo de reaçãoning 200 ul de 5% (w / w) de Chelex-100 da solução. </li></ol> Se você também pretende / precisa marcar os filhotes, faça-o agora, como descrito na seção 6. 3. Armazenamento de Amostras Antes de DNA Extraction <ol><li> Se trabalham no laboratório, amostras armazenar a -20 ° C. Se isso não for possível ou difícil (por exemplo, no campo) armazenar as amostras à temperatura ambiente. </li><li> As amostras podem ser armazenadas durante mais de três anos, a temperaturas variando desde a temperatura ambiente até -20 ° C. </li></ol> 4. Extração de DNA <ol><li> Se a amostra for congelado, descongele-o em temperatura ambiente. </li><li> Certifique-se de que a folha de papel é no fundo do tubo mergulhado na solução de Chelex-100. </li><li> Incubar as amostras durante 15 min a 56 ° C. </li><li> Brevemente Vortex e girar o conteúdo do tubo. </li><li> Incubar as amostras durante 8 minutos a 100 ° C. </li><li> Gire as amostras a 15.000 xg por 3 min. </li><li> Use as supernatant para genotipagem subseqüente. </li></ol> 5. Molecular Determinação do Sexo <ol><li> Prepare um tubo PCR com 6 premix mL por amostra, mais dois tubos adicionais para o negativo (obrigatório) e controle positivo (opcional). Para a determinação do sexo de rotina incluem uma amostra a partir da última sexagem sucesso como um controlo positivo. </li><li> Adicionar 19 mL do sobrenadante a partir da extracção de ADN para a pré-mistura de PCR. Certifique-se de pipeta da superfície da solução para evitar a transição de contas Chelex. Isto é crucial, como Chelex é um permutador de catiões e, assim, inibe severamente todas as reacções enzimáticas. </li><li> Executar o seguinte programa de PCR: A incubação a 94 ° C durante 3 min, 45 ciclos cada um com um passo de fusão de 30 seg 94 ° C, seguido por um passo de emparelhamento de 30 segundos a 55 ° C, seguido por um passo de alongamento de 45 segundos a 72 ° C. Em uma etapa final perseguição fora, as reacções são incubadas durante 5 min a 72 ° C. </li><li> Prepare uma TBE padrão de 2% ou TAE agaro<html> si em gel para separar os produtos de PCR. </li><li> Execute o gel de agarose com configurações adequadas de tensão. </li><li> Visualize as bandas sob luz UV e tirar uma foto. Certifique-se que as duas bandas nas amostras provenientes de fêmeas são bem separados. </li><li> Distinguir masculino a partir de amostras do sexo feminino pela presença de um dois (feminino) bandas (masculino) ou. </li></ol> 6. Marcação Filhotes <ol><li> Verifique ninhos para pintos recém-nascidos em um apropriado cronograma para a espécie / estudo (por exemplo, verificações diárias no período da manhã são aconselhados como a maioria dos filhotes nascem em seguida). </li><li> Corte as penas para baixo de cada garota dentro de um ninho em um local característica diferente. Em tentilhões-zebra tufos de penas crescer em quatro áreas característicos e distintos em todo o corpo (Figura 4A) do filhote. Para cada pinto cortar uma área (Figura 4B). Se houver mais de quatro filhotes dentro de um ninho, os quatro &#39;haircuts&#39; exclusivos podem ser combinados. </li></ol>ove_content &quot;&gt; Para tentilhões-zebra: Aplicar anilhas em dez dias após a eclosão, quando estabelece penas tornam-se difíceis de detectar e tamanho filhote permite tocar.

