Work in the authors' laboratory is supported by a grant from the National Institute of General Medical Sciences (GM41628) and by a grant to the Stowers Institute for Medical Research from the Helen Nelson Medical Research Fund at the Greater Kansas City Community Foundation.

1. ATP-dependentes nucleossoma Remodelação Ensaios Para medir as actividades de ATP-dependente nucleossoma remodelação, imunopurificada INO80 ou subcomplexos INO80 são incubados com ATP e um substrato mononucleosomal, que contém um único nucleossoma posicionado numa extremidade de um fragmento de ADN de 216 pb, 32 P-marcado. Os produtos da reacção são então sujeitos a electroforese em géis de poli-acrilamida nativo. <ol><li> Para gerar o, &#39;601&#39; fragmento de ADN marcado com 32 P, a partir de amplificar pGEM-3Z-4 601 um fragmento de ADN de 216 pb que contém uma sequência de 601 posicionamento nucleossoma posicionada-final, utilizando os oligonucleótidos 5&#39;-ACAGGATGTATATATCTGACACGTGCCTGG e 5&#39;-como AATACTCAAGCTTGGATGCCTGCAG frente e verso, primers. <ol><li> Defina-se uma reacção de PCR de 100 ul, tal como descrito na Tabela 1. </li><li> Realizar as reacções de PCR num termociclador utilizando o seguinte programa: 1 min a 96 ° C, followed por 45 seg a 94 ° C, 30 seg a 57 ° C, 60 segundos a 72 ° C durante 30 ciclos; terminando com 7 min a 72 ° C. </li><li> Após a reacção de PCR é terminado, remover os nucleótidos não incorporados fazendo passar os produtos de reacção duas vezes através de colunas de giro livre de nuclease. </li><li> Executar 5 ul do produto de PCR purificado em gel de agarose a 1,2% para confirmar que a reacção de PCR gerado a ~ 216 pb Fragmento de ADN desejado. </li><li> Dilui-se 5 ul do produto de PCR purificado de 20 vezes, e medir a concentração de ADN, utilizando um espectrofotómetro de UV. O rendimento médio é de aproximadamente 40 ng / mL. </li><li> Medir a radioactividade de 1 ul do produto de PCR purificado em um contador de cintilação. Estimar a eficiência de marcação pelo cálculo do cpm / ng. A reacção de marcação bem sucedida é esperado para produzir ~ 15,000 cpm / ng de fragmento de ADN 601. </li></ol></li><li> Transferir nucleossomas células HeLa na rotulada 601 DNA utilizando um método de diluição em série 5. <ol><li> Misture 2 pmol de32 601 fragmento de ADN marcado com P com 6 ug de nucleossomas Hela (preparado tal como descrito 5) em 50 ul de um tampão contendo 1,0 M de NaCl, 10 mM Tris-HCl, pH 8,0, EDTA 1 mM, PMSF 0,1 mM e 1 mM TDT e incubar a 30 ° C durante 30 min. </li><li> Sequencialmente diluir a mistura a 0,8 M, 0,6 M e 0,4 M de NaCl por diluição com 12,5 mL, 20,8 mL, e 41,6 ul, respectivamente, de 10 mM Tris-HCl (pH 8,0), EDTA 1 mM, PMSF 0,1 mM, e 1 mM de DTT, com uma incubação de 30 min a 30 ° C depois de cada diluição. </li><li> Diluir a mistura de 0,2 M e, em seguida, para NaCl 0,1 M por adição de 125 mL e, em seguida, 250 ul do mesmo tampão contendo 0,1% de Nonidet P-40, 20% de glicerol, e 200 ug / ml BSA, com uma incubação de 30 min a 30 ° C entre as duas diluições finais. Armazenar o substrato mononucleosome a 4 ° C durante até 3 meses. </li></ol></li><li> Realizar as reacções de nucleossomas deslizante dependentes de ATP num volume total de 10 ul. A reaction componentes estão listados na Tabela 2. vez que a concentração de NaCl para a actividade óptima remodelação nucleossoma INO80 ~ é NaCl 50 mM (resultados não publicados), ajustar a concentração total de cada reacção em NaCl a 50 mM, tendo em conta a quantidade de NaCl contido nas preparações de nucleossomas e enzima. <ol><li> Antes de começar a configurar os ensaios, lança gel de poli-acrilamida nativas (18 x 16 cm). Para preparar um único gel contendo 5% de acrilamida (acrilamida: bisacrilamida a 37,5: 1), TBE 0,5 x (45 mM Tris borato, 1 mM EDTA), 0,01% de persulfato de amónio (APS), e 0,001% de N, N, N &#39;, N&#39;-tetrametiletilenodiamina (TEMED), mistura dos ingredientes listados na Tabela 3. Permitir que o gel de polimerizar durante pelo menos 2 horas à temperatura ambiente. </li><li> Entretanto, para cada reacção a ser realizada, combinar num tubo siliconizado microcentrífuga de 1,5 ml pré-arrefecido ~ 20 nM ou INO80 INO80 subcomplexo (preparado como descrito 3) com uma quantidade de tampão EB100 ( <strong&gt; Tabela 4) suficiente para dar um volume de 4,75 mL. Imediatamente re-congelar qualquer restantes fracções contendo INO80 em gelo seco em pó ou em azoto líquido. </li><li> Defina-se um cocktail mestre com o resto dos ingredientes, ampliação de um factor de &#39;X&#39; (em que X = número total de reacções 3). A quantidade de cada ingrediente necessário para uma única reacção de 10 uL é listada na Tabela 5; a receita deve ser dimensionado de acordo com o número de reacções a serem realizadas. Misture bem, tocando o tubo ou pipetando para cima e para baixo com um Pipetman e girar o tubo por alguns segundos em uma microcentrífuga de bancada. </li><li> Dispensar 5,25 ul do cocktail de mestre para cada um dos tubos de reacção estabelecidas no passo 1.3.2. Misture bem pipetando para cima e para baixo. Iniciar as reacções através da transferência de tubos de reacção para um banho de 30 ° C de calor bloco ou água e incubar durante 2 horas. </li><li> Enquanto isso, a preparar »removendo mistura &#39;cocktail contendo ADN competidore nucleossomos, ampliação por um fator de X (X = número total de reações + 4). A quantidade de cada ingrediente necessário para a preparação de 1,5 ul da mistura para