Clinical and Translational Science Award program of NCATS UL1 TR0000427 and KL2 TR000428 (Cengiz P), UL1TR000427 to the UW ICTR from NIH/NCATS and funds from Waisman Center (Cengiz P), K08 NS088563-01A1 from NINDS (Cengiz P) and NIH P30 HD03352 (Waisman Center), NIH/NINDS 1K08NS078113 (Ferrazzano P). We would like to thank Albee Messing, PhD, for providing us the GFAP knockout mice.

NOTA: Este estudo foi realizado de acordo com a recomendação do Guia para o Cuidado e Uso de Animais de Laboratório do Instituto Nacional de Saúde. O protocolo animal foi aprovado pela Universidade de Wisconsin-Madison, Institutional Animal Care e do Comitê Use. Protocolo de Cultura Astrocyte primário que é apresentado aqui é adotada a partir dos protocolos apresentados por Zhang Y 19 et al. E Cengiz P 20 et al., Com algumas modificações. 1. hipocampo Dissecção e Cultura Astrocyte <ol><li> Prepare todos os reagentes e materiais necessários, incluindo tesouras cirúrgicas, fórceps finos lisos, uma pinça ponta plana, toalhas de papel, saco de lixo, 70% de etanol e 2 pratos de dissecação (3,5 cm de diâmetro) no gelo cheias de 2 Solução Salina Equilibrada de mL Hank (HBSS) cada . Certifique-se do equipamento cirúrgico são estéreis (autoclave) antes do procedimento e utilizar todos os outros materiais (Astrocyte chapeamento meio: soro DMEM + 5% + cavalo1% de penicilina-estreptomicina, soro de cavalo, de HBSS, 0,25% de tripsina, lamelas de vidro, placas de Petri, 15/50 mL tubos, frascos T25, etc.) como pré-esterilizado. </li><li> Pressione cuidadosamente e pulverizar a cabeça e pescoço do cachorro rato com 70% de etanol e decapitar usando uma tesoura esterilizada afiadas [Figura 1 (1)]. </li><li> Realizar uma incisão mediana de posterior para anterior crânio com uma tesoura pequena ao longo do couro cabeludo para expor o cérebro [Figura 1 (2-3)]. </li><li> Cortar o crânio com cuidado desde o pescoço até o nariz com uma tesoura pequena. Em seguida, corte crânio anterior para os bulbos olfatórios e inferior ao cerebelo para desconectar o crânio da base do crânio. </li><li> Fazer uma pequena incisão na base do crânio e cortar ao longo da linha média. Use uma pinça de ponta chata estéreis para descascar o crânio. Remover o tronco cerebral com a ajuda de uma pinça curvos. Remover o cérebro do crânio e colocar para o primeiro prato de dissecação [Figura 1 (4-9)] 21. </li><li> Usando uma pinça curva, virar o cérebro de modo que a superfície ventral do cérebro é voltado para cima e, em seguida, separar os dois hemisférios com uma lâmina cirúrgica estéril afiada [Figura 1 (10,11)] </li><li> Retire os hemisférios cerebrais e remova cuidadosamente o tecido mesencéfalo e tálamo abaulamento com um estéreis pinças curvas planas para revelar o hipocampo, uma estrutura pequena, cavalo marinho em forma no lobo temporal medial [Figura 1 (12-14)]. </li><li> Remova ambos os lóbulos do hipocampo [Figura 1 (15,16)] e dissecar cuidadosamente as meninges de lobos puxando com a pinça fina. Este passo evita a contaminação da cultura final do astrócito por células meníngeas e fibroblastos. </li><li> Transferir os lóbulos do hipocampo preparados para o segundo prato cheio com HBSS e devolvê-lo em gelo [Figura 1 (17,18)]. Piscina ambos hipocampo lóbulos de um único rato (P0 - P2) para preparação de hipopótamoculturas Campal astrócitos. Isto dá a densidade apropriada dos astrócitos. Picar lobos do hipocampo, utilizando uma lâmina cirúrgica estéril afiada (aproximadamente 4 vezes). </li><li> Aspirar HBSS de prato usando uma ponta estéril ligada a uma pipeta de 1 mL e adicionar 3 ml de 0,25% de tripsina, misturar e transferir para um tubo cónico de 15 ml estéril e a incubação do tecido a 37 ° C durante 20 min com agitação suave. </li><li> tubo de centrifugação a 300 xg durante 5 min. Aspirar o sobrenadante cuidadosamente, utilizando uma pipeta de vidro estéril ligada a uma linha de vácuo. Adicionar 10 ml de astrócitos chapeamento médio e triturado (20 - 30 vezes) usando um fogo polido pipeta de vidro até pedaços de tecido homogeneizar. </li><li> tubo de centrifugação a 300 xg durante 5 min. Aspirar o sobrenadante e adicionar 2 mL de meio de astrócitos chapeamento pré-aquecido fresco. Passar as células através de um filtro de malha de 70 um (filtro de células) para um novo tubo cónico de 50 mL. </li><li> suspensão de células em placa inteira num frasco de cultura T25 estéril poli-D-lisina / laminina, contendo 3 mL revestido demeios de astrócitos plaqueamento, depois incubar o balão a 37 ° C numa incubadora de CO2 a 5%. </li><li> Toda Aspirar mídia na dia- i n-vitro (DIV) 1, DIV 3 e DIV 7, e substituir com 2 mL de meio de astrócitos chapeamento frescos. Observe a progressão e confluência astrocitária sob microscópio de luz cada vez que ao substituir a mídia astrócitos chapeamento. NOTA: A DIV 1, todos os astrócitos viáveis ​​são ligadas à superfície do frasco de cultura e as células mortas ou a morrer que incluem neurónios estão a flutuar no sobrenadante. No DIV 3, as células ligadas começar a dividir para formar a camada de células de astrócitos. Na ausência de condições favoráveis, a cultura é quase desprovida de qualquer crescimento neuronal. No DIV 7, astrócitos camada é de cerca de 80 - 90% confluentes e alguns microglia, bem como células precursoras de oligodendrócitos estão presentes no topo da camada de astrócitos. </li><li> Aspirar o meio chapeamento do frasco, adicionar 2 mL de meio de astrócitos chapeamento pré-aquecido fresco, lavar and remover novamente no DIV 11, quando os astrócitos são confluentes e pronto para a sub cultura. </li><li> Adicionar 2 mL de tripsina a 0,25%, rode suavemente o frasco algumas vezes e aspirado de tripsina usando uma pipeta de vidro esterilizado. </li><li> Adicionar 2 mL de tripsina a 0,25% e deixar que o balão se sentar na capa de cultura de tecidos para 4-5 min a RT. </li><li> Remover a tripsina e manter o balão a 37 ° C numa incubadora de CO2 a 5% durante 10 min. Adicionar 5 mL