<ol>
	<li>Russell, W. M. S., Burch, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+principles+of+humane+experimental+technique.">The principles of humane experimental technique.</a> , (1959).</li><li>Robertson, B. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+sexing+of+individual+kakapo,+Strigops+habroptilus+Aves,+from+feces.">Molecular sexing of individual kakapo, Strigops habroptilus Aves, from feces.</a> Mol. Ecol. 8, 1349-1350 (1999).</li><li>Yannic, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Description+of+microsatellite+markers+and+genotyping+performances+using+feathers+and+buccal+swabs+for+the+Ivory+gull+(Pagophila+eburnea).">Description of microsatellite markers and genotyping performances using feathers and buccal swabs for the Ivory gull (Pagophila eburnea).</a> Mol. Ecol. Resour. 11, 877-889 (2011).</li><li>Bello, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+genomic+DNA+from+feathers.">Isolation of genomic DNA from feathers.</a> J. Vet. Diagn. Invest. 13, 162-164 (2001).</li><li>Handel, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+buccal+swabs+for+sampling+DNA+from+nestling+and+adult+birds.">Use of buccal swabs for sampling DNA from nestling and adult birds.</a> Wildl. Soc. Bull. 34, 1094-1100 (2006).</li><li>Brubaker, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+noninvasive,+direct+real-time+PCR+method+for+sex+determination+in+multiple+avian+species.">A noninvasive, direct real-time PCR method for sex determination in multiple avian species.</a> Mol. Ecol. Resour. 11, 415-417 (2011).</li><li>Arima, H., Ohnishi, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Usefulness+of+avian+buccal+cells+for+molecular+sexing.">Usefulness of avian buccal cells for molecular sexing.</a> Ornithological Science. 5, 139-143 (2006).</li><li>Seki, S. -. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+sexing+of+individual+Ryukyu+Robins+Erithacus+komadori+using+buccal+cells+as+a+non-invasive+source+of+DNA.">Molecular sexing of individual Ryukyu Robins Erithacus komadori using buccal cells as a non-invasive source of DNA.</a> Ornithological Science. 2, 135-137 (2003).</li><li>Wellbrock, A. H. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Buccal+swabs+as+a+reliable+source+of+DNA+for+sexing+young+and+adult+Common+Swifts+(Apus+apus).">Buccal swabs as a reliable source of DNA for sexing young and adult Common Swifts (Apus apus).</a> J. Ornithol. 153, 991-994 (2012).</li><li>Marion, W. R., Shamis, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Annotated-Bibliography+of+Bird+Marking+Techniques.">Annotated-Bibliography of Bird Marking Techniques.</a> Bird Banding. 48, 42-61 (1977).</li><li>Scharff, C., Adam, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neurogenetics+of+birdsong.">Neurogenetics of birdsong.</a> Curr. Opin. Neurobiol. , (2012).</li><li>Griffith, S. C., Buchanan, K. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Zebra+Finch:+the+ultimate+Australian+supermodel.">The Zebra Finch: the ultimate Australian supermodel.</a> Emu. 110, 5-12 (2010).</li><li>Fee, M. S., Scharff, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+songbird+as+a+model+for+the+generation+and+learning+of+complex+sequential+behaviors.">The songbird as a model for the generation and learning of complex sequential behaviors.</a> Ilar J. 51, 362-377 (2010).</li><li>Honarmand, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stressful+dieting:+nutritional+conditions+but+not+compensatory+growth+elevate+corticosterone+levels+in+zebra+finch+nestlings+and+fledglings.">Stressful dieting: nutritional conditions but not compensatory growth elevate corticosterone levels in zebra finch nestlings and fledglings.</a> PLoS On. 5, (1371).</li><li>Krause, E. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebra+finch+nestlings+beg+more+under+better+nutritional+conditions.">Zebra finch nestlings beg more under better nutritional conditions.</a> Behaviour. 148, 1239-1255 (2011).</li><li>Griffiths, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+DNA+test+to+sex+most+birds.">A DNA test to sex most birds.</a> Mol. Ecol. 7, 1071-1075 (1998).</li><li>Pluthero, F. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+purification+of+high-activity+Taq+DNA+polymerase.">Rapid purification of high-activity Taq DNA polymerase.</a> Nucleic Acids Res. 21, 4850-4851 (1993).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Joint+Working+Group+on+Refinement.+Laboratory+birds:+refinements+in+husbandry+and+procedures.+Fifth+report+of+BVAAWF/FRAME/RSPCA/UFAW+Joint+Working+Group+on+Refinement.">Joint Working Group on Refinement. Laboratory birds: refinements in husbandry and procedures. Fifth report of BVAAWF/FRAME/RSPCA/UFAW Joint Working Group on Refinement.</a> Lab Anim. 35, 1-163 (2001).</li></ol>

Os autores não têm nada a revelar.