remoção de uma única reacção está listado na Tabela 6; a receita deve ser aumentado de acordo com o número de ensaios a serem realizados. </li><li> Terminar reações adicionando 1,5 mL da mistura de remover. Misture bem, girar para baixo, e incuba-se a 30 ° C durante mais 30 min. </li><li> Enquanto isso, a pré-rodar o gel de poliacrilamida nativa, em uma unidade de electroforese vertical, a 100 V durante 30 min a 4 ° C, usando TBE 0,5 x como tampão de corrida com uma barra de agitação magnética no interior da câmara inferior para manter a circulação tampão constante. </li><li> Para carregar a amostra, adicionar 2,5 l de corante de carga contendo TBE 3x, 30% de glicerol, 0,25% azul de bromofenol e 0,25% xileno cianol FF. Misture bem, girar rapidamente as amostras, e carregar no gel usando dicas de carregamento. </li><li> Submeter o gel a 200 V durante 4,5 horas a 4 ° C com tampão de circulação.</li><li> Para detectar o sinal, a transferência do gel para uma pilha de duas folhas de papel de filtro. Envolver o papel de filtro com o gel no topo usando plástico transparente, e, em seguida, expô-la a um ecrã de fósforo de armazenamento a 4 ° C durante o tempo desejado. </li><li> Digitalize o ecrã com um sistema de scanner de imagens isótopo e analisar os dados utilizando software apropriado. </li></ol></li></ol> 2. Mononucleosome Ensaios de Ligação Para ensaiar a afinidade de ligação de um dado complexo INO80 para mononucleosomes, realizar um deslocamento Electrophoretic Mobility Assay (EMSA), utilizando o substrato mononucleosomal gerado no passo 1.2. <ol><li> Configure a reação Misturas para ensaios de ligação, tal como descrito para os ensaios de remodelação nucleossomos, mas omitir o ATP e remover mix das reações; incubar a 30 ° C durante 30 min. </li><li> Adicionar 2,5 uL de corante de carga de cada uma das misturas de reacção, e aplicam-se a um gel de poliacrilamida nativa, contendo 3,5% de acrilamida (acrilamida: bis 37,5: 1), 1% de glicerol, TBE 0,5 x, 0,01% APS, 0,001% e TEMED. </li><li> Usando 0,5 x TBE como tampão de corrida, correr o gel a 200 V durante 2,5 horas a 4 ° C com tampão de circulação e expor a um ecrã de fósforo de armazenamento. </li></ol> 3. ADN e Nucleosome-ATPase Os ensaios dependentes Realizar ensaios ATPase em misturas de reacção contendo 5 ul de 20 mM Tris-HCl (pH 7,5), 60 mM de NaCl, 6,6 mM de MgCl2, 0,8 mM EDTA, 0,015% de Nonidet P-40, 2,5% de glicerol, 0,1 mg / ml de BSA, 1 DTT, 0,1 mM de PMSF, 2 mM ATP, 2 uCi de [α- 32 P] ATP (3000 Ci / mmol). Para cada complexo INO80 ou quantidade de complexo a ser ensaiada INO80 criou três reacções paralelas, uma contendo tampão EB100 para medir DNA- ou nucleossoma-ATPase independente, contendo um DNA de plasmídeo circular fechado (5000 pb, ~ 30 nM) para medir DNA- ATPase dependente, e outro contendo Hela oligonucleosomes (~ 185 nm) para medir nucleosome-ATPase dependente. Configure todas as reações no gelo. <ol&gt; <li> Para cada reacção, combinar 10-50 nM dos INO80 ou INO80 subcomplexos imunopurificados com uma quantidade de tampão EB100 suficiente para dar um volume de 2,2 mL em 1,5 mL lubrificados microtubos previamente arrefecidos. Imediatamente re-congelar quaisquer fracções contendo INO80 em gelo seco em pó ou em azoto líquido. </li><li> Configurar um cocktail mestre. A quantidade de cada ingrediente necessário para uma única reacção é apresentado na Tabela 7. Scale-se a receita por ampliação de um factor de 3 (X + 2) 1, em que X = número de preparações INO80 a ser ensaiada. </li><li> Para preparar contendo tampão &#39;sub-cocktails&#39; só, DNA, ou nucleossomos, dispensar 2.5 (X + 2) ul do cocktail mestre em três tubos separados. Adicionar 0,3 (X +2) ul de qualquer EB100, o DNA de plasmídeo circular fechado (1,5 ug / uL), ou Hela oligonucleosomes (1,5 ug / uL) e misturar bem. </li><li> Dispensar 2,8 ul da sub-coquetel adequado para os tubos de reacção contendo enzimas criados em rep 3.1. Pipeta suavemente para cima e para baixo para misturar; evitar a introdução de bolhas. </li><li> Para iniciar reações, transfira os tubos de reacção a um bloco de 30 ° C de calor. </li><li> Depois de 5, 15, 30, e 60 min de incubação, a mancha de 0,5 ul de cada mistura de reacção sobre uma cromatografia em camada fina de celulose polietilenoimina (CCF) da placa (20 x 10 cm) de uma linha recta, pelo menos, 1,5 cm a partir da extremidade inferior . Retornar imediatamente tubos de reação ao bloco C calor de 30 ° para múltiplos pontos temporais podem ser tomadas a partir de um único tubo. Depois de manchas, seque as placas de TLC usando um secador de cabelo. </li><li> Transferir as placas de TLC de uma câmara de vidro contendo o suficiente fosfato de potássio 0,375 M (pH 3,5) para permitir que o fundo de 0,5 cm da placa de TLC a ser submergido na solução. </li><li> Cobrir a câmara, e se desenvolvem até a frente da fase de líquido atinge o topo das placas de TLC. Immediate secar os pratos, cuidadosamente, com um secador de cabelo. </li><li> Expor as placas de TLC secas para uma tela de fósforo de armazenamento à temperatura ambiente.Digitalize o ecrã com um sistema de scanner de imagens isótopo e determinar a quantidade de substrato ATP radioativo e produtos ADP. </li><li> Para calcular a quantidade de ATP hidrolisado, multiplicar o ATP% hidrolisado por a quantidade de ATP presente na mistura da reacção de partida com a seguinte fórmula: pmol de ATP hidrolisado = 10 pmol de ATP na reacção de partida x [ADP / ATP (+ ADP)] </li></ol>