pré-aquecido astrócitos chapeamento médio e retirar a camada de astrócitos tocando o frasco contra a palma da sua mão (3 - 4 vezes) seguido por trituração suave para conseguir separação completa e recolher os astrócitos em um tubo cônico de 15 mL. </li><li> tubo de centrifugação a 300 xg durante 5 min, aspirar o sobrenadante e adicionar 1 mL de meio fresco astrócitos chapeamento. </li><li> Adicionam-se 10 uL da suspensão de células para um hemocitómetro e contar as células na grande superfície reticulada central (1 mm2), utilizando um microscópio de contraste de fase invertida (objectiva 10X). Multiply por 10 4 para estimar o número de células por mL. Um balão T25 produzirá ~ 1 x 10 6 células totais dissociado. Semente ~ 1 x 10 5 células em 2 ml de astrócitos do plaqueamento em meio de um diâmetro de Poli-D-Lisina lamela de vidro pré-revestidas com 12 mm de o poço de uma placa de cultura de 24 poços. </li><li> Incubar a 37 ° C numa incubadora de CO2 a 5%. Execute OGD / Reox na DIV 12-14 (seção 2). </li><li> Tratar as culturas de astrócitos na DIV 3 com cloridrato de 5 mM L-leucina éster metílico (LME) até DIV 11 se culturas de hipocampo desprovidas de microglia são desejados. Após LME incubação, as culturas sujeitas a agitação (300 rpm durante 1 h) para remover contaminantes microglia. NOTA: LME é um agente citotóxico da microglia que tem sido amplamente utilizado como um método para eliminar a proliferação microglia 22. </li></ol> 2. OGD / Reox Tratamento <ol><li> media aspirado de lamela contendo cultura de astrócitos aderente (DIV 12-14) e lavar 3 vezespor rotação suave a 24 poços de cultura prato que prende a lamela algumas vezes com 1 mL de solução isotónica OGD (pH 7,4) contendo (em mM): 0 de glucose, 21 de NaHCO3, 120 NaCl, 5.36 KCl, 0,33 Na 2 HPO 4, 0,44 KH 2 PO 4, 1,27 de CaCl2, e 0,81 MgSO 4. </li><li> Adicionar 0,2 mL de solução a OGD bem para cobrir a lamela e incubar durante 2 h numa incubadora hipóxico contendo 94% de N 2, 1% de O2, e 5% de CO 2. Misturar suavemente com um agitador orbital (50 rpm) durante os primeiros 30 minutos de hipoxia para facilitar o intercâmbio de gás. </li><li> Incubar as células de controlo normóxicas durante 2 h em 5% de CO 2 e o ar atmosférico em um tampão idêntica à solução OGD, excepto a adição de 5,5 mM de glucose. </li><li> Para Reox, aspirado solução OGD e adicionar 2 mL de astrócitos chapeamento médio. Incubar em 5% de CO 2 e o ar atmosférico, a 37 ° C durante 5 h. </li></ol> 3. imunocitoquímica Coloração &lt;/ P&gt; <ol><li> Aspirar o meio de cultura usando uma pipeta de vidro estéril ligada a uma linha de vácuo e rapidamente enxaguar lamela uma vez por adição de 1 mL de 0,1 M de Tris salino tamponado (TBS) (NaCl 154 mM, 16 mM, de Trizma base, Tris-HCl a 84, pH 7,4) para o poço. Aspirar e juntar 2 ml de paraformaldeído a 4% (PFA) em 1x tampão fosfato salino (PBS). Incubar durante 15 minutos à TA. </li><li> Aspirar e adicionar 1 mL de 0,1 M TBS, em seguida, coloque em um agitador de balanço por 2 min. Repita 3 vezes. Adicionar 1 ml de solução (soro de cabra a 10%, 10 mg / mL de BSA, 0,025% de Triton X-100 a 0,1 M em TBS) de bloqueio e incubar durante 30 min a 37 ° C num agitador de balanço. </li><li> Aspirar solução de bloqueio e adicionar anticorpo-GFAP monoclonal anti-primário do rato (0,2 mL de uma diluição de 1: 500 em solução de bloqueio) e soro policlonal de coelho anti-S100B (1: 500) ou anticorpo policlonal de coelho anti-HIF1α (1: 200) durante 60 min a 37 ° C num agitador de balanço. </li><li> Alternativamente, alguns astrócitos são incubadas com anticorpo policlonal de coelho anti-IBA1 (1: 200) e seg ratooclonal anti-MAP2 para acessar a pureza da cultura. </li><li> Aspirar anticorpo primário e enxaguar lamela pela adição de 1 mL de 0,1 M TBS e colocação num agitador de balanço por 2 min e depois aspirar. Repita duas vezes. </li><li> Adicionar 0,2 ml de uma diluição 1: 200 dos anticorpos anti-coelho conjugados 568-488-conjugados e anti-ratinho de cabra secundário em solução de bloqueio durante 60 minutos a 37 ° C num agitador de balanço. </li><li> Aspirar anticorpo secundário e enxaguar lamela pela adição de 1 mL de 0,1 M TBS e coloque num agitador de balanço por 2 min e depois aspirar. Repita duas vezes. </li><li> Remover lamela de bem e seco, colocando em um slide posicionado sobre uma lâmina de cabelo. Mount lamela em um novo slide, invertendo em uma única gota de Vectashield hardset meio de montagem com DAPI (1,5 ng / mL). </li><li> lamelas de imagem em um microscópio confocal usando 20X objetivo óleo seco ou 60X. Aquisição de imagens (512 x 512) para DAPI (405 nm ex / 450 nm em) e fluorocromo 488 etiquetado anticorpo GFAP (488 nm ex / 515 nmem). Manter parâmetros de aquisição constantes dentro do 20X e 60X grupos. </li></ol> 4. A determinação do sexo Usando PCR <ol><li> Calor pup dedo do pé ou dedo para recortes de 95 ° C durante 45 min em NaOH 50 mM e neutraliza-se com igual volume de Tris 1 M, pH 6,8. </li><li> Adicionar 1 mL da solução de ADN extraído a 19 uL da mistura seguinte: 5 pmol de iniciadores para os genes Myog e Sry, 1x tampão de reacção, 0,2 mM de cada desoxinucleótido e 8 U de Taq polimerase. </li><li> Use sequências de primers; Sry 5&#39;TCATGAGACTGCCAACCACAG3 &#39;, 5&#39;CATGACCACCACCACCACCAA3&#39; e Myog 5&#39;TTACGTCCATCGTGGACAGC3 &#39;, 5&#39;TGGGCTGGGTGTTAGTCTTA3&#39; 23. </li><li> Executar o seguinte protocolo de PCR: 95 ° C durante 3 min, depois 30 ciclos de desnaturação a 95 ° C durante 15 s, emparelhamento a 58 ° C durante 15 s, e alongamento a 72 ° C durante 1 min. Seguindo esta 30 ciclos, a reacção termina com um final de 72 ° C alongamento durante 1 min. </li><li> PC separadoProdutos R electroforeticamente num gel de brometo de etidio contendo 2% de agarose e visualização sob luz UV. (Figura 2A). CUIDADO! O brometo de etídio é um potencial cancerígeno e deve ser manuseado com cuidado e descartados de forma apropriada de acordo com os regulamentos da instituição. </li></ol>