Sexagem de zaragatoas bucais utilizando Chelex mostrou um alto índice de sucesso. Para baixo penas de corte do hatchling permitiu a diferenciação entre filhotes até que a perna bandas era possível. Extração Chelex-DNA a partir de zaragatoas bucais rendeu DNA suficiente para realizar com êxito a sexagem molecular. A determinação do sexo foi de 100% correta, conforme validado pela plumagem dimorfismo sexual. A taxa de sucesso relatado aqui é significativamente maior do que a taxa re...

O reconhecimento individual, sexagem e genotipagem são pré-requisitos fundamentais em uma variedade de estudos experimentais. Obtenção de material com DNA e marcação assuntos de forma inequívoca (mesmo em tenra idade) deve ter um impacto mínimo sobre a fisiologia, comportamento e sobrevivência. Sempre que possível, os procedimentos invasivos deve ser evitada de acordo com o princípio da RRR 1. Os métodos não-invasivos não são apenas benéfico para o animal, mas também pode melhorar os dados obtidos como os animais são menos afetadas pelos tratamentos. Nas aves, sexagem de DNA pode ser executada em uma série de materiais obtidos não invasiva como excrementos 2, 3,4 ou penas zaragatoas bucais 3,5,9. Independentemente do estado e idade swabs bucais do sujeito são o método de escolha para a sexagem das aves, porque são fáceis de executar, raramente falham e manuseio é curto. Até agora, o DNA de swabs bucaisou foi extraído com kits disponíveis no mercado 3,6 ou demoradas protocolos de extração de DNA padrão 3,6-8. Kits não são apenas um pouco caro, mas os protocolos podem impor desafios para o trabalho de campo. Alguns detalhes do procedimento, por exemplo, de secagem e de incubação de amostras, não são práticos na área. Especialmente em um ambiente onde protocolos experimentais requerem tratamento dependente sexo já a partir de alguns minutos após a eclosão, há exortar por um método rápido, não-invasivo, confiável e fácil de obter resultados. Do outro lado da taxa aviária uma caixa de ferramentas considerável para os indivíduos de marcação foi desenvolvido 10. A grande variedade de técnicas disponíveis explica a variedade de objetivos de pesquisa, espécies e orçamentos. No entanto, a marcação das pequenas filhotes confrontou pesquisadores com desafios adicionais. Em algumas espécies (por exemplo, passerines) pintos são demasiado pequena para aplicar bandas de perna e requerem métodos alternativos, quenão alteram o comportamento de pais e filhos. Enquanto a consciência e interesse em melhorar o bem-estar e técnicas em estudos de campo e de laboratório animais está crescendo, o uso de técnicas não-invasivas é fortemente encorajado e preferencial. Este protocolo fornece um método não-invasivo, rápido e facilmente reconhecível e persistente para marcar individualmente muito jovens filhotes antes de aplicar bandas de perna é viável. Este método de marcação é introduzido em uma das espécies de aves modelo de laboratório mais importantes, a Zebra Finch (Taeniopygia guttata) 11-13. O protocolo em conformidade com todos os objectivos previamente publicados para as técnicas de marcação individuais 10 e já foi aplicada com êxito 14,15.

<table border="0" cellpadding="0" cellspacing="0" width="702">
	<tbody>
		<tr height="75">
			<td height="75" style="height:75px;width:191px;">Whatman 3MM Chromatography paper</td>
			<td style="width:163px;">e.g. Fisher Scientific</td>
			<td style="width:269px;">No.:3030-153</td>
			<td style="width:80px;"></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:191px;">Chelex 100 Resin</td>
			<td style="width:163px;">Biorad</td>
			<td style="width:269px;">#143-2832</td>
			<td></td>
		</tr>
		<tr height="50">
			<td height="50" style="height:50px;width:191px;">Taq polymerase</td>
			<td style="width:163px;">addgene</td>
			<td style="width:269px;">http://www.addgene.org/25712/</td>
			<td></td>
		</tr>
		<tr height="75">
			<td height="75" style="height:75px;width:191px;">leg band (Flexi number rings for birds, diameter 2,5 mm)</td>
			<td style="width:163px;">Horst Stengel &#38; Sohn</td>
			<td style="width:269px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