<ol>
	<li>Clapier, C. R., Cairns, B. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biology+of+chromatin+remodeling+complexes.">The biology of chromatin remodeling complexes.</a> Annual Review of Biochemistry. 78, 273-304 (2009).</li><li>Narlikar, G. J., Sundaramoorthy, R., Owen-Hughes, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+and+functions+of+ATP-dependent+chromatin-remodeling+enzymes.">Mechanisms and functions of ATP-dependent chromatin-remodeling enzymes.</a> Cell. 154 (3), 490-503 (2013).</li><li>Chen, L., Ooi, S. K., Conaway, J. W., Conaway, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+and+purification+of+human+INO80+chromatin+remodeling+complexes+and+subcomplexes.">Generation and purification of human INO80 chromatin remodeling complexes and subcomplexes.</a> , (2013).</li><li>Lowary, P. T., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+DNA+sequence+rules+for+high+affinity+binding+to+histone+octamer+and+sequence-directed+nucleosome+positioning.">New DNA sequence rules for high affinity binding to histone octamer and sequence-directed nucleosome positioning.</a> J. Mol. Biol. 276 (1), (1006).</li><li>Owen-Hughes, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+nucleosome+disruption+by+ATP-driven+chromatin+remodeling+complexes.">Analysis of nucleosome disruption by ATP-driven chromatin remodeling complexes.</a> Methods Mol. Biol. 119, 319-331 (1999).</li><li>Udugama, M., Sabri, A., Bartholomew, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+INO80+ATP-dependent+chromatin+remodeling+complex+is+a+nucleosome+spacing+factor.">The INO80 ATP-dependent chromatin remodeling complex is a nucleosome spacing factor.</a> Mol. Cell Biol. 31 (4), 662-673 (2011).</li><li>Jin, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mammalian+chromatin+remodeling+complex+with+similarities+to+the+yeast+INO80+complex.">A mammalian chromatin remodeling complex with similarities to the yeast INO80 complex.</a> Journal of Biological Chemistry. 280 (50), 41207-41212 (1074).</li><li>Chen, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Subunit+organization+of+the+human+INO80+chromatin+remodeling+complex:+an+evolutionarily+conserved+core+complex+catalyzes+ATP-dependent+nucleosome+remodeling.">Subunit organization of the human INO80 chromatin remodeling complex: an evolutionarily conserved core complex catalyzes ATP-dependent nucleosome remodeling.</a> Journal of Biological Chemistry. 286 (13), 11283-11289 (2011).</li><li>Hamiche, A., Sandaltzopoulos, R., Gdula, D. A., Wu, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ATP-dependent+histone+octamer+sliding+mediated+by+the+chromatin+remodeling+complex+NURF.">ATP-dependent histone octamer sliding mediated by the chromatin remodeling complex NURF.</a> Cell. 97 (7), 833-842 (1999).</li><li>Polach, K. J., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Restriction+enzymes+as+probes+of+nucleosome+stability+and+dynamics.">Restriction enzymes as probes of nucleosome stability and dynamics.</a> Methods Enzymol. 304, 278-298 (1999).</li><li>Anderson, J. D., Thastrom, A., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+access+of+proteins+to+buried+nucleosomal+DNA+target+sites+occurs+via+a+mechanism+that+is+distinct+from+nucleosome+translocation,+Mol.Cell+Biol.">Spontaneous access of proteins to buried nucleosomal DNA target sites occurs via a mechanism that is distinct from nucleosome translocation, Mol.Cell Biol.</a> 22 (20), 7147-7157 (2002).</li><li>Saha, A., Wittmeyer, J., Cairns, B. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+remodeling+through+directional+DNA+translocation+from+an+internal+nucleosomal+site.">Chromatin remodeling through directional DNA translocation from an internal nucleosomal site.</a> Nature Structural and Molecular Biology. 12 (9), 747-755 (2005).</li><li>Gottschalk, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Poly(ADP-ribosyl)ation+directs+recruitment+and+activation+of+an+ATP-dependent+chromatin+remodeler,+Proc.Natl.Acad.Sci.U.S.A.">Poly(ADP-ribosyl)ation directs recruitment and activation of an ATP-dependent chromatin remodeler, Proc.Natl.Acad.Sci.U.S.A.</a> 106 (33), 13770-13774 (2009).</li><li>Clapier, C. R., Cairns, B. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+ISWI+involves+inhibitory+modules+antagonized+by+nucleosomal+epitopes.">Regulation of ISWI involves inhibitory modules antagonized by nucleosomal epitopes.</a> Nature. 492 (7428), 280-284 (2012).</li><li>Brune, M., Hunter, J. L., Corrie, J. E. T., Direct Webb, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-Time+Measurement+of+Rapid+Inorganic+Phosphate+Release+Using+a+Novel+Fluorescent+Probe+and+Its+Application+to+Actomyosin+Subfragment+1+ATPase,+Biochemistry.">Real-Time Measurement of Rapid Inorganic Phosphate Release Using a Novel Fluorescent Probe and Its Application to Actomyosin Subfragment 1 ATPase, Biochemistry.</a> 33 (27), 8262-8271 (1994).</li><li>Luk, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stepwise+histone+replacement+by+SWR1+requires+dual+activation+with+histone+H2A.Z+and+canonical+nucleosome.">Stepwise histone replacement by SWR1 requires dual activation with histone H2A.Z and canonical nucleosome.</a> Cell. 143 (5), 725-736 (2010).</li></ol>

The authors declare that they have no competing financial interests.