<ol>
	<li>Powell, E. M., Geller, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+astrocyte-mediated+cues+in+neuronal+guidance+and+process+extension.">Dissection of astrocyte-mediated cues in neuronal guidance and process extension.</a> Glia. 26, 73-83 (1999).</li><li>Koehler, R. C., Roman, R. J., Harder, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Astrocytes+and+the+regulation+of+cerebral+blood+flow.">Astrocytes and the regulation of cerebral blood flow.</a> Trends in neurosciences. 32, 160-169 (2009).</li><li>Seifert, G., Schilling, K., Steinhauser, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Astrocyte+dysfunction+in+neurological+disorders:+a+molecular+perspective.">Astrocyte dysfunction in neurological disorders: a molecular perspective.</a> Nature reviews. Neuroscience. 7, 194-206 (2006).</li><li>Ballabh, P., Braun, A., Nedergaard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+blood-brain+barrier:+an+overview:+structure,+regulation,+and+clinical+implications.">The blood-brain barrier: an overview: structure, regulation, and clinical implications.</a> Neurobiology of disease. 16, 1-13 (2004).</li><li>Araque, A., Parpura, V., Sanzgiri, R. P., Haydon, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tripartite+synapses:+glia,+the+unacknowledged+partner.">Tripartite synapses: glia, the unacknowledged partner.</a> Trends in neurosciences. 22, 208-215 (1999).</li><li>Anderson, M. A., Ao, Y., Sofroniew, M. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heterogeneity+of+reactive+astrocytes.">Heterogeneity of reactive astrocytes.</a> Neuroscience letters. 565, 23-29 (2014).</li><li>Cengiz, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+Na+/H++exchanger+isoform+1+is+neuroprotective+in+neonatal+hypoxic+ischemic+brain+injury.">Inhibition of Na+/H+ exchanger isoform 1 is neuroprotective in neonatal hypoxic ischemic brain injury.</a> Antioxidants &amp; redox signaling. 14, 1803-1813 (2011).</li><li>Ferriero, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neonatal+brain+injury.">Neonatal brain injury.</a> The New England journal of medicine. 351, 1985-1995 (2004).</li><li>Hill, C. A., Fitch, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sex+differences+in+mechanisms+and+outcome+of+neonatal+hypoxia-ischemia+in+rodent+models:+implications+for+sex-specific+neuroprotection+in+clinical+neonatal+practice.">Sex differences in mechanisms and outcome of neonatal hypoxia-ischemia in rodent models: implications for sex-specific neuroprotection in clinical neonatal practice.</a> Neurol Res Int. , 1-9 (2012).</li><li>Cikla, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ERalpha+Signaling+Is+Required+for+TrkB-Mediated+Hippocampal+Neuroprotection+in+Female+Neonatal+Mice+after+Hypoxic+Ischemic+Encephalopathy(1,2,3).">ERalpha Signaling Is Required for TrkB-Mediated Hippocampal Neuroprotection in Female Neonatal Mice after Hypoxic Ischemic Encephalopathy(1,2,3).</a> eNeuro. 3, (2016).</li><li>Uluc, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TrkB+receptor+agonist+7,+8+dihydroxyflavone+triggers+profound+gender-+dependent+neuroprotection+in+mice+after+perinatal+hypoxia+and+ischemia.">TrkB receptor agonist 7, 8 dihydroxyflavone triggers profound gender- dependent neuroprotection in mice after perinatal hypoxia and ischemia.</a> CNS Neurol Disord Drug Targets. 12, 360-370 (2013).</li><li>Cikla, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Suppression+of+microglia+activation+after+hypoxia-ischemia+results+in+age-dependent+improvements+in+neurologic+injury.">Suppression of microglia activation after hypoxia-ischemia results in age-dependent improvements in neurologic injury.</a> J Neuroimmunol. 291, 18-27 (2016).</li><li>McQuillen, P. S., Ferriero, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+vulnerability+in+the+developing+central+nervous+system.">Selective vulnerability in the developing central nervous system.</a> Pediatr Neurol. 30, 227-235 (2004).</li><li>Morken, T. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Altered+astrocyte-neuronal+interactions+after+hypoxia-ischemia+in+the+neonatal+brain+in+female+and+male+rats.">Altered astrocyte-neuronal interactions after hypoxia-ischemia in the neonatal brain in female and male rats.</a> Stroke; a journal of cerebral circulation. 45, 2777-2785 (2014).</li><li>Chisholm, N. C., Sohrabji, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Astrocytic+response+to+cerebral+ischemia+is+influenced+by+sex+differences+and+impaired+by+aging.">Astrocytic response to cerebral ischemia is influenced by sex differences and impaired by aging.