Molte grazie a Silke Kipper, Sarah Kiefer, Michael Weiss, Conny Bartsch e Silke Voigt-Heucke per la raccolta del campione entusiasta nel campo, per Janett Birkenfeld per l&#39;assistenza continua, a Ulla Kobalz per le belle gel e Tobias Krause per il supporto morale.

Tutte le procedure sono state eseguite in conformità alla legge tedesca per la protezione degli animali (TierSchG). 1. Preparazione dei reagenti e materiali di consumo <ol><li> Preparare un 5% (w / w) Chelex-100 soluzione in acqua di grado molecolare. Preparare aliquote di 200 ml in provette da 1,5 ml standard. Come resina Chelex precipita rapidamente dalla sospensione è necessario ri-omogeneizzare la sospensione costantemente durante la preparazione delle aliquote. È consigliabile preparare almeno 50 ml in una partita e mantenere la sospensione omogeneizzata con un agitatore magnetico. La soluzione Chelex può essere conservato per anni in condizioni ambiente. </li><li> Tagliare pezzi di carta Whatman con una larghezza inferiore alla larghezza becco dell&#39;uccello da testare. La lunghezza della carta dipende dal metodo di prelevare il campione: <ol><li> Utilizzando pinze, il pezzo dovrebbe essere abbastanza lungo da permettere la raccolta del campione, senza la pinza essere inseriti nel becco dell&#39;uccello. Comestima approssimativa, per una lunghezza di 0,5 cm becco un pezzo di carta con la lunghezza di 1 cm dovrebbe andare bene. </li><li> Se non usando pinze, il pezzo deve essere più lungo, ma la rigidità del pezzo dovrebbe ancora permettere il campionamento delle cellule epiteliali. </li></ol></li><li> Preparare una aliquota della premiscela PCR per ciascun campione da analizzare. Per una PCR in un volume totale di 25 microlitri della miscela contenente 0.18 mM dNTPs, 2 mM MgCl 2, 70 mM Tris-HCl, 17,25 mM di solfato di ammonio, 0,1% Tween-20, 0,32 mM P2 Primer (TCTGCATCGCTAAATCCTTT), 0,32 mM P8 Primer (CTCCCAAGGATGAGRAAYTG) 16 e 2 unità di Taq polimerasi. Casalinga Taq polimerasi 17 può essere utilizzato. Per consentire l&#39;aggiunta della quantità massima di DNA-soluzione, una premiscela 6 microlitri può essere preparato e conservato a -20 ° C per diverse settimane. </li></ol> 2. Raccolta dei campioni Indossare guanti non è essenziale per la determinazione del sesso aviaria come primer PCR non possono ricombinarsi di DNA umano. Peraltri fini di genotipizzazione che potrebbe essere consigliabile. <ol><li> Cattura l&#39;uccello di interesse e delicatamente tenerlo in una mano ad esempio con la &#39;presa di suoneria&#39; 18. Assicurarsi di non spremere l&#39;uccello. </li><li> Tenere un pezzo di carta Whatman con una pinza e sfiorare più volte attraverso la parte interna delle guance, la lingua e la choana. Solitamente i campioni sono ottenuti in meno di 30 secondi. <ol><li> Animali adulti: a seconda della specie potrebbe essere difficile ottenere l&#39;uccello per aprire il becco. Solitamente toccare il lato del becco e applicando una leggera pressione funzionerà. </li><li> Nidiacei: Campionamento da larve o nidiacei è particolarmente facile usando questa tecnica, in quanto il loro comportamento accattonaggio offre un facile accesso all&#39;interno del becco. Potrebbe anche essere possibile avere il campione senza gestire loro a tutti, in quanto facilmente pregano per esempio quando il loro nido è aperto. </li></ol></li><li> Immediatamente conservare la carta in un preparato conte tubo di reazionening 200 microlitri del 5% (w / w) Chelex-100 soluzione. </li></ol> Se si intende inoltre / bisogno di segnare i pulcini, farlo ora come descritto nel capitolo 6. 