Para garantir que a remodelação nucleosome e atividades ATPase observamos em ensaios dependem da atividade catalítica de complexos INO80, e não sobre a contaminação de remodelação e / ou enzimas ATPase, nós nucleosome rotineiramente ensaio remodelação e atividade ATPase de versões cataliticamente inativos de complexos INO80, purificado em paralelo com o tipo selvagem INO80 utilizando o mesmo procedimento. Uma reacção de controlo negativo a que falta o ATP também deve ser realizada quando se examina a acti...

SnF2 complexos de remodelação da cromatina família incluem um SnF2-como centro ATPase subunidade 1,2. Alguns ATPases função SnF2-como enzimas individuais de subunidade, enquanto que outros funcionam como a subunidade catalítica de grandes complexos de multi-subunidades. Elucidar os mecanismos moleculares pelos quais cada uma das subunidades da cromatina complexos de remodelação contribuir para as suas actividades requer a capacidade de realizar ensaios bioquímicos que dissecam o processo de remodelação. ATP-dependente remodelação nucleossoma pelo complexo INO80 humano e outras enzimas remodelação da cromatina pode ser concebido como um processo multi-etapas que começa com a ligação da enzima à remodelação nucleossomas, seguido por activação do seu ADN e / ou nucleossoma-ATPase dependente, translocação da enzima na remodelação ADN nucleossomal, e eventual reposicionamento de nucleossomas 1,2. Compreender os detalhes moleculares do dependente de ATP processo de remodelação da cromatina requires dissecção da reacção remodelação nos seus passos individuais e definição das contribuições das subunidades individuais do complexo de remodelação da cromatina para cada passo da reacção. Tais análises exigem a capacidade de analisar remodelação nucleosome e outras atividades utilizando substratos moleculares definidos in vitro. Em um protocolo JOVE anterior, descrevemos os procedimentos utilizados para gerar complexos de remodelação da cromatina INO80 e subcomplexos com composições de subunidades definidas 3. Aqui, apresentamos três ensaios bioquímicos que permitem a análise quantitativa da ligação, DNA- e nucleosome ativado ATPase, e as atividades de remodelação nucleossomos associados com tais complexos nucleosome.

<table border="0" cellpadding="0" cellspacing="0" width="839">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Name of Reagent/Material</td>
			<td style="width:212px;">Company</td>
			<td style="width:147px;">Catalog Number</td>
			<td style="width:123px;">Comments</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Protease Inhibitor Cocktail</td>
			<td style="width:212px;">Sigma</td>
			<td style="width:147px;">P8340</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">10x PCR reaction buffer&#160;</td>
			<td style="width:212px;">Roche Applied Science&#160;</td>
			<td style="width:147px;">11435094001</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Roche Taq DNA Polymerase</td>
			<td style="width:212px;">Roche Applied Science&#160;</td>
			<td style="width:147px;">11435094001</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NucAway Nuclease-free Spin Columns&#160;</td>
			<td>Ambion</td>
			<td style="width:147px;">Cat. # AM10070</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ultrapure ATP&#160;</td>
			<td>USB/Affymetrix</td>
			<td style="width:147px;">77241 25 UM</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">bovine serum albumin&#160;</td>
			<td style="width:212px;">Sigma</td>
			<td style="width:147px;">A9418&#160;</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">N,N,N&#180;,N&#180;-tetramethylethylenediamine (TEMED)</td>
			<td style="width:212px;">Thermo Scientific</td>
			<td style="width:147px;">17919</td>
			<td style="width:123px;">Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">40% Acrylamide/Bis 37.5:1</td>
			<td style="width:212px;">Amresco</td>
			<td style="width:147px;">0254-500ML</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sonicated salmon sperm DNAs&#160;</td>
			<td>GE Healthcare</td>
			<td style="width:147px;">27-4565-01</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">10% ammonium persulfate (APS)</td>
			<td style="width:212px;">Thermo Scientific</td>
			<td style="width:147px;">17874</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">benzonase&#160;</td>
			<td>Novagen</td>
			<td style="width:147px;">Cat. No. 70664</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;">[&#945;-32P] ATP (3000 Ci/mmol)</td>
			<td style="width:212px;">PerkinElmer</td>
			<td style="width:147px;">BLU003H250UC</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">dCTP, [&#945;-32P]- 6000Ci/mmol</td>
			<td style="width:212px;">PerkinElmer</td>
			<td style="width:147px;">BLU013Z250UC</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;"></td>
			<td style="width:212px;"></td>
			<td style="width:147px;"></td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Equipment</td>
			<td style="width:212px;">Company</td>
			<td style="width:147px;"></td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PCR thermal cycler PTC 200</td>
			<td>MJ Research</td>
			<td style="width:147px;">PTC 200</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hoefer vertical electrophoresis unit</td>
			<td style="width:212px;">Hoefer</td>
			<td style="width:147px;">SE600X-15-1.5</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">lubricated 1.5ml microcentrifuge tubes&#160;</td>
			<td style="width:212px;">Costar</td>
			<td style="width:147px;">3207</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Storage Phosphor Screen&#160;</td>
			<td>Molecular Dynamics</td>
			<td style="width:147px;">63-0034-79</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">3MM filter paper</td>
			<td>Whatman&#160;</td>
			<td style="width:147px;">28458-005</td>
			<td style="width:123px;">VWR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Typhoon PhosphorImager&#160;</td>
			<td>GE Healthcare</td>
			<td style="width:147px;">8600</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ImageQuant software</td>
			<td>GE Healthcare</td>
			<td style="width:147px;">ver2003.02</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">TLC Glass Plates, PEI-Cellulose F</td>
			<td style="width:212px;">Millipore</td>
			<td style="width:147px;">5725-7</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Immobilon-FL Transfer Membrane 7 x 8.4</td>
			<td style="width:212px;">Millipore</td>
			<td style="width:147px;">IPFL07810</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:359px;">General purpose survey meter with end-window or pancake GM (Geiger-Mueller) probe</td>
			<td style="width:212px;">Biodex</td>
			<td style="width:147px;">Model 14C</td>
			<td style="width:123px;"></td>
		</tr>
	</tbody>
</table>

biochemical assays for analyzing activities of atp-dependent chromatin remodeling enzymes