</a> Neurobiology of disease. 85, 245-253 (2016).</li><li>Liu, M., Oyarzabal, E. A., Yang, R., Murphy, S. J., Hurn, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+method+for+assessing+sex-specific+and+genotype-specific+response+to+injury+in+astrocyte+culture.">A novel method for assessing sex-specific and genotype-specific response to injury in astrocyte culture.</a> Journal of neuroscience methods. 171, 214-217 (2008).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+the+biological+contributions+to+human+health:+does+sex+matter?.">Exploring the biological contributions to human health: does sex matter?.</a> Journal of women's health &amp; gender-based. 10, 433-439 (2001).</li><li>Collins, F. S., Tabak, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Policy:+NIH+plans+to+enhance+reproducibility.">Policy: NIH plans to enhance reproducibility.</a> Nature. 505, 612-613 (2014).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+single-step+induction+of+functional+neurons+from+human+pluripotent+stem+cells.">Rapid single-step induction of functional neurons from human pluripotent stem cells.</a> Neuron. 78, 785-798 (2013).</li><li>Cengiz, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sustained+Na+/H++exchanger+activation+promotes+gliotransmitter+release+from+reactive+hippocampal+astrocytes+following+oxygen-glucose+deprivation.">Sustained Na+/H+ exchanger activation promotes gliotransmitter release from reactive hippocampal astrocytes following oxygen-glucose deprivation.</a> PloS one. 9, e84294 (2014).</li><li>Landis, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+call+for+transparent+reporting+to+optimize+the+predictive+value+of+preclinical+research.">A call for transparent reporting to optimize the predictive value of preclinical research.</a> Nature. 490, 187-191 (2012).</li><li>Hamby, M. E., Uliasz, T. F., Hewett, S. J., Hewett, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+an+improved+procedure+for+the+removal+of+microglia+from+confluent+monolayers+of+primary+astrocytes.">Characterization of an improved procedure for the removal of microglia from confluent monolayers of primary astrocytes.</a> J Neurosci Methods. 150, 128-137 (2006).</li><li>McClive, P. J., Sinclair, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+DNA+extraction+and+PCR-sexing+of+mouse+embryos.">Rapid DNA extraction and PCR-sexing of mouse embryos.</a> Molecular reproduction and development. 60, 225-226 (2001).</li><li>Wolterink-Donselaar, I. G., Meerding, J. M., Fernandes, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+method+for+gender+determination+in+newborn+dark+pigmented+mice.">A method for gender determination in newborn dark pigmented mice.</a> Lab Anim (NY). 38, 35-38 (2009).</li><li>Uliasz, T. F., Hamby, M. E., Jackman, N. A., Hewett, J. A., Hewett, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+primary+astrocyte+cultures+devoid+of+contaminating+microglia.">Generation of primary astrocyte cultures devoid of contaminating microglia.</a> Methods Mol Biol. 814, 61-79 (2012).</li><li>Raponi, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=S100B+expression+defines+a+state+in+which+GFAP-expressing+cells+lose+their+neural+stem+cell+potential+and+acquire+a+more+mature+developmental+stage.">S100B expression defines a state in which GFAP-expressing cells lose their neural stem cell potential and acquire a more mature developmental stage.</a> Glia. 55, 165-177 (2007).</li><li>Souza, D. G., Bellaver, B., Souza, D. O., Quincozes-Santos, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+adult+rat+astrocyte+cultures.">Characterization of adult rat astrocyte cultures.</a> PloS one. 8, e60282 (2013).</li><li>Puschmann, T. B., Dixon, K. J., Turnley, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Species+differences+in+reactivity+of+mouse+and+rat+astrocytes+in+vitro.">Species differences in reactivity of mouse and rat astrocytes in vitro.</a> Neuro-Signals. 18, 152-163 (2010).</li><li>Schildge, S., Bohrer, C., Beck, K., Schachtrup, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+culture+of+mouse+cortical+astrocytes.">Isolation and culture of mouse cortical astrocytes.</a> Journal of visualized experiments : JoVE. , (2013).</li><li>Saura, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microglial+cells+in+astroglial+cultures:+a+cautionary+note.">Microglial cells in astroglial cultures: a cautionary note.</a> J Neuroinflammation. 4 (26), (2007).</li></ol>