who is who? non-invasive methods to individually sex and mark altricial chicks

Muitos experimentos exigem determinação precoce do sexo do filho, bem como início de marcação de recém-nascidos para o reconhecimento individual. De acordo com as diretrizes de bem-estar animal, devem ser preferidos sempre que aplicável técnicas não invasivas. Em nosso grupo, nós trabalhamos em diferentes espécies de pássaros da canção no laboratório e no campo, e aplicar com êxito métodos não-invasivos para sexo e individualmente marcar pintos. Este trabalho apresenta uma abrangente ferramenta de caixa não-invasiva. Sexagem aves antes da expressão de características sexuais secundárias exige a coleta de material de suporte de DNA para PCR. Nós estabelecemos um método rápido e fácil para as aves do sexo de qualquer idade (pós eclosão) por extração de DNA a partir de zaragatoas bucais. Os resultados podem ser obtidos em 3 horas. Por baixo do bico penas marcação indivíduo são cortados em padrões específicos que permitam identificar rapidamente dentro da ordem de eclosão. Este conjunto de métodos é facilmente aplicável em um laboratório padrão equipada e especialmente adequado para trabalhandog no campo como nenhum equipamento especial é necessário para a amostragem e armazenamento. Manipulação de pintos é minimizado e técnicas de marcação e sexagem não são invasivos apoiando assim o RRR-princípio de diretrizes de bem-estar animal.

<html> Cotonetes bucais podem ser usadas para obter DNA para a determinação do sexo em uma variedade de aves pequenas Foram coletadas amostras de Passarinhos da zebra (Taeniopygia guttata, 99 indivíduos, idade 0 dias - 5 anos), Canárias (Serinus canaria), Bengalese Passarinhos (Lonchura striata), rouxinóis (Luscinia megarhynchos), Great Tits (Parus major) e melros (Turdus merula) (para todas as outras espécies: tamanho da amostra 1-3, d...

Watch this Scientific Journal Video about Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks at JoVE.com

Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks

Este protocolo fornece um conjunto conveniente de métodos, que permite extremamente rápido, fácil, não-invasivo, confiável e de baixo custo, a determinação do sexo molecular de aves e sua não-invasivo, rápido, seguro e facilmente reconhecível marcando logo após a eclosão. É necessária apenas a manipulação limitado de pintos. Esta caixa de ferramentas conveniente de métodos cumpre totalmente com as diretrizes-RRR.

Quem é Quem? Métodos não-invasivos para Individualmente Sexo e Mark altriciais Chicks

Many experiments require early determination of offspring's sex as well as early marking of newborns for individual recognition. According to animal ...

who-is-who-non-invasive-methods-to-individually-sex-mark-altricial

Research

JoVE Journal

Biology

18.2K visualizações.  Freie Universität Berlin.  Este protocolo fornece um conjunto conveniente de métodos, que permite extremamente rápido, fácil, não-invasivo, confiável e de baixo custo, a determinação do sexo molecular de aves e sua não-invasivo, rápido, seguro e facilmente reconhecível marcando logo após a eclosão. É necessária apenas a manipulação limitado de pintos. Esta caixa de ferramentas conveniente de métodos cumpre totalmente com as diretrizes-RRR. 

Vídeo: Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks

Labeling hESCs and hMSCs with Iron Oxide Nanoparticles for Non-Invasive in vivo Tracking with MR Imaging

In recent years, stem cell research has led to a better understanding of developmental biology, various diseases and its potential impact on regenerative medicine. A non-invasive method to monitor the transplanted stem cells repeatedly in vivo would greatly enhance our ability to understand the mechanisms that control stem cell death and identify trophic factors and signaling pathways that improve stem cell engraftment. MR imaging has been proven to be an effective tool for the in vivo depiction of stem cells with near microscopic anatomical resolution. In order to detect stem cells with MR, the cells have to be labeled with cell specific MR contrast agents. For this purpose, iron oxide nanoparticles, such as superparamagnetic iron oxide particles (SPIO), are applied, because of their high sensitivity for cell detection and their excellent biocompatibility. SPIO particles are composed of an iron oxide core and a dextran, carboxydextran or starch coat, and function by creating local field inhomogeneities, that cause a decreased signal on T2-weighted MR images. This presentation will demonstrate techniques for labeling of stem cells with clinically applicable MR contrast agents for subsequent non-invasive in vivo tracking of the labeled cells with MR imaging.