Members of the SNF2 family of ATPases often function as components of multi-subunit chromatin remodeling complexes that regulate nucleosome dynamics and DNA accessibility by catalyzing ATP-dependent nucleosome remodeling. Biochemically dissecting the contributions of individual subunits of such complexes to the multi-step ATP-dependent chromatin remodeling reaction requires the use of assays that monitor the production of reaction products and measure the formation of reaction intermediates. This JOVE protocol describes assays that allow one to measure the biochemical activities of chromatin remodeling complexes or subcomplexes containing various combinations of subunits. Chromatin remodeling is measured using an ATP-dependent nucleosome sliding assay, which monitors the movement of a nucleosome on a DNA molecule using an electrophoretic mobility shift assay (EMSA)-based method. Nucleosome binding activity is measured by monitoring the formation of remodeling complex-bound mononucleosomes using a similar EMSA-based method, and DNA- or nucleosome-dependent ATPase activity is assayed using thin layer chromatography (TLC) to measure the rate of conversion of ATP to ADP and phosphate in the presence of either DNA or nucleosomes. Using these assays, one can examine the functions of subunits of a chromatin remodeling complex by comparing the activities of the complete complex to those lacking one or more subunits. The human INO80 chromatin remodeling complex is used as an example; however, the methods described here can be adapted to the study of other chromatin remodeling complexes.

As figuras mostram os resultados representativos de testes bioquímicos usados ​​para caracterizar as actividades, incluindo INO80 nucleossoma deslizante (Figura 1) e de ligação (Figura 2) e DNA- ensaios ou ensaios de ATPase dependente de nucleossoma (Figura 3). A experiência apresentada na Figura 1 compara a capacidade dos complexos INO80 intactas purificado através de FLAG-Ies2 ou FLAG-INO80E e de INO80 subcomplexo...

Watch this Scientific Journal Video about Biochemical Assays for Analyzing Activities of ATP-dependent Chromatin Remodeling Enzymes at JoVE.com

Biochemical Assays for Analyzing Activities of ATP-dependent Chromatin Remodeling Enzymes

Here we describe biochemical assays that can be used to characterize ATP-dependent chromatin remodeling enzymes for their abilities to 1) catalyze ATP-dependent nucleosome sliding, 2) engage with nucleosome substrates, and 3) hydrolyze ATP in a nucleosome- or DNA-dependent manner.

Os ensaios bioquímicos para analisar as actividades de ATP-dependente cromatina remodelação Enzimas

Members of the SNF2 family of ATPases often function as components of multi-subunit chromatin remodeling complexes that regulate nucleosome dynamics and ...

biochemical-assays-for-analyzing-activities-atp-dependent-chromatin

Research

JoVE Journal

Biology

14.7K visualizações.  Stowers Institute for Medical Research. Here we describe biochemical assays that can be used to characterize ATP-dependent chromatin remodeling enzymes for their abilities to 1) catalyze ATP-dependent nucleosome sliding, 2) engage with nucleosome substrates, and 3) hydrolyze ATP in a nucleosome- or DNA-dependent manner.

Vídeo: Biochemical Assays for Analyzing Activities of ATP-dependent Chromatin Remodeling Enzymes

A Chromatin Assay for Human Brain Tissue

Chronic neuropsychiatric illnesses such as schizophrenia, bipolar disease and autism are thought to result from a combination of genetic and environmental factors that might result in epigenetic alterations of gene expression and other molecular pathology. Traditionally, however, expression studies in postmortem brain were confined to quantification of mRNA or protein. The limitations encountered in postmortem brain research   such as variabilities in autolysis time and tissue integrities   are also likely to impact any studies of higher order chromatin structures. However, the nucleosomal organization of genomic DNA   including DNA:core histone binding - appears to be largely preserved in representative samples provided by various brain banks. Therefore, it is possible to study the methylation pattern and other covalent modifications of the core histones at defined genomic loci in postmortem brain. Here, we present a simplified native chromatin immunoprecipitation (NChIP) protocol for frozen (never-fixed) human brain specimens. Starting with micrococcal nuclease digestion of brain homogenates, NChIP followed by qPCR can be completed within three days. The methodology presented here should be useful to elucidate epigenetic mechanisms of gene expression in normal and diseased human brain.

Until recently, expression studies on human brain were limited to quantification of RNA or protein. With the chromatin immunoprecipitation techniques described in this paper, it will be possible to map histone methylation and other epigenetic regulators of gene expression in postmortem brain.

Um Ensaio Chromatin para tecido do cérebro humano

Chronic neuropsychiatric illnesses such as schizophrenia, bipolar disease and autism are thought to result from a combination of genetic and environmental ...

Biologia

Zebrafish Brain Ventricle Injection

Proper brain ventricle formation during embryonic brain development is required for normal brain function.  Brain ventricles are the highly conserved cavities within the brain that are filled with cerebrospinal fluid.  In zebrafish, after neural tube formation, the neuroepithelium undergoes a series of constrictions and folds while it fills with fluid resulting in brain ventricle formation.  In order to understand the process of ventricle formation, and the neuroepithelial shape changes that occur at the same time, we needed a way to visualize the ventricle space in comparison to the brain tissue.  However, the nature of transparent zebrafish embryos makes it difficult to differentiate the tissue from the ventricle space.  Therefore, we developed a brain ventricle injection technique where the ventricle space is filled with a fluorescent dye and imaged by brightfield and fluorescent microscopy.  The brightfield and the fluorescent images are then processed and superimposed in Photoshop.  This technique allows for visualization of the ventricle space with the fluorescent dye, in comparison to the shape of the neuroepithelium in the brightfield image.  Brain ventricle injection in zebrafish can be employed from 18 hours post fertilization through early larval stages.  We have used this technique extensively in our studies of brain ventricle formation and morphogenesis as well as in characterizing brain morphogenesis mutants (1-3).