3. Conservazione dei campioni prima estrazione del DNA <ol><li> Se lavorano in laboratorio, conservare i campioni a -20 ° C. Se ciò non è possibile o difficile (ad esempio nel campo) conservare i campioni a temperatura ambiente. </li><li> I campioni possono essere conservati per più di 3 anni a temperature comprese tra temperatura ambiente a -20 ° C. </li></ol> Estrazione del DNA 4. <ol><li> Se il campione è congelato, scongelare a temperatura ambiente. </li><li> Assicurarsi che il pezzo di carta è sul fondo del tubo sommerso nella soluzione Chelex-100. </li><li> Incubare campioni per 15 min a 56 ° C. </li><li> Vortex brevemente e centrifugare il contenuto del tubo. </li><li> Incubare i campioni per 8 min a 100 ° C. </li><li> Centrifugare i campioni a 15.000 xg per 3 min. </li><li> Utilizzare le supernatant per la successiva genotipizzazione. </li></ol> 5. Molecolare Sex Determinazione <ol><li> Preparare un tubo PCR con 6 ml premiscelato per campione, più due tubi supplementari per il negativo (obbligatorio) e positivo di controllo (facoltativo). Per la determinazione del sesso di routine su un campione dall&#39;ultimo sessaggio successo come controllo positivo. </li><li> Aggiungere 19 ml di surnatante dall&#39;estrazione del DNA alla premiscela PCR. Assicurati di pipetta dalla superficie della soluzione per evitare riporto di Chelex perline. Questo è fondamentale, come Chelex è uno scambiatore di cationi e quindi inibisce fortemente tutte le reazioni enzimatiche. </li><li> Eseguire il seguente programma PCR: incubazione a 94 ° C per 3 min, 45 cicli ciascuno con una fusione 30 sec fase 94 ° C, seguita da una fase di ricottura 30 sec a 55 ° C, seguita da un allungamento passo 45 sec a 72 ° C. In una fase finale chase off, le reazioni vengono incubate per 5 minuti a 72 ° C. </li><li> Preparare un TBE standard di 2% o TAE agaro<html> SE gel per separare i prodotti di PCR. </li><li> Eseguire il gel di agarosio con le impostazioni di tensione appropriate. </li><li> Visualizza le bande sotto la luce UV e scattare una foto. Assicurarsi che le due bande nei campioni provenienti da femmine sono ben separati. </li><li> Distinguere il maschio dalla femmina campioni dalla presenza di uno (maschio) o due bande (femmina). </li></ol> 6. Marcatura Nestlings <ol><li> Controllare nidi per i pulcini appena nati su un programma appropriato per la specie / studio (ad esempio i controlli giornalieri al mattino sono invitati, come la maggior parte dei pulcini schiudono poi). </li><li> Tagliare le piume di ogni pulcino in un nido in una posizione caratteristica diversa. In fringuelli zebra ciuffi di bassi crescono a quattro zone caratteristiche e distinte in tutto il corpo (Figura 4A) della immerso. Per ogni pulcino tagliare una zona (Figura 4B). Se ci sono più di quattro pulcini all&#39;interno di un nido, le uniche quattro &#39;haircut&#39; possono essere combinati. </li></ol>ove_content &quot;&gt; Per fringuelli zebra: Applicare bande gamba a dieci giorni dopo la schiusa, quando piume diventano difficili da individuare e dimensioni immerso permette di squillare.