Nenhum dos autores têm interesses concorrentes ou conflitantes.

Para estudar as diferenças entre os sexos nas propriedades e função de astrócitos em condições fisiológicas e patológicas, preparação de astrócitos primários sexado em cultura celular é uma ferramenta importante para utilizar. No presente estudo relatamos um altamente eficiente e um método reprodutível à cultura uma população homogénea altamente enriquecido de astrócitos do hipocampo sexado de recém-nascidos (P0-P2) C57BL / 6 (tipo selvagem) ou K19F (GFAP null) filhotes de rato in vitro. Es...

Os astrócitos são um dos principais intervenientes mais importantes no sistema nervoso central (SNC). Crescente corpo de evidências indica que os papéis de astrócitos são mais do que apoio neuronal. Na verdade, o papel dos astrócitos em condições fisiológicas pode ser muito complexo, tais como guiar a migração de axónios em desenvolvimento 1, regulando SNC fluxo de sangue 2, a manutenção da homeostase do sináptica fluido intersticial 3 pH, e participam na barreira hemato-encefálica 4 e 5 da transmissão sináptica. Em condições patológicas, astrócitos responder a uma lesão com um processo chamado astrogliose reactivo em que a morfologia, número, localização, topografia (em relação à distância do insulto) e a função dos astrocitos podem mudar de uma forma heterogénea 6,7. Astrogliosis visto seguinte encefalopatia hipóxico-isquémica neonatal talvez contribuindo para a morbidade e mortalidade de recém-nascidos <saté&gt; 8. estudos clínicos e experimentais recentes indicam que a gravidade da lesão cerebral parece ser dependente do sexo e que os machos recém-nascidos são mais susceptíveis aos efeitos de hipoxia / isquemia (HI) lesão cerebral -relacionados, resultando nos resultados neurológicos mais graves, em comparação com mulheres com lesões cerebrais comparáveis 9-11. Embora a localização da lesão depende da idade gestacional e a duração e a gravidade da lesão, hipocampo é uma das regiões mais vulgarmente efectuada no SNC após HI neonatal prazo, e aumentou astrogliose hipocampo foi confirmada por super-regulação de a proteína glial fibrilar ácida (GFAP) 3 d após a HI neonatal 7,10,12,13. Diferenças sexuais em função de astrócitos foram mostrados em ambos os recém-nascidos e roedores adultos após isquemia cerebral 14,15. Além disso, a susceptibilidade de astrócitos do sexo masculino de isquemia in vitro foi demonstrado por um aumento da CELl morte em comparação com astrócitos corticais do sexo feminino na cultura 16. Diferenças sexuais começar no útero e continuam até a morte 17. Durante a última década, a importância de incluir os sexos em condições experimentais em cultura celular e in vivo estudos têm sido a ênfase do Instituto de Medicina e NIH para buscar conhecimentos fundamentais nas diferenças de sexo visto em condições fisiológicas e patológicas 17,18 . Desenvolvimento de métodos confiáveis ​​para isolar e manter populações de astrócitos do hipocampo sexuado é essencial para compreender a base celular das diferenças sexuais nas consequências patológicas de HI neonatal. O presente estudo foi desenhado para proporcionar as técnicas para preparar culturas de astrócitos do hipocampo específicas do sexo enriquecidos de ratos recém-nascidos, a fim de avaliar os papéis de astrócitos GFAP-imunoreativos seguintes Oxygen / Glucose Privação (OGD) e reoxigenação (Reox), induzindoHl em meio de cultura de células. Esta técnica pode ser usado para testar qualquer hipótese referente a astrócitos do hipocampo em machos e fêmeas neonatais sob condições de normóxia e isquémicas.

<table><tbody><tr><td>&lt;strong&gt;&lt;em&gt;Astrocyte culture media&lt;/em&gt;&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>DMEM, high glucose</td><td>cellgro</td><td>10-013-CV</td><td></td></tr><tr><td>Horse Serum</td><td>Gibco</td><td>26050-070</td><td>Final Concentration: 10%</td></tr><tr><td>Penicillin-Streptomycin</td><td>Cellgro&amp;nbsp;</td><td>30-002-CI</td><td>Final Concentration: 1%</td></tr><tr><td>L-Leucine methyl ester hydrochloride</td><td>Aldrich</td><td>L1002-25G</td><td>Final Concentration: 5 mM</td></tr><tr><td>&lt;strong&gt;&lt;em&gt;Solution for brain tissue digestion&lt;/em&gt;&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>HBSS</td><td>Life Technologies</td><td>14170-088</td><td></td></tr><tr><td>Trypsin</td><td>cellgro</td><td>25-050-CI</td><td>Final Concentration: 0.25%</td></tr><tr><td>&lt;strong&gt;&lt;em&gt;Other&lt;/em&gt;&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>70% (vol/vol) ethanol</td><td>Roth</td><td>9065.2</td><td></td></tr><tr><td>Poly-D-Lysine (PDL) 12 mm round coverslips&amp;nbsp;</td><td>Corning</td><td>354087</td><td></td></tr><tr><td>Water</td><td>Sigma</td><td>W3500</td><td>Cell-culture grade</td></tr><tr><td>PBS</td><td>cellgro</td><td>21-040-CV</td><td>Cell-culture grade</td></tr><tr><td>0.05% Trypsin-EDTA&amp;nbsp;</td><td>Life Technologies</td><td>25300-062</td><td></td></tr><tr><td>70 &amp;mu;m Sterile cell strainer&amp;nbsp;</td><td>Fisher scientific</td><td>22363548</td><td></td></tr><tr><td>3.5 cm Petri dish</td><td>BD Falcon</td><td>353001</td><td></td></tr><tr><td>15 mL Falcon tube</td><td>BD Falcon</td><td>352096</td><td></td></tr><tr><td>50 mL Falcon tube</td><td>BD Falcon</td><td>352070</td><td></td></tr><tr><td>Forceps, fine&amp;nbsp;</td><td>Dumont</td><td>2-1032; 2-1033</td><td># 3c; # 5</td></tr><tr><td>Forceps, flat tip</td><td>KLS Martin</td><td>12-120-11</td><td></td></tr><tr><td>13 cm surgical scissors</td><td>Aesculap</td><td>BC-140-R</td><td></td></tr><tr><td>Confocal Microscope</td><td>Nikon</td><td>A1RSi&amp;nbsp;</td><td></td></tr><tr><td>Centrifuge</td><td>Eppendorf</td><td>5805000.017</td><td>5804R</td></tr><tr><td>Orbital Shaker</td><td>Thermo Scientific</td><td>SHKE 4450-1CE</td><td>MaxQ 4450&amp;nbsp;</td></tr><tr><td>Anti-IBA1</td><td>Wako</td><td>019-19741</td><td>Rabbit monoclonal</td></tr><tr><td>Anti-MAP2</td><td>Sigma</td><td>M2320</td><td>Mouse monoclonal</td></tr><tr><td>Anti-HIF1alpha</td><td>abcam</td><td>ab179483</td><td>Rabbit monoclonal</td></tr><tr><td>Anti-S100B</td><td>Sigma</td><td>HPA015768</td><td>Rabbit polyclonal</td></tr><tr><td>Anti-GFAP (cocktail)</td><td>Biolegend</td><td>837602</td><td></td></tr><tr><td>VECTASTAIN Elite ABC Kit (Rabbit IgG)</td><td>Vector Labs</td><td>PK-6101</td><td>Contains 4 Reagents&amp;nbsp;</td></tr><tr><td>Goat Anti Rabbit Alexa-Fluor 488</td><td>Invitrogen</td><td>A11070</td><td></td></tr><tr><td>Goat Anti Mouse Alexa-Fluor 568</td><td>Invitrogen</td><td>A11004</td><td></td></tr></tbody></table>