For the evaluation of new stem cell therapies it is important to non-invasively track the injected cells in vivo. This video will show you how to label human mesenchymal and embryonic stem cells with iron oxide based contrast agents in vivo for subsequent MR imaging in vivo.

Rotulagem e hESCs hMSCs com óxido de ferro nanopartículas para Não-invasiva em Rastreamento vivo com ressonância magnética

In recent years, stem cell research has led to a better understanding of developmental biology, various diseases and its potential impact on regenerative ...

Biologia

Labeling Stem Cells with Fluorescent Dyes for non-invasive Detection with Optical Imaging

Optical imaging (OI) is an easy, fast and inexpensive tool for in vivo monitoring of new stem cell based therapies. The technique is based on ex vivo labeling of stem cells with a fluorescent dye, subsequent intravenous injection of the labeled cells and visualization of their accumulation in specific target organs or pathologies. The presented technique demonstrates how we label human mesenchymal stem cells (hMSC) by simple incubation with the lipophilic fluorescent dye DiD (C67H103CIN2O3S) and how we label human embryonic stem cells (hESC) with the FDA approved fluorescent dye Indocyanine Green (ICG). The uptake mechanism is via adherence and diffusion of the lypophilic dye across the phospholipid cell membrane bilayer. The labeling efficiency is usually improved if the cells are incubated with the dye in serum-free media as opposed to incubation in serum-containing media. Furthermore, the addition of the transfection agent Protamine Sulfate significantly improves contrast agent uptake.

This video shows techniques for labeling of human embryonic stem cells and mesenchymal stem cells with fluorescent dyes. This technique can be used for an in vivo tracking of transplanted stem cells with optical imaging and for histopathological correlations with fluorescence microscopy.

Rotulagem células-tronco com corantes fluorescentes para detecção não invasiva com imagens ópticas

Optical imaging (OI) is an easy, fast and inexpensive tool for in vivo monitoring of new stem cell based therapies. The technique is based on ex vivo ...

Non-invasive 3D-Visualization with Sub-micron Resolution Using Synchrotron-X-ray-tomography

Little is known about the internal organization of many micro-arthropods with body sizes below 1 mm. The reasons for that are the small size and the hard cuticle which makes it difficult to use protocols of classical histology. In addition, histological sectioning destroys the sample and can therefore not be used for unique material. Hence, a non-destructive method is desirable which allows to view inside small samples without the need of sectioning.
We used synchrotron X-ray tomography at the European Synchrotron Radiation Facility (ESRF) in Grenoble (France) to non-invasively produce 3D tomographic datasets with a pixel-resolution of 0.7&micro;m. Using volume rendering software, this allows us to reconstruct the internal organization in its natural state without the artefacts produced by histological sectioning. These date can be used for quantitative morphology, landmarks, or for the visualization of animated movies to understand the structure of hidden body parts and to follow complete organ systems or tissues through the samples.

We used synchrotron X-ray tomography at the European Synchrotron Radiation Facility (ESRF) to non-invasively produce 3D tomographic datasets with a pixel-resolution of 0.7&micro;m. Using volume rendering software, this allows the reconstruction of internal structures in their natural state without the artefacts produced by histological sectioning.

Não-invasivo 3D Visualization com Sub-micron Resolução Usando Síncrotron-X-ray-tomografia

Little is known about the internal organization of many micro-arthropods with body sizes below 1 mm. The reasons for that are the small size and the hard ...