<ol>
	<li>Russell, W. M. S., Burch, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+principles+of+humane+experimental+technique.">The principles of humane experimental technique.</a> , (1959).</li><li>Robertson, B. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+sexing+of+individual+kakapo,+Strigops+habroptilus+Aves,+from+feces.">Molecular sexing of individual kakapo, Strigops habroptilus Aves, from feces.</a> Mol. Ecol. 8, 1349-1350 (1999).</li><li>Yannic, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Description+of+microsatellite+markers+and+genotyping+performances+using+feathers+and+buccal+swabs+for+the+Ivory+gull+(Pagophila+eburnea).">Description of microsatellite markers and genotyping performances using feathers and buccal swabs for the Ivory gull (Pagophila eburnea).</a> Mol. Ecol. Resour. 11, 877-889 (2011).</li><li>Bello, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+genomic+DNA+from+feathers.">Isolation of genomic DNA from feathers.</a> J. Vet. Diagn. Invest. 13, 162-164 (2001).</li><li>Handel, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+buccal+swabs+for+sampling+DNA+from+nestling+and+adult+birds.">Use of buccal swabs for sampling DNA from nestling and adult birds.</a> Wildl. Soc. Bull. 34, 1094-1100 (2006).</li><li>Brubaker, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+noninvasive,+direct+real-time+PCR+method+for+sex+determination+in+multiple+avian+species.">A noninvasive, direct real-time PCR method for sex determination in multiple avian species.</a> Mol. Ecol. Resour. 11, 415-417 (2011).</li><li>Arima, H., Ohnishi, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Usefulness+of+avian+buccal+cells+for+molecular+sexing.">Usefulness of avian buccal cells for molecular sexing.</a> Ornithological Science. 5, 139-143 (2006).</li><li>Seki, S. -. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+sexing+of+individual+Ryukyu+Robins+Erithacus+komadori+using+buccal+cells+as+a+non-invasive+source+of+DNA.">Molecular sexing of individual Ryukyu Robins Erithacus komadori using buccal cells as a non-invasive source of DNA.</a> Ornithological Science. 2, 135-137 (2003).</li><li>Wellbrock, A. H. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Buccal+swabs+as+a+reliable+source+of+DNA+for+sexing+young+and+adult+Common+Swifts+(Apus+apus).">Buccal swabs as a reliable source of DNA for sexing young and adult Common Swifts (Apus apus).</a> J. Ornithol. 153, 991-994 (2012).</li><li>Marion, W. R., Shamis, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Annotated-Bibliography+of+Bird+Marking+Techniques.">Annotated-Bibliography of Bird Marking Techniques.</a> Bird Banding. 48, 42-61 (1977).</li><li>Scharff, C., Adam, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neurogenetics+of+birdsong.">Neurogenetics of birdsong.</a> Curr. Opin. Neurobiol. , (2012).</li><li>Griffith, S. C., Buchanan, K. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Zebra+Finch:+the+ultimate+Australian+supermodel.">The Zebra Finch: the ultimate Australian supermodel.</a> Emu. 110, 5-12 (2010).</li><li>Fee, M. S., Scharff, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+songbird+as+a+model+for+the+generation+and+learning+of+complex+sequential+behaviors.">The songbird as a model for the generation and learning of complex sequential behaviors.</a> Ilar J. 51, 362-377 (2010).</li><li>Honarmand, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stressful+dieting:+nutritional+conditions+but+not+compensatory+growth+elevate+corticosterone+levels+in+zebra+finch+nestlings+and+fledglings.">Stressful dieting: nutritional conditions but not compensatory growth elevate corticosterone levels in zebra finch nestlings and fledglings.</a> PLoS On. 5, (1371).</li><li>Krause, E. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebra+finch+nestlings+beg+more+under+better+nutritional+conditions.">Zebra finch nestlings beg more under better nutritional conditions.</a> Behaviour. 148, 1239-1255 (2011).</li><li>Griffiths, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+DNA+test+to+sex+most+birds.">A DNA test to sex most birds.</a> Mol. Ecol. 7, 1071-1075 (1998).</li><li>Pluthero, F. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+purification+of+high-activity+Taq+DNA+polymerase.">Rapid purification of high-activity Taq DNA polymerase.</a> Nucleic Acids Res. 21, 4850-4851 (1993).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Joint+Working+Group+on+Refinement.+Laboratory+birds:+refinements+in+husbandry+and+procedures.+Fifth+report+of+BVAAWF/FRAME/RSPCA/UFAW+Joint+Working+Group+on+Refinement.">Joint Working Group on Refinement. Laboratory birds: refinements in husbandry and procedures. Fifth report of BVAAWF/FRAME/RSPCA/UFAW Joint Working Group on Refinement.</a> Lab Anim. 35, 1-163 (2001).</li></ol>