sex differences in mouse hippocampal astrocytes after in-vitro ischemia

Astrogliosis seguinte hipóxia / isquemia (HI) lesão cerebral -relacionados desempenha um papel no aumento da morbidade e mortalidade em recém-nascidos. Estudos clínicos recentes indicam que a gravidade da lesão cerebral parece ser dependente do sexo, e que os machos recém-nascidos são mais susceptíveis aos efeitos de lesões cerebrais relacionadas-HI, resultando nos resultados neurológicos mais graves, em comparação com mulheres com lesões cerebrais comparáveis. O desenvolvimento de métodos confiáveis ​​para isolar e manter populações altamente enriquecido de astrócitos do hipocampo sexuado é essencial para compreender a base celular das diferenças sexuais nas consequências patológicas de HI neonatal. Neste estudo, descrevemos um método para a criação de culturas de astrócitos do sexo específicos do hipocampo que são submetidos a um modelo de isquemia in vitro, a privação de oxigénio-glicose, seguida por reoxigenação. astrogliosis reactiva subsequente foi examinado por immunostaiNing para a proteína glial fibrilar ácida (GFAP) e a S100B. Este método fornece uma ferramenta útil para estudar o papel do sexo masculino e astrócitos do hipocampo do sexo feminino seguinte HI neonatal, separadamente.

Compreender os papéis de funções de astrócitos sexado em condições fisiológicas ou fisiopatológicas foram imensamente elucidada por cultura destas células sob condições in vitro. O aspecto importante da cultura realizando sexuado é para determinar o sexo do filhote de rato antes da sua utilização. Determinou-se o sexo do ratinho geneticamente por PCR e por avaliação visual (Figura 2) 16. A metodologia de determinação do sexo usando P...

Watch this Scientific Journal Video about Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia at JoVE.com

Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia

Os astrócitos são um dos principais intervenientes mais importantes no sistema nervoso central (SNC). Aqui, nós estamos relatando um método prático de protocolo de cultura de astrócitos do hipocampo sexuado, a fim de estudar os mecanismos subjacentes a função de astrócitos em filhotes recém-nascidos do sexo masculino e feminino após isquemia in-vitro.

As diferenças sexuais no mouse do hipocampo astrócitos após<em&gt; In-Vitro</em&gt; Isquemia

Astrogliosis following hypoxia/ischemia (HI)-related brain injury plays a role in increased morbidity and mortality in neonates. Recent clinical studies ...

sex-differences-mouse-hippocampal-astrocytes-after-vitro

Research

JoVE Journal

Neuroscience

Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia

13.3K visualizações.  University of Wisconsin.  Os astrócitos são um dos principais intervenientes mais importantes no sistema nervoso central (SNC). Aqui, nós estamos relatando um método prático de protocolo de cultura de astrócitos do hipocampo sexuado, a fim de estudar os mecanismos subjacentes a função de astrócitos em filhotes recém-nascidos do sexo masculino e feminino após isquemia in-vitro. 

Vídeo: Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia

Isolation and Culture of Mouse Cortical Astrocytes

Astrocytes are an abundant cell type in the mammalian brain, yet much remains to be learned about their molecular and functional characteristics. In vitro astrocyte cell culture systems can be used to study the biological functions of these glial cells in detail. This video protocol shows how to obtain pure astrocytes by isolation and culture of mixed cortical cells of mouse pups. The method is based on the absence of viable neurons and the separation of astrocytes, oligodendrocytes and microglia, the three main glial cell populations of the central nervous system, in culture. Representative images during the first days of culture demonstrate the presence of a mixed cell population and indicate the timepoint, when astrocytes become confluent and should be separated from microglia and oligodendrocytes. Moreover, we demonstrate purity and astrocytic morphology of cultured astrocytes using immunocytochemical stainings for well established and newly described astrocyte markers. This culture system can be easily used to obtain pure mouse astrocytes and astrocyte-conditioned medium for studying various aspects of astrocyte biology.