After neural tube formation, the neuroepithelium constricts and folds while the tube fills with embryonic cerebrospinal fluid (eCSF) to form the embryonic brain ventricles. We developed this ventricle injection technique to better visualize the fluid filled space in contrast to the neuroepithelial shape in a live embryo.

Zebrafish Injection Ventrículo Cerebral

Proper brain ventricle formation during embryonic brain development is required for normal brain function.  Brain ventricles are the highly conserved ...

Photobleaching Assays (FRAP &amp; FLIP) to Measure Chromatin Protein Dynamics in Living Embryonic Stem Cells

Fluorescence Recovery After Photobleaching (FRAP) and Fluorescence Loss In Photobleaching (FLIP) enable the study of protein dynamics in living cells with good spatial and temporal resolution. Here we describe how to perform FRAP and FLIP assays of chromatin proteins, including H1 and HP1, in mouse embryonic stem (ES) cells. In a FRAP experiment, cells are transfected, either transiently or stably, with a protein of interest fused with the green fluorescent protein (GFP) or derivatives thereof (YFP, CFP, Cherry, etc.). In the transfected, fluorescing cells, an intense focused laser beam bleaches a relatively small region of interest (ROI). The laser wavelength is selected according to the fluorescent protein used for fusion. The laser light irreversibly bleaches the fluorescent signal of molecules in the ROI and, immediately following bleaching, the recovery of the fluorescent signal in the bleached area - mediated by the replacement of the bleached molecules with the unbleached molecules - is monitored using time lapse imaging. The generated fluorescence recovery curves provide information on the protein's mobility. If the fluorescent molecules are immobile, no fluorescence recovery will be observed. In a complementary approach, Fluorescence Loss in Photobleaching (FLIP), the laser beam bleaches the same spot repeatedly and the signal intensity is measured elsewhere in the fluorescing cell. FLIP experiments therefore measure signal decay rather than fluorescence recovery and are useful to determine protein mobility as well as protein shuttling between cellular compartments. Transient binding is a common property of chromatin-associated proteins. Although the major fraction of each chromatin protein is bound to chromatin at any given moment at steady state, the binding is transient and most chromatin proteins have a high turnover on chromatin, with a residence time in the order of seconds. These properties are crucial for generating high plasticity in genome expression1. Photobleaching experiments are therefore particularly useful to determine chromatin plasticity using GFP-fusion versions of chromatin structural proteins, especially in ES cells, where the dynamic exchange of chromatin proteins (including heterochromatin protein 1 (HP1), linker histone H1 and core histones) is higher than in differentiated cells2,3.

Photobleaching Assays FRAP &amp; FLIP to Measure Chromatin Protein Dynamics in Living Embryonic Stem Cells

We describe photobleaching methods including Fluorescence Recovery After Photobleaching (FRAP) and Fluorescence Loss In Photobleaching (FLIP) to monitor chromatin protein dynamics in embryonic stem (ES) cells. Chromatin protein dynamics, which is considered to be one of the means to study chromatin plasticity, is enhanced in pluripotent cells.

Fotobranqueamento Ensaios (FRAP &amp; FLIP) a Medida Dynamics Protein Chromatin em Viver Células-Tronco Embrionárias

Fluorescence Recovery After Photobleaching (FRAP) and Fluorescence Loss In Photobleaching (FLIP) enable the study of protein dynamics in living cells with ...

Quantitative Comparison of cis-Regulatory Element (CRE) Activities in Transgenic Drosophila melanogaster

Gene expression patterns are specified by cis-regulatory element (CRE) sequences, which are also called enhancers or cis-regulatory modules. A typical CRE possesses an arrangement of binding sites for several transcription factor proteins that confer a regulatory logic specifying when, where, and at what level the regulated gene(s) is expressed. The full set of CREs within an animal genome encodes the organism&prime;s program for development1, and empirical as well as theoretical studies indicate that mutations in CREs played a prominent role in morphological evolution2-4. Moreover, human genome wide association studies indicate that genetic variation in CREs contribute substantially to phenotypic variation5,6. Thus, understanding regulatory logic and how mutations affect such logic is a central goal of genetics. 
Reporter transgenes provide a powerful method to study the in vivo function of CREs. Here a known or suspected CRE sequence is coupled to heterologous promoter and coding sequences for a reporter gene encoding an easily observable protein product. When a reporter transgene is inserted into a host organism, the CRE&prime;s activity becomes visible in the form of the encoded reporter protein. P-element mediated transgenesis in the fruit fly species Drosophila (D.) melanogaster7 has been used for decades to introduce reporter transgenes into this model organism, though the genomic placement of transgenes is random. Hence, reporter gene activity is strongly influenced by the local chromatin and gene environment, limiting CRE comparisons to being qualitative. In recent years, the phiC31 based integration system was adapted for use in D. melanogaster to insert transgenes into specific genome landing sites8-10. This capability has made the quantitative measurement of gene and, relevant here, CRE activity11-13 feasible. The production of transgenic fruit flies can be outsourced, including phiC31-based integration, eliminating the need to purchase expensive equipment and/or have proficiency at specialized transgene injection protocols. 
Here, we present a general protocol to quantitatively evaluate a CRE&prime;s activity, and show how this approach can be used to measure the effects of an introduced mutation on a CRE&prime;s activity and to compare the activities of orthologous CREs. Although the examples given are for a CRE active during fruit fly metamorphosis, the approach can be applied to other developmental stages, fruit fly species, or model organisms. Ultimately, a more widespread use of this approach to study CREs should advance an understanding of regulatory logic and how logic can vary and evolve.