Gli autori non hanno nulla da rivelare.

Sexing da tamponi buccali utilizzando Chelex hanno mostrato un tasso estremamente elevato di successo. Piume di taglio del hatchling abilitati differenziazione tra nidiacei fino gamba banding era possibile. Estrazione Chelex-DNA dai tamponi buccali ceduto abbastanza DNA per eseguire con successo sessaggio molecolare. Determinazione del sesso è stata del 100% preciso convalidato dal piumaggio dimorfismo sessuale. Il tasso di successo riportato qui è nettamente superiore al tasso riportato d...

Riconoscimento individuale, sessaggio e la genotipizzazione sono requisiti fondamentali in una varietà di studi sperimentali. Ottenere DNA materiale del cuscinetto e marcatura soggetti senza ambiguità (anche in tenera età) dovrebbe avere un impatto minimo sulla fisiologia, il comportamento e la sopravvivenza. Quando possibile, procedure invasive dovrebbero essere evitati secondo il principio RRR 1. Metodi non invasivi non sono solo benefici per l&#39;animale, ma anche potrebbe migliorare i dati ottenuti da animali risentono meno dei trattamenti. Negli uccelli, sessaggio del DNA può essere eseguita su una serie di materiali ottenibili non invasivo come escrementi 2, piume 3,4 o tamponi buccali 3,5,9. Indipendentemente dalla condizione ed età tamponi buccali del soggetto sono il metodo di scelta per sessaggio aviaria, perché sono facili da eseguire, raramente sicuro e la gestione è breve. Finora, il DNA da tamponi buccaliera o estratto con kit disponibili in commercio o 3,6 in termini di tempo protocolli di estrazione del DNA standard di 3,6-8. I kit non solo sono piuttosto costosi, ma i loro protocolli possono imporre sfide per il lavoro sul campo. Alcuni dettagli procedurali, ad esempio l&#39;essiccazione e l&#39;incubazione dei campioni, non sono pratici nel campo. Specialmente in un ambiente dove protocolli sperimentali richiedono sesso trattamento dipende da come presto come pochi minuti dopo la schiusa, c&#39;è sollecitare un metodo rapido, non invasivo, affidabile e facile da ottenere risultati. Dall&#39;altra parte taxa aviaria una notevole toolbox per gli individui di marcatura è stato sviluppato 10. La vasta gamma di tecniche disponibili rappresenta la varietà degli obiettivi della ricerca, delle specie e dei bilanci. Tuttavia, la marcatura piccoli nidiacei ha affrontato ricercatori con ulteriori sfide. In alcune specie (es. passeriformi) pulcini sono troppo piccoli per applicare le bande gambe e richiedono metodi alternativi, chenon alterare il comportamento del genitore-prole. Come la consapevolezza e l&#39;interesse per migliorare il benessere e le tecniche in studi sul campo e di laboratorio sugli animali è in crescita, l&#39;uso di tecniche non invasive è fortemente incoraggiata e preferiva. Questo protocollo fornisce un metodo rapido, facilmente riconoscibile e persistente non invasivo per contrassegnare individualmente molto giovani nidiacei prima di applicare fasce gamba è fattibile. Questo metodo di marcatura viene introdotto in uno dei più importanti specie aviarie modello di laboratorio, la Zebra Finch (Taeniopygia guttata) 11-13. Il protocollo soddisfa tutti gli obiettivi precedentemente pubblicati per singole tecniche di marcatura 10 ed è stata già applicata con successo 14,15.

<table border="0" cellpadding="0" cellspacing="0" width="702">
	<tbody>
		<tr height="75">
			<td height="75" style="height:75px;width:191px;">Whatman 3MM Chromatography paper</td>
			<td style="width:163px;">e.g. Fisher Scientific</td>
			<td style="width:269px;">No.:3030-153</td>
			<td style="width:80px;"></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:191px;">Chelex 100 Resin</td>
			<td style="width:163px;">Biorad</td>
			<td style="width:269px;">#143-2832</td>
			<td></td>
		</tr>
		<tr height="50">
			<td height="50" style="height:50px;width:191px;">Taq polymerase</td>
			<td style="width:163px;">addgene</td>
			<td style="width:269px;">http://www.addgene.org/25712/</td>
			<td></td>
		</tr>
		<tr height="75">
			<td height="75" style="height:75px;width:191px;">leg band (Flexi number rings for birds, diameter 2,5 mm)</td>
			<td style="width:163px;">Horst Stengel &#38; Sohn</td>
			<td style="width:269px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

who is who? non-invasive methods to individually sex and mark altricial chicks

Molti esperimenti richiedono la determinazione precoce del sesso della prole, così come anticipato marcatura dei neonati per il riconoscimento individuale. Secondo le linee guida sul benessere degli animali, tecniche non invasive dovrebbero essere preferiti quando applicabili. Nel nostro gruppo, lavoriamo su diverse specie di uccelli canori in laboratorio e in campo, e ci applichiamo con successo metodi non invasivi al sesso e individualmente segnalo pulcini. Questo articolo presenta una tool-box non invasivo completo. Sexing uccelli prima della espressione dei tratti sessuali secondari richiede la raccolta di materiale DNA-cuscinetto per la PCR. Abbiamo stabilito un metodo rapido e semplice per gli uccelli di sesso di ogni età (post schiusa) estraendo il DNA dai tamponi buccali. I risultati possono essere ottenuti entro 3 ore. Per piume singolo pulcino marcatura sono rivestiti in modelli specifici che consentono di identificare rapidamente all&#39;interno dell&#39;ordine schiusa. Questo insieme di metodi è facilmente applicabile in un laboratorio standard dotato e particolarmente adatto per working nel campo come attrezzatura speciale è richiesta per il campionamento e memorizzazione. Manipolazione dei pulcini è ridotto al minimo e le tecniche di marcatura e sessaggio sono non-invasive sostenendo così il RRR-principio di linee guida sul benessere degli animali.

<html> Tamponi orali possono essere utilizzati per ottenere DNA per la determinazione del sesso in una varietà di piccoli uccelli I campioni sono stati raccolti da diamanti mandarini (Taeniopygia guttata, 99 individui, di età 0 giorni - 5 anni), Canarie (Serinus canaria), bengalesi Fringuelli (Lonchura striata), usignoli (Luscinia megarhynchos), cinciallegre (Parus major) e Merli (Turdus merula) (per tutte le altre specie: dimensione del ca...