Astrocytes have been recognized to be versatile cells participating in fundamental biological processes that are essential for normal brain development and function, and central nervous system repair. Here we present a rapid procedure to obtain pure mouse astrocyte cultures to study the biology of this major class of central nervous system cells.

Isolamento e Cultura de astrócitos corticais de rato

Astrocytes  are an abundant cell type in the mammalian brain, yet much remains to be  learned about their molecular and functional characteristics. In ...

Neurociência

Sex Stratified Neuronal Cultures to Study Ischemic Cell Death Pathways

Sex differences in neuronal susceptibility to ischemic injury and neurodegenerative disease have long been observed, but the signaling mechanisms responsible for those differences remain unclear. Primary disassociated embryonic neuronal culture provides a simplified experimental model with which to investigate the neuronal cell signaling involved in cell death as a result of ischemia or disease; however, most neuronal cultures used in research today are mixed sex. Researchers can and do test the effects of sex steroid treatment in mixed sex neuronal cultures in models of neuronal injury and disease, but accumulating evidence suggests that the female brain responds to androgens, estrogens, and progesterone differently than the male brain. Furthermore, neonate male and female rodents respond differently to ischemic injury, with males experiencing greater injury following cerebral ischemia than females. Thus, mixed sex neuronal cultures might obscure and confound the experimental results; important information might be missed. For this reason, the Herson Lab at the University of Colorado School of Medicine routinely prepares sex-stratified primary disassociated embryonic neuronal cultures from both hippocampus and cortex. Embryos are sexed before harvesting of brain tissue and male and female tissue are disassociated separately, plated separately, and maintained separately. Using this method, the Herson Lab has demonstrated a male-specific role for the ion channel TRPM2 in ischemic cell death. In this manuscript, we share and discuss our protocol for sexing embryonic mice and preparing sex-stratified hippocampal primary disassociated neuron cultures. This method can be adapted to prepare sex-stratified cortical cultures and the method for embryo sexing can be used in conjunction with other protocols for any study in which sex is thought to be an important determinant of outcome.

Primary disassociated embryonic hippocampal neuronal cultures are useful for investigating the signaling mechanisms involved in neuron death. Sexing the embryos before the isolation and dissociation of the hippocampus allows the preparation of separate male and female cultures, which enables the researcher to identify and investigate sex-specific cell signaling.

Sex differences in neuronal susceptibility to ischemic injury and neurodegenerative disease have long been observed, but the signaling mechanisms ...

Assessment of Dendritic Arborization in the Dentate Gyrus of the Hippocampal Region in Mice

Dendritic arborization has been shown to be a reliable marker for examination of structural and functional integrity of neurons. Indeed, the complexity and extent of dendritic arborization correlates well with the synaptic plasticity in these cells. A reliable method for assessment of dendritic arborization is needed to characterize the deleterious effects of neurological disorders on these structures and to determine the effects of therapeutic interventions. However, quantification of these structures has proven to be a formidable task given their complex and dynamic nature. Fortunately, sophisticated imaging techniques can be paired with conventional staining methods to assess the state of dendritic arborization, providing a more reliable and expeditious means of assessment. Below is an example of how these imaging techniques were paired with staining methods to characterize the dendritic arborization in wild type mice. These complementary imaging methods can be used to qualitatively and quantitatively assess dendritic arborization that span a rather wide area within the hippocampal region.

We describe two methods for visualization and quantification of dendritic arborization in the hippocampus of mouse models: real-time and extended depth of field imaging. While the former method allows sophisticated topographical tracing and quantification of the extent of branching, the latter allows speedy visualization of the dendritic tree.

Avaliação de dendríticas Arborização no giro dentado do hipocampo em Ratos Região

Dendritic arborization has been shown to be a reliable marker for examination of structural and functional integrity of neurons. Indeed, the complexity ...

Monitoring Astrocyte Reactivity and Proliferation in Vitro Under Ischemic-Like Conditions

Ischemic stroke is a complex brain injury caused by a thrombus or embolus obstructing blood flow to parts of the brain. This leads to deprivation of oxygen and glucose, which causes energy failure and neuronal death. After an ischemic stroke insult, astrocytes become reactive and proliferate around the injury site as it develops. Under this scenario, it is difficult to study the specific contribution of astrocytes to the brain region exposed to ischemia. Therefore, this article introduces a methodology to study primary astrocyte reactivity and proliferation under an in vitro model of an ischemia-like environment, called oxygen glucose deprivation (OGD). Astrocytes were isolated from 1-4 day-old neonatal rats and the number of non-specific astrocytic cells was assessed using astrocyte selective marker Glial Fibrillary Acidic Protein (GFAP) and nuclear staining. The period in which astrocytes are subjected to the OGD condition can be customized, as well as the percentage of oxygen they are exposed to. This flexibility allows scientists to characterize the duration of the ischemic-like condition in different groups of cells in vitro. This article discusses the timeframes of OGD that induce astrocyte reactivity, hypertrophic morphology, and proliferation as measured by immunofluorescence using Proliferating Cell Nuclear Antigen (PCNA). Besides proliferation, astrocytes undergo energy and oxidative stress, and respond to OGD by releasing soluble factors into the cell medium. This medium can be collected and used to analyze the effects of molecules released by astrocytes in primary neuronal cultures without cell-to-cell interaction. In summary, this primary cell culture model can be efficiently used to understand the role of isolated astrocytes upon injury.