Quantitative Comparison of cis-Regulatory Element CRE Activities in Transgenic Drosophila melanogaster

Phenotypic variation for traits can result from mutations in cis-regulatory element (CRE) sequences that control gene expression patterns. Methods derived for use in Drosophila melanogaster can quantitatively compare the levels of spatial and temporal patterns of gene expression mediated by modified or naturally occurring CRE variants.

Comparação quantitativa de Cis-Regulamentação elemento (CRE) Atividades em transgênicos Drosophila melanogaster</em

Gene expression patterns are specified by cis-regulatory element (CRE) sequences, which are also called enhancers or cis-regulatory modules. A typical CRE ...

Blood Collection for Biochemical Analysis in Adult Zebrafish

The zebrafish has been used as an animal model for studies of several human diseases. It can serve as a powerful preclinical platform for studies of molecular events and therapeutic strategies as well as for evaluating the physiological mechanisms of some pathologies1. 
There are relatively few publications related to adult zebrafish physiology of organs and systems2, which may lead researchers to infer that the basic techniques needed to allow the exploration of zebrafish systems are lacking3. Hematologic biochemical values of zebrafish were first reported in 2003 by Murtha and colleagues4 who employed a blood collection technique first described by Jagadeeswaran and colleagues in 1999. Briefly, blood was collected via a micropipette tip through a lateral incision, approximately 0.3 cm in length, in the region of the dorsal aorta5. Because of the minute dimensions involved, this is a high-precision technique requiring a highly skilled practitioner. The same technique was used by the same group in another publication in that same year6. In 2010, Eames and colleagues assessed whole blood glucose levels in zebrafish7. They gained access to the blood by performing decapitations with scissors and then inserting a heparinized microcapillary collection tube into the pectoral articulation. They mention difficulties with hemolysis that were solved with an appropriate storage temperature based on the work Kilpatrick et al.8. When attempting to use Jagadeeswaran's technique in our laboratory, we found that it was difficult to make the incision in precisely the right place as not to allow a significant amount of blood to be lost before collection could be started. 
Recently, Gupta et al.9 described how to dissect adult zebrafish organs, Kinkle et al.10 described how to perform intraperitoneal injections, and Pugach et al.11 described how to perform retro-orbital injections. However, more work is needed to more fully explore basic techniques for research in zebrafish.
The small size of zebrafish presents challenges for researchers using it as an experimental model. Furthermore, given this smallness of scale, it is important that simple techniques are developed to enable researchers to explore the advantages of the zebrafish model.

This paper presents a technique for collection of blood from the dorsal aorta of Zebrafish. It also provides instructions for obtaining serum for use in biochemical analyses, such as tests for determining cholesterol and triglyceride levels.

Coleta de sangue para análise bioquímica em Zebrafish Adulto

The zebrafish has been used as an animal model for studies of several human diseases. It can serve as a powerful preclinical platform for studies of ...

Biochemical and High Throughput Microscopic Assessment of Fat Mass in Caenorhabditis Elegans

The nematode C. elegans has emerged as an important model for the study of conserved genetic pathways regulating fat metabolism as it relates to human obesity and its associated pathologies. Several previous methodologies developed for the visualization of C. elegans triglyceride-rich fat stores have proven to be erroneous, highlighting cellular compartments other than lipid droplets. Other methods require specialized equipment, are time-consuming, or yield inconsistent results. We introduce a rapid, reproducible, fixative-based Nile red staining method for the accurate and rapid detection of neutral lipid droplets in C. elegans. A short fixation step in 40% isopropanol makes animals completely permeable to Nile red, which is then used to stain animals. Spectral properties of this lipophilic dye allow it to strongly and selectively fluoresce in the yellow-green spectrum only when in a lipid-rich environment, but not in more polar environments. Thus, lipid droplets can be visualized on a fluorescent microscope equipped with simple GFP imaging capability after only a brief Nile red staining step in isopropanol. The speed, affordability, and reproducibility of this protocol make it ideally suited for high throughput screens. We also demonstrate a paired method for the biochemical determination of triglycerides and phospholipids using gas chromatography mass-spectrometry. This more rigorous protocol should be used as confirmation of results obtained from the Nile red microscopic lipid determination. We anticipate that these techniques will become new standards in the field of C. elegans metabolic research.

Biochemical and High Throughput Microscopic Assessment of Fat Mass in Caenorhabditis Elegans

We present robust biochemical and microscopic methods for studying Caenorhabditis elegans lipid stores. A rapid, simple, fixing-staining procedure for fluorescent lipid droplet imaging leverages the spectral properties of the lipophilic dye Nile red. We then present biochemical measurement of triglycerides and phospholipids using solid phase extraction and gas chromatography-mass spectrometry.

Bioquímica e Alto Rendimento Avaliação microscópica de massa gorda em<em&gt; Caenorhabditis elegans</em

The nematode C. elegans has emerged as an important  model for the study of conserved genetic pathways regulating fat metabolism as  it relates to human ...

Biochemical Titration of Glycogen In vitro

Glycogen is the main energetic polymer of glucose in vertebrate animals and plays a crucial role in whole body metabolism as well as in cellular metabolism. Many methods to detect glycogen already exist but only a few are quantitative. We describe here a method using the Abcam Glycogen assay kit, which is based on specific degradation of glycogen to glucose by glucoamylase. Glucose is then specifically oxidized to a product that reacts with the OxiRed probe to produce fluorescence. Titration is accurate, sensitive and can be achieved on cell extracts or tissue sections. However, in contrast to other techniques, it does not give information about the distribution of glycogen in the cell. As an example of this technique, we describe here the titration of glycogen in two cell lines, Chinese hamster lung fibroblast CCL39 and human colon carcinoma LS174, incubated in normoxia (21% O2) versus hypoxia (1% O2). We hypothesized that hypoxia is a signal that prepares cells to synthesize and store glycogen in order to survive1.

Biochemical Titration of Glycogen In vitro

We describe here an accurate, reproducible and convenient biochemical method for titration of glycogen in vitro. This technique uses the Abcam Glycogen assay kit and is based on successive hydrolysis of glycogen to glucose and glucose titration by fluorescence.