Watch this Scientific Journal Video about Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks at JoVE.com

Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks

Questo protocollo fornisce un insieme di metodi conveniente, che consente estremamente veloce, semplice, non invasivo, affidabile ea basso costo, determinazione del sesso molecolare degli uccelli e la loro non-invasivo, rapido, sicuro e facilmente riconoscibile marcatura poco dopo la schiusa. È necessaria solo la gestione limitata dei pulcini. Questo comodo toolbox di metodi del tutto conforme alle RRR linee guida.

Chi è Chi? Metodi non invasivi per Sex autonomamente e Mark altricial Chicks

Many experiments require early determination of offspring's sex as well as early marking of newborns for individual recognition. According to animal ...

who-is-who-non-invasive-methods-to-individually-sex-mark-altricial

Research

JoVE Journal

Biology

18.2K Views.  Freie Universität Berlin.  Questo protocollo fornisce un insieme di metodi conveniente, che consente estremamente veloce, semplice, non invasivo, affidabile ea basso costo, determinazione del sesso molecolare degli uccelli e la loro non-invasivo, rapido, sicuro e facilmente riconoscibile marcatura poco dopo la schiusa. È necessaria solo la gestione limitata dei pulcini. Questo comodo toolbox di metodi del tutto conforme alle RRR linee guida. 

Video: Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks

Labeling hESCs and hMSCs with Iron Oxide Nanoparticles for Non-Invasive in vivo Tracking with MR Imaging

In recent years, stem cell research has led to a better understanding of developmental biology, various diseases and its potential impact on regenerative medicine. A non-invasive method to monitor the transplanted stem cells repeatedly in vivo would greatly enhance our ability to understand the mechanisms that control stem cell death and identify trophic factors and signaling pathways that improve stem cell engraftment. MR imaging has been proven to be an effective tool for the in vivo depiction of stem cells with near microscopic anatomical resolution. In order to detect stem cells with MR, the cells have to be labeled with cell specific MR contrast agents. For this purpose, iron oxide nanoparticles, such as superparamagnetic iron oxide particles (SPIO), are applied, because of their high sensitivity for cell detection and their excellent biocompatibility. SPIO particles are composed of an iron oxide core and a dextran, carboxydextran or starch coat, and function by creating local field inhomogeneities, that cause a decreased signal on T2-weighted MR images. This presentation will demonstrate techniques for labeling of stem cells with clinically applicable MR contrast agents for subsequent non-invasive in vivo tracking of the labeled cells with MR imaging.

For the evaluation of new stem cell therapies it is important to non-invasively track the injected cells in vivo. This video will show you how to label human mesenchymal and embryonic stem cells with iron oxide based contrast agents in vivo for subsequent MR imaging in vivo.

Etichettatura hESC e hMSCs con nanoparticelle di ossido di ferro per i non-invasiva in vivo inseguimento con la RM

In recent years, stem cell research has led to a better understanding of developmental biology, various diseases and its potential impact on regenerative ...

Ricerca

Biologia

Labeling Stem Cells with Fluorescent Dyes for non-invasive Detection with Optical Imaging

Optical imaging (OI) is an easy, fast and inexpensive tool for in vivo monitoring of new stem cell based therapies. The technique is based on ex vivo labeling of stem cells with a fluorescent dye, subsequent intravenous injection of the labeled cells and visualization of their accumulation in specific target organs or pathologies. The presented technique demonstrates how we label human mesenchymal stem cells (hMSC) by simple incubation with the lipophilic fluorescent dye DiD (C67H103CIN2O3S) and how we label human embryonic stem cells (hESC) with the FDA approved fluorescent dye Indocyanine Green (ICG). The uptake mechanism is via adherence and diffusion of the lypophilic dye across the phospholipid cell membrane bilayer. The labeling efficiency is usually improved if the cells are incubated with the dye in serum-free media as opposed to incubation in serum-containing media. Furthermore, the addition of the transfection agent Protamine Sulfate significantly improves contrast agent uptake.

This video shows techniques for labeling of human embryonic stem cells and mesenchymal stem cells with fluorescent dyes. This technique can be used for an in vivo tracking of transplanted stem cells with optical imaging and for histopathological correlations with fluorescence microscopy.

Etichettatura Cellule staminali con le tinture fluorescenti per la rilevazione non invasiva con Optical Imaging

Optical imaging (OI) is an easy, fast and inexpensive tool for in vivo monitoring of new stem cell based therapies. The technique is based on ex vivo ...