A Magnetic Tether System to Investigate Visual and Olfactory Mediated Flight Control in Drosophila

It has been clear for many years that insects use visual cues to stabilize their heading in a wind stream. Many animals track odors carried in the wind. As such, visual stabilization of upwind tracking directly aids in odor tracking. But do olfactory signals directly influence visual tracking behavior independently from wind cues? Also, the recent deluge of research on the neurophysiology and neurobehavioral genetics of olfaction in Drosophila has motivated ever more technically sophisticated and quantitative behavioral assays. Here, we modified a magnetic tether system originally devised for vision experiments by equipping the arena with narrow laminar flow odor plumes. A fly is glued to a small steel pin and suspended in a magnetic field that enables it to yaw freely. Small diameter food odor plumes are directed downward over the fly s head, eliciting stable tracking by a hungry fly. Here we focus on the critical mechanics of tethering, aligning the magnets, devising the odor plume, and confirming stable odor tracking.

Here we describe how to tether a fly in an olfactory magnetic-tether (OMT) apparatus. We describe how to align the rare-earth magnets and odor ports, and how to set mass flow rates for both the stimulus delivery and vacuum suction to achieve optimal odor tracking.

Um sistema de acoplamento magnético para Investigar controle de vôo visual e olfativo Mediated em Drosophila

It has been clear for many years that insects use visual cues to stabilize their heading in a wind stream. Many animals track odors carried in the wind. ...

Cell Block Preparation from Cytology Specimen with Predominance of Individually Scattered Cells

This video demonstrates Shidham's method for preparation of cell blocks from liquid based cervicovaginal cytology specimens containing individually scattered cells and small cell groups. This technique uses HistoGel (Thermo Scientific) with conventional laboratory equipment.
The use of cell block sections is a valuable ancillary tool for evaluation of non-gynecologic cytology. They enable the cytopathologist to study additional morphologic specimen detail including the architecture of the lesion. Most importantly, they allow for the evaluation of ancillary studies such as immunocytochemistry, in-situ hybridization tests (FISH/CISH) and in-situ polymerase chain reaction (PCR). Traditional cell block preparation techniques have mostly been applied to non-gynecologic cytology specimens, typically for body fluid effusions and fine needle aspiration biopsies.
Liquid based cervicovaginal specimens are relatively less cellular than their non-gynecologic counterparts with many individual scattered cells. Because of this, adequate cellularity within the cell block sections is difficult to achieve. In addition, the histotechnologist sectioning the block cannot visualize the level at which the cells are at the highest concentration. Therefore, it is difficult to monitor the appropriate level at which sections can be selected to be transferred to the glass slides for testing. As a result, the area of the cell block with the cells of interest may be missed, either by cutting past or not cutting deep enough. Current protocol for Shidham's method addresses these issues. Although this protocol is standardized and reported for gynecologic liquid based cytology specimens, it can also be applied to non-gynecologic specimens such as effusion fluids, FNA, brushings, cyst contents etc for improved quality of diagnostic material in cell block sections.

Shidham's method for preparation of cell blocks with AV-marker from cytology specimens containing individually scattered cells and small cell groups.

Preparação Cell Block da amostra citologia com predomínio de células individualmente Scattered

This video demonstrates Shidham's method for preparation of cell blocks from liquid based cervicovaginal cytology specimens containing individually ...

A Practical Approach to Genetic Inducible Fate Mapping: A Visual Guide to Mark and Track Cells In Vivo