Titulação Bioquímica de glicogênio<em&gt; In vitro</em

Glycogen is the main energetic polymer of glucose in vertebrate animals and plays a crucial role in whole body metabolism as well as in cellular ...

Generation and Purification of Human INO80 Chromatin Remodeling Complexes and Subcomplexes

INO80 chromatin remodeling complexes regulate nucleosome dynamics and DNA accessibility by catalyzing ATP-dependent nucleosome remodeling. Human INO80 complexes consist of 14 protein subunits including Ino80, a SNF2-like ATPase, which serves both as the catalytic subunit and the scaffold for assembly of the complexes. Functions of the other subunits and the mechanisms by which they contribute to the INO80 complex&#39;s chromatin remodeling activity remain poorly understood, in part due to the challenge of generating INO80 subassemblies in human cells or heterologous expression systems. This JOVE protocol describes a procedure that allows purification of human INO80 chromatin remodeling subcomplexes that are lacking a subunit or a subset of subunits. N-terminally FLAG epitope tagged Ino80 cDNA are stably introduced into human embryonic kidney (HEK) 293 cell lines using Flp-mediated recombination. In the event that a subset of subunits of the INO80 complex is to be deleted, one expresses instead mutant Ino80 proteins that lack the platform needed for assembly of those subunits. In the event an individual subunit is to be depleted, one transfects siRNAs targeting this subunit into an HEK 293 cell line stably expressing FLAG tagged Ino80 ATPase. Nuclear extracts are prepared, and FLAG immunoprecipitation is performed to enrich protein fractions containing Ino80 derivatives. The compositions of purified INO80 subcomplexes can then be analyzed using methods such as immunoblotting, silver staining, and mass spectrometry. The INO80 and INO80 subcomplexes generated according to this protocol can be further analyzed using various biochemical assays, which are described in the accompanying JOVE protocol. The methods described here can be adapted for studies of the structural and functional properties of any mammalian multi-subunit chromatin remodeling and modifying complexes.

This protocol describes a procedure for generating and purifying wild type and mutant versions of the human INO80 chromatin remodeling complex. Epitope tagged versions of INO80 subunits are stably expressed in HEK293 cells, and complete complexes and complexes lacking specific sets of subunits are purified by immunoaffinity chromatography.

Geração e Purificação de INO80 cromatina remodelação Complexos Humanos e subcomplexos

INO80 chromatin remodeling complexes regulate nucleosome dynamics and DNA accessibility by catalyzing ATP-dependent nucleosome remodeling. Human INO80 ...

Isolation of Specific Genomic Regions and Identification of Associated Molecules by enChIP

The identification of molecules associated with specific genomic regions of interest is required to understand the mechanisms of regulation of the functions of these regions. To enable the non-biased identification of molecules interacting with a specific genomic region of interest, we recently developed the engineered DNA-binding molecule-mediated chromatin immunoprecipitation (enChIP) technique. Here, we describe how to use enChIP to isolate specific genomic regions and identify the associated proteins and RNAs. First, a genomic region of interest is tagged with a transcription activator-like (TAL) protein or a clustered regularly interspaced short palindromic repeats (CRISPR) complex consisting of a catalytically inactive form of Cas9 and a guide RNA. Subsequently, the chromatin is crosslinked and fragmented by sonication. The tagged locus is then immunoprecipitated and the crosslinking is reversed. Finally, the proteins or RNAs that are associated with the isolated chromatin are subjected to mass spectrometric or RNA sequencing analyses, respectively. This approach allows the successful identification of proteins and RNAs associated with a genomic region of interest.

The identification of molecules associated with specific genomic regions of interest is required to understand the mechanisms of regulation of the functions of these regions. This protocol describes procedures to perform engineered DNA-binding molecule-mediated chromatin imunoprecipitation (enChIP) for identification of proteins and RNAs associated with a specific genomic region.

O isolamento de regiões específicas genômico e identificação de moléculas pela Associated enChIP

The identification of molecules associated with specific genomic regions of interest is required to understand the mechanisms of regulation of the ...

Amplification, Next-generation Sequencing, and Genomic DNA Mapping of Retroviral Integration Sites

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of diverse libraries of retroviral integration sites using ligation-mediated PCR (LM-PCR) amplification and next-generation sequencing (NGS), (2) mapping the genomic location of each virus-host junction using BEDTools, and (3) analyzing the data for statistical relevance. Genomic DNA extracted from infected cells is fragmented by digestion with restriction enzymes or by sonication. After suitable DNA end-repair, double-stranded linkers are ligated onto the DNA ends, and semi-nested PCR is conducted using primers complementary to both the long terminal repeat (LTR) end of the virus and the ligated linker DNA. The PCR primers carry sequences required for DNA clustering during NGS, negating the requirement for separate adapter ligation. Quality control (QC) is conducted to assess DNA fragment size distribution and adapter DNA incorporation prior to NGS. Sequence output files are filtered for LTR-containing reads, and the sequences defining the LTR and the linker are cropped away. Trimmed host cell sequences are mapped to a reference genome using BLAT and are filtered for minimally 97% identity to a unique point in the reference genome. Unique integration sites are scrutinized for adjacent nucleotide (nt) sequence and distribution relative to various genomic features. Using this protocol, integration site libraries of high complexity can be constructed from genomic DNA in three days. The entire protocol that encompasses exogenous viral infection of susceptible tissue culture cells to integration site analysis can therefore be conducted in approximately one to two weeks. Recent applications of this technology pertain to longitudinal analysis of integration sites from HIV-infected patients.

We describe a protocol for amplifying retroviral integration sites from the genomic DNA of infected cells, sequencing the amplified virus-host junctions, and then mapping these sequences to a reference genome. We also describe techniques to quantify the distribution of integration sites relative to various genomic annotations using BEDTools.

Amplificação, sequenciamento de próxima geração, e Genomic DNA Mapeamento das retrovirais Integração Sites

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of ...