Non-invasive 3D-Visualization with Sub-micron Resolution Using Synchrotron-X-ray-tomography

Little is known about the internal organization of many micro-arthropods with body sizes below 1 mm. The reasons for that are the small size and the hard cuticle which makes it difficult to use protocols of classical histology. In addition, histological sectioning destroys the sample and can therefore not be used for unique material. Hence, a non-destructive method is desirable which allows to view inside small samples without the need of sectioning.
We used synchrotron X-ray tomography at the European Synchrotron Radiation Facility (ESRF) in Grenoble (France) to non-invasively produce 3D tomographic datasets with a pixel-resolution of 0.7&micro;m. Using volume rendering software, this allows us to reconstruct the internal organization in its natural state without the artefacts produced by histological sectioning. These date can be used for quantitative morphology, landmarks, or for the visualization of animated movies to understand the structure of hidden body parts and to follow complete organ systems or tissues through the samples.

We used synchrotron X-ray tomography at the European Synchrotron Radiation Facility (ESRF) to non-invasively produce 3D tomographic datasets with a pixel-resolution of 0.7&micro;m. Using volume rendering software, this allows the reconstruction of internal structures in their natural state without the artefacts produced by histological sectioning.

Non invasive di visualizzazione 3D con sub-micron Risoluzione Utilizzando sincrotrone a raggi-X, la tomografia

Little is known about the internal organization of many micro-arthropods with body sizes below 1 mm. The reasons for that are the small size and the hard ...

A Magnetic Tether System to Investigate Visual and Olfactory Mediated Flight Control in Drosophila

It has been clear for many years that insects use visual cues to stabilize their heading in a wind stream. Many animals track odors carried in the wind. As such, visual stabilization of upwind tracking directly aids in odor tracking. But do olfactory signals directly influence visual tracking behavior independently from wind cues? Also, the recent deluge of research on the neurophysiology and neurobehavioral genetics of olfaction in Drosophila has motivated ever more technically sophisticated and quantitative behavioral assays. Here, we modified a magnetic tether system originally devised for vision experiments by equipping the arena with narrow laminar flow odor plumes. A fly is glued to a small steel pin and suspended in a magnetic field that enables it to yaw freely. Small diameter food odor plumes are directed downward over the fly s head, eliciting stable tracking by a hungry fly. Here we focus on the critical mechanics of tethering, aligning the magnets, devising the odor plume, and confirming stable odor tracking.

Here we describe how to tether a fly in an olfactory magnetic-tether (OMT) apparatus. We describe how to align the rare-earth magnets and odor ports, and how to set mass flow rates for both the stimulus delivery and vacuum suction to achieve optimal odor tracking.

Un sistema magnetico Tether per Indagare visivo e olfattivo di controllo mediata Volo in Drosophila

It has been clear for many years that insects use visual cues to stabilize their heading in a wind stream. Many animals track odors carried in the wind. ...

Cell Block Preparation from Cytology Specimen with Predominance of Individually Scattered Cells

This video demonstrates Shidham's method for preparation of cell blocks from liquid based cervicovaginal cytology specimens containing individually scattered cells and small cell groups. This technique uses HistoGel (Thermo Scientific) with conventional laboratory equipment.
The use of cell block sections is a valuable ancillary tool for evaluation of non-gynecologic cytology. They enable the cytopathologist to study additional morphologic specimen detail including the architecture of the lesion. Most importantly, they allow for the evaluation of ancillary studies such as immunocytochemistry, in-situ hybridization tests (FISH/CISH) and in-situ polymerase chain reaction (PCR). Traditional cell block preparation techniques have mostly been applied to non-gynecologic cytology specimens, typically for body fluid effusions and fine needle aspiration biopsies.
Liquid based cervicovaginal specimens are relatively less cellular than their non-gynecologic counterparts with many individual scattered cells. Because of this, adequate cellularity within the cell block sections is difficult to achieve. In addition, the histotechnologist sectioning the block cannot visualize the level at which the cells are at the highest concentration. Therefore, it is difficult to monitor the appropriate level at which sections can be selected to be transferred to the glass slides for testing. As a result, the area of the cell block with the cells of interest may be missed, either by cutting past or not cutting deep enough. Current protocol for Shidham's method addresses these issues. Although this protocol is standardized and reported for gynecologic liquid based cytology specimens, it can also be applied to non-gynecologic specimens such as effusion fluids, FNA, brushings, cyst contents etc for improved quality of diagnostic material in cell block sections.

Shidham's method for preparation of cell blocks with AV-marker from cytology specimens containing individually scattered cells and small cell groups.

Cellule preparazione del blocco da campioni Citologia con predominanza di cellule sparse individualmente

This video demonstrates Shidham's method for preparation of cell blocks from liquid based cervicovaginal cytology specimens containing individually ...