Fate maps are generated by marking and tracking cells in vivo to determine how progenitors contribute to specific structures and cell types in developing and adult tissue. An advance in this concept is Genetic Inducible Fate Mapping (GIFM), linking gene expression, cell fate, and cell behaviors in vivo, to create fate maps based on genetic lineage.
GIFM exploits X-CreER lines where X is a gene or set of gene regulatory elements that confers spatial expression of a modified bacteriophage protein, Cre recombinase (CreERT). CreERT contains a modified estrogen receptor ligand binding domain which renders CreERT sequestered in the cytoplasm in the absence of the drug tamoxifen. The binding of tamoxifen releases CreERT, which translocates to the nucleus and mediates recombination between DNA sequences flanked by loxP sites. In GIFM, recombination typically occurs between a loxP flanked Stop cassette preceding a reporter gene such as GFP.
Mice are bred to contain either a region- or cell type-specific CreER and a conditional reporter allele. Untreated mice will not have marking because the Stop cassette in the reporter prevents further transcription of the reporter gene. We administer tamoxifen by oral gavage to timed-pregnant females, which provides temporal control of CreERT release and subsequent translocation to the nucleus removing the Stop cassette from the reporter. Following recombination, the reporter allele is constitutively and heritably expressed. This series of events marks cells such that their genetic history is indelibly recorded. The recombined reporter thus serves as a high fidelity genetic lineage tracer that, once on, is uncoupled from the gene expression initially used to drive CreERT.
We apply GIFM in mouse to study normal development and ascertain the contribution of genetic lineages to adult cell types and tissues. We also use GIFM to follow cells on mutant genetic backgrounds to better understand complex phenotypes that mimic salient features of human genetic disorders.
This video article guides researchers through experimental methods to successfully apply GIFM. We demonstrate the method using our well characterized Wnt1-CreERT;mGFP mice by administering tamoxifen at embryonic day (E)8.5 via oral gavage followed by dissection at E12.5 and analysis by epifluorescence stereomicroscopy. We also demonstrate how to micro-dissect fate mapped domains for explant preparation or FACS analysis and dissect adult fate-mapped brains for whole mount fluorescent imaging. Collectively, these procedures allow researchers to address critical questions in developmental biology and disease models.

A Practical Approach to Genetic Inducible Fate Mapping: A Visual Guide to Mark and Track Cells In Vivo

Genetic Inducible Fate Mapping (GIFM) marks and tracks cells with fine spatial and temporal control in vivo and elucidates how cells from a specific genetic lineage contribute to developing and adult tissues. Demonstrated here are the techniques required to fate map E12.5 mouse embryos for epifluorescent and explant analysis.

Uma Abordagem Prática para mapeamento genético induzível Fate: Um Guia Visual para Mark e Track Células In Vivo</em

Fate maps are generated by marking and tracking cells in vivo to determine how progenitors contribute to specific structures and cell types in developing ...

A Reversible, Non-invasive Method for Airway Resistance Measurements and Bronchoalveolar Lavage Fluid Sampling in Mice

Airway hyperreactivity (AHR) measurements and bronchoalveolar lavage (BAL) fluid sampling are essential to experimental asthma models, but repeated procedures to obtain such measurements in the same animal are generally not feasible.  Here, we demonstrate protocols for obtaining from mice repeated measurements of AHR and bronchoalveolar lavage fluid samples.  Mice were challenged intranasally seven times over 14 days with a potent allergen or sham treated.  Prior to the initial challenge, and within 24 hours following each intranasal challenge, the same animals were anesthetized, orally intubated and mechanically ventilated.  AHR, assessed by comparing dose response curves of respiratory system resistance (RRS) induced by increasing intravenous doses of acetylcholine (Ach) chloride between sham and allergen-challenged animals, were determined.  Afterwards, and via the same intubation, the left lung was lavaged so that differential enumeration of airway cells could be performed.  These studies reveal that repeated measurements of AHR and BAL fluid collection are possible from the same animals and that maximal airway hyperresponsiveness and airway eosinophilia are achieved within 7-10 days of initiating allergen challenge.  This novel technique significantly reduces the number of mice required for longitudinal experimentation and is applicable to diverse rodent species, disease models and airway physiology instruments.  

Repeated measurements of rodent respiratory physiology and sampling of airway inflammatory cells are desirable, but generally not feasible. Here we describe a repeatable method for orally intubating mice that permits repeated measurements of airway hyperreactivity and sampling of airway inflammatory cells.

A reversível, método não-invasivo para medições de Resistência das Vias Aéreas e Amostragem Líquido da Lavagem Broncoalveolar em Ratos

Airway hyperreactivity (AHR) measurements and bronchoalveolar lavage (BAL) fluid sampling are essential to experimental asthma models, but repeated ...