A Practical Approach to Genetic Inducible Fate Mapping: A Visual Guide to Mark and Track Cells In Vivo

Fate maps are generated by marking and tracking cells in vivo to determine how progenitors contribute to specific structures and cell types in developing and adult tissue. An advance in this concept is Genetic Inducible Fate Mapping (GIFM), linking gene expression, cell fate, and cell behaviors in vivo, to create fate maps based on genetic lineage.
GIFM exploits X-CreER lines where X is a gene or set of gene regulatory elements that confers spatial expression of a modified bacteriophage protein, Cre recombinase (CreERT). CreERT contains a modified estrogen receptor ligand binding domain which renders CreERT sequestered in the cytoplasm in the absence of the drug tamoxifen. The binding of tamoxifen releases CreERT, which translocates to the nucleus and mediates recombination between DNA sequences flanked by loxP sites. In GIFM, recombination typically occurs between a loxP flanked Stop cassette preceding a reporter gene such as GFP.
Mice are bred to contain either a region- or cell type-specific CreER and a conditional reporter allele. Untreated mice will not have marking because the Stop cassette in the reporter prevents further transcription of the reporter gene. We administer tamoxifen by oral gavage to timed-pregnant females, which provides temporal control of CreERT release and subsequent translocation to the nucleus removing the Stop cassette from the reporter. Following recombination, the reporter allele is constitutively and heritably expressed. This series of events marks cells such that their genetic history is indelibly recorded. The recombined reporter thus serves as a high fidelity genetic lineage tracer that, once on, is uncoupled from the gene expression initially used to drive CreERT.
We apply GIFM in mouse to study normal development and ascertain the contribution of genetic lineages to adult cell types and tissues. We also use GIFM to follow cells on mutant genetic backgrounds to better understand complex phenotypes that mimic salient features of human genetic disorders.
This video article guides researchers through experimental methods to successfully apply GIFM. We demonstrate the method using our well characterized Wnt1-CreERT;mGFP mice by administering tamoxifen at embryonic day (E)8.5 via oral gavage followed by dissection at E12.5 and analysis by epifluorescence stereomicroscopy. We also demonstrate how to micro-dissect fate mapped domains for explant preparation or FACS analysis and dissect adult fate-mapped brains for whole mount fluorescent imaging. Collectively, these procedures allow researchers to address critical questions in developmental biology and disease models.

A Practical Approach to Genetic Inducible Fate Mapping: A Visual Guide to Mark and Track Cells In Vivo

Genetic Inducible Fate Mapping (GIFM) marks and tracks cells with fine spatial and temporal control in vivo and elucidates how cells from a specific genetic lineage contribute to developing and adult tissues. Demonstrated here are the techniques required to fate map E12.5 mouse embryos for epifluorescent and explant analysis.

Un approccio pratico alla mappatura genetica Destino inducibile: una guida visiva a Mark e Pista Cellule In Vivo</em

Fate maps are generated by marking and tracking cells in vivo to determine how progenitors contribute to specific structures and cell types in developing ...

A Reversible, Non-invasive Method for Airway Resistance Measurements and Bronchoalveolar Lavage Fluid Sampling in Mice

Airway hyperreactivity (AHR) measurements and bronchoalveolar lavage (BAL) fluid sampling are essential to experimental asthma models, but repeated procedures to obtain such measurements in the same animal are generally not feasible.  Here, we demonstrate protocols for obtaining from mice repeated measurements of AHR and bronchoalveolar lavage fluid samples.  Mice were challenged intranasally seven times over 14 days with a potent allergen or sham treated.  Prior to the initial challenge, and within 24 hours following each intranasal challenge, the same animals were anesthetized, orally intubated and mechanically ventilated.  AHR, assessed by comparing dose response curves of respiratory system resistance (RRS) induced by increasing intravenous doses of acetylcholine (Ach) chloride between sham and allergen-challenged animals, were determined.  Afterwards, and via the same intubation, the left lung was lavaged so that differential enumeration of airway cells could be performed.  These studies reveal that repeated measurements of AHR and BAL fluid collection are possible from the same animals and that maximal airway hyperresponsiveness and airway eosinophilia are achieved within 7-10 days of initiating allergen challenge.  This novel technique significantly reduces the number of mice required for longitudinal experimentation and is applicable to diverse rodent species, disease models and airway physiology instruments.  

Repeated measurements of rodent respiratory physiology and sampling of airway inflammatory cells are desirable, but generally not feasible. Here we describe a repeatable method for orally intubating mice that permits repeated measurements of airway hyperreactivity and sampling of airway inflammatory cells.