Fecal Glucocorticoid Analysis: Non-invasive Adrenal Monitoring in Equids

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, corticotrophin releasing hormone (CRH) is released from the hypothalamus in the brain. This stimulates the release of adrenocorticotrophic hormone (ACTH) from the pituitary gland, which in turn stimulates release of glucocorticoids from the adrenal gland. In horses the glucocorticoid corticosterone is responsible for several adaptations needed to support equine flight behaviour and subsequent removal from the aversive situation. Corticosterone metabolites can be detected in the feces of horses and assessment offers a non-invasive option to evaluate long term patterns of adrenal activity. Fecal assessment offers advantages over other techniques that monitor adrenal activity including blood plasma and saliva analysis. The non-invasive nature of the method avoids sampling stress which can confound results. It also allows the opportunity for repeated sampling over time and is ideal for studies in free ranging horses. This protocol describes the enzyme linked immunoassay (EIA) used to assess feces for corticosterone, in addition to the associated biochemical validation.

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. The method offers a non-invasive option to assess long term patterns in both domestic and free ranging horses. This protocol describes the enzyme linked immunoassay involved and the associated biochemical validation.

Fecal Análise de glicocorticóides: Non-invasive Monitoring Adrenal em eqüídeos

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, ...

Methods to Discover Alternative Promoter Usage and Transcriptional Regulation of Murine Bcrp1

Gene expression in different tissues is often controlled by alternative promoters that result in the synthesis of mRNA with unique &#8212; usually untranslated &#8212; first exons. Bcrp1 (Abcg2), the murine orthologue of the ABC transporter Breast Cancer Resistance Protein (BCRP, ABCG2), has at least four alternative promoters that are designated by the corresponding four alternative first exons produced: E1U, E1A, E1B, and E1C. Herein, in-silico protocols are presented to predict alternative promoter usage for Bcrp1. Furthermore, reporter assay methods are described to produce reporter constructs for alternative promoters and to determine the functionality of putative promoters upstream of the alternative first exons that are identified.

With the murine ABC transporter Bcrp1 (Abcg2) as an example, in-silico protocols are presented to detect alternative promoter usage in genes expressed in mouse tissues, and to evaluate the functionality of the alternative promoters identified using reporter assays.

Métodos para descobrir Uso Promotor Alternativa e regulação da transcrição de Murino Bcrp1

Gene expression in different tissues is often controlled by alternative promoters that result in the synthesis of mRNA with unique &#8212; usually ...

Methods to Classify Cytoplasmic Foci as Mammalian Stress Granules

Cells are often challenged by sudden environmental changes. Stress Granules (SGs), cytoplasmic ribonucleoprotein complexes that form in cells exposed to stress conditions, are implicated in various aspects of cell metabolism and survival. SGs modulate cellular signaling pathways, post-transcriptional gene expression, and stress response programs. The formation of these mRNA-containing granules is directly connected to cellular translation. SG assembly is triggered by inhibited translation initiation, and SG disassembly is promoted by translation activation or by inhibited translation elongation. This relationship is further highlighted by SG composition. Core SG components are stalled translation pre-initiation complexes, mRNA, and selected RNA-binding Proteins (RBPs). The purpose of SG assembly is to conserve cellular energy by sequestering translationally stalled housekeeping mRNAs, allowing for the enhanced translation of stress-responsive proteins. In addition to the core constituents, such as stalled translation preinitiation complexes, SGs contain a plethora of other proteins and signaling molecules. Defects in SG formation can impair cellular adaptation to stress and can thus promote cell death. SGs and similar RNA-containing granules have been linked to a number of human diseases, including neurodegenerative disorders and cancer, leading to the recent interest in classifying and defining RNA granule subtypes. This protocol describes assays to characterize and quantify mammalian SGs.

Stress Granules (SGs) are nonmembranous cytoplasmic structures that form in cells exposed to a variety of stresses. SGs contain mRNAs, RNA-binding proteins, small ribosomal subunits, translation-related factors, and various cell signaling proteins. This protocol describes a workflow that uses several experimental approaches to detect, characterize, and quantify bona fide SGs.

Métodos para classificar os focos citoplasmáticos como grânulos de estresse de mamíferos

Cells are often challenged by sudden environmental changes. Stress Granules (SGs), cytoplasmic ribonucleoprotein complexes that form in cells exposed to ...