Un reversibile, metodo non invasivo per le misure di resistenza delle vie aeree e liquido di lavaggio broncoalveolare di campionamento nei topi

Airway hyperreactivity (AHR) measurements and bronchoalveolar lavage (BAL) fluid sampling are essential to experimental asthma models, but repeated ...

Fecal Glucocorticoid Analysis: Non-invasive Adrenal Monitoring in Equids

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, corticotrophin releasing hormone (CRH) is released from the hypothalamus in the brain. This stimulates the release of adrenocorticotrophic hormone (ACTH) from the pituitary gland, which in turn stimulates release of glucocorticoids from the adrenal gland. In horses the glucocorticoid corticosterone is responsible for several adaptations needed to support equine flight behaviour and subsequent removal from the aversive situation. Corticosterone metabolites can be detected in the feces of horses and assessment offers a non-invasive option to evaluate long term patterns of adrenal activity. Fecal assessment offers advantages over other techniques that monitor adrenal activity including blood plasma and saliva analysis. The non-invasive nature of the method avoids sampling stress which can confound results. It also allows the opportunity for repeated sampling over time and is ideal for studies in free ranging horses. This protocol describes the enzyme linked immunoassay (EIA) used to assess feces for corticosterone, in addition to the associated biochemical validation.

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. The method offers a non-invasive option to assess long term patterns in both domestic and free ranging horses. This protocol describes the enzyme linked immunoassay involved and the associated biochemical validation.

Fecale Analisi glucocorticoidi: non invasivo di monitoraggio surrenale in equidi

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, ...

Methods to Discover Alternative Promoter Usage and Transcriptional Regulation of Murine Bcrp1

Gene expression in different tissues is often controlled by alternative promoters that result in the synthesis of mRNA with unique &#8212; usually untranslated &#8212; first exons. Bcrp1 (Abcg2), the murine orthologue of the ABC transporter Breast Cancer Resistance Protein (BCRP, ABCG2), has at least four alternative promoters that are designated by the corresponding four alternative first exons produced: E1U, E1A, E1B, and E1C. Herein, in-silico protocols are presented to predict alternative promoter usage for Bcrp1. Furthermore, reporter assay methods are described to produce reporter constructs for alternative promoters and to determine the functionality of putative promoters upstream of the alternative first exons that are identified.

With the murine ABC transporter Bcrp1 (Abcg2) as an example, in-silico protocols are presented to detect alternative promoter usage in genes expressed in mouse tissues, and to evaluate the functionality of the alternative promoters identified using reporter assays.

I metodi per scoprire alternative Uso Promotore e regolazione trascrizionale di Murine Bcrp1

Gene expression in different tissues is often controlled by alternative promoters that result in the synthesis of mRNA with unique &#8212; usually ...

Methods to Classify Cytoplasmic Foci as Mammalian Stress Granules

Cells are often challenged by sudden environmental changes. Stress Granules (SGs), cytoplasmic ribonucleoprotein complexes that form in cells exposed to stress conditions, are implicated in various aspects of cell metabolism and survival. SGs modulate cellular signaling pathways, post-transcriptional gene expression, and stress response programs. The formation of these mRNA-containing granules is directly connected to cellular translation. SG assembly is triggered by inhibited translation initiation, and SG disassembly is promoted by translation activation or by inhibited translation elongation. This relationship is further highlighted by SG composition. Core SG components are stalled translation pre-initiation complexes, mRNA, and selected RNA-binding Proteins (RBPs). The purpose of SG assembly is to conserve cellular energy by sequestering translationally stalled housekeeping mRNAs, allowing for the enhanced translation of stress-responsive proteins. In addition to the core constituents, such as stalled translation preinitiation complexes, SGs contain a plethora of other proteins and signaling molecules. Defects in SG formation can impair cellular adaptation to stress and can thus promote cell death. SGs and similar RNA-containing granules have been linked to a number of human diseases, including neurodegenerative disorders and cancer, leading to the recent interest in classifying and defining RNA granule subtypes. This protocol describes assays to characterize and quantify mammalian SGs.

Stress Granules (SGs) are nonmembranous cytoplasmic structures that form in cells exposed to a variety of stresses. SGs contain mRNAs, RNA-binding proteins, small ribosomal subunits, translation-related factors, and various cell signaling proteins. This protocol describes a workflow that uses several experimental approaches to detect, characterize, and quantify bona fide SGs.

Metodi per classificare i foci citoplasmatici come granuli di stress di mammiferi

Cells are often challenged by sudden environmental changes. Stress Granules (SGs), cytoplasmic ribonucleoprotein complexes that form in cells exposed to ...