Monitoring Astrocyte Reactivity and Proliferation in Vitro Under Ischemic-Like Conditions

Ischemic stroke is a complex event in which the specific contribution of astrocytes to the affected brain region exposed to oxygen glucose deprivation (OGD) is difficult to study. This article introduces a methodology to obtain isolated astrocytes and study their reactivity and proliferation under OGD conditions.

Monitoramento de Astrocyte de reatividade e proliferação in Vitro sob condições isquêmicas

Ischemic stroke is a complex brain injury caused by a thrombus or embolus obstructing blood flow to parts of the brain. This leads to deprivation of ...

Neurobehavioral Assessments in a Mouse Model of Neonatal Hypoxic-ischemic Brain Injury

We performed unilateral carotid artery occlusion on CD-1 mice to create a neonatal hypoxic-ischemic (HI) model and investigated the effects of neonatal HI brain injury by studying neurobehavioral functions in these mice compared to non-operated (i.e., normal) mice. During the study, Rice-Vannucci&#39;s method was used to induce neonatal HI brain damage in postnatal day 7-10 (P7-10) mice. The HI operation was performed on the pups by unilateral carotid artery ligation and exposure to hypoxia (8% O2 and 92% N2 for 90 min). One week after the operation, the damaged brains were evaluated with the naked eye through the semi-transparent skull and were categorized into subgroups based on the absence (&#34;no cortical injury&#34; group) or presence (&#34;cortical injury&#34; group) of cortical injury, such as a lesion in the right hemisphere. On week 6, the following neurobehavioral tests were performed to evaluate the cognitive and motor functions: passive avoidance task (PAT), ladder walking test, and grip strength test. These behavioral tests are helpful in determining the effects of neonatal HI brain injury and are used in other mouse models of neurodegenerative diseases. In this study, neonatal HI brain injury mice showed motor deficits that corresponded to right hemisphere damage. The behavioral test results are relevant to the deficits observed in human neonatal HI patients, such as cerebral palsy or neonatal stroke patients. In this study, a mouse model of neonatal HI brain injury was established and showed different degrees of motor deficits and cognitive impairment compared to non-operated mice. This work provides basic information on the HI mouse model. MRI images demonstrate the different phenotypes, separated according to the severity of brain damage by motor and cognitive tests.

We performed unilateral carotid artery occlusion on postnatal day 7-10 CD-1 mouse pups to create a neonatal hypoxic-ischemic (HI) model and investigated the effects of HI brain injury. We studied neurobehavioral functions in these mice compared to non-operated normal mice.

Neurocomportamentais avaliações em um modelo do rato de lesão cerebral hipóxica-isquêmica Neonatal

We performed unilateral carotid artery occlusion on CD-1 mice to create a neonatal hypoxic-ischemic (HI) model and investigated the effects of neonatal HI ...

Ex Vivo Pressurized Hippocampal Capillary-Parenchymal Arteriole Preparation for Functional Study

From subtle behavioral alterations to late-stage dementia, vascular cognitive impairment typically develops following cerebral ischemia. Stroke and cardiac arrest are remarkably sexually dimorphic diseases, and both induce cerebral ischemia. However, progress in understanding the vascular cognitive impairment, and then developing sex-specific treatments, has been partly limited by challenges in investigating the brain microcirculation from mouse models in functional studies. Here, we present an approach to examine the capillary-to-arteriole signaling in an ex vivo hippocampal capillary-parenchymal arteriole (HiCaPA) preparation from mouse brain. We describe how to isolate, cannulate, and pressurize the microcirculation to measure arteriolar diameter in response to capillary stimulation. We show which appropriate functional controls can be used to validate the HiCaPA preparation integrity and display typical results, including testing potassium as a neurovascular coupling agent and the effect of the recently characterized inhibitor of the Kir2 inward rectifying potassium channel family, ML133. Further, we compare the responses in preparations obtained from male and female mice. While these data reflect functional investigations, our approach can also be used in molecular biology, immunochemistry, and electrophysiology studies.

The present manuscript details how to isolate hippocampal arterioles and capillaries from the mouse brain and how to pressurize them for pressure myography, immunofluorescence, biochemistry, and molecular studies.

Ex Vivo pressurizado Hipocampal Capilar-Parenchymal Arteriole Preparação para estudo funcional

From subtle behavioral alterations to late-stage dementia, vascular cognitive impairment typically develops following cerebral ischemia. Stroke and ...

A Cell Culture Model for Studying the Role of Neuron-Glia Interactions in Ischemia

Ischemic stroke is a clinical condition characterized by hypoperfusion of brain tissue, leading to oxygen and glucose deprivation, and the consequent neuronal loss. Numerous evidence suggests that the interaction between glial and neuronal cells exert beneficial effects after an ischemic event. Therefore, to explore potential protective mechanisms, it is important to develop models that allow studying neuron-glia interactions in an ischemic environment. Herein we present a simple approach to isolate astrocytes and neurons from the rat embryonic cortex, and that by using specific culture media, allows the establishment of neuron- or astrocyte-enriched cultures or neuron-glia cultures with high yield and reproducibility.
To study the crosstalk between astrocytes and neurons, we propose an approach based on a co-culture system in which neurons cultured in coverslips are maintained in contact with a monolayer of astrocytes plated in multiwell plates. The two cultures are maintained apart by small paraffin spheres. This approach allows the independent manipulation and the application of specific treatments to each cell type, which represents an advantage in many studies.
To simulate what occurs during an ischemic stroke, the cultures are subjected to an oxygen and glucose deprivation protocol. This protocol represents a useful tool to study the role of neuron-glia interactions in ischemic stroke.

Here, we present a simple approach using specific culture media that allows the establishment of neuron- and astrocyte-enriched cultures, or neuron-glia cultures from the embryonic cortex, with high yield and reproducibility.

Um modelo de cultura celular para estudar o papel das interações neurônio-glia na isquemia

Ischemic stroke is a clinical condition characterized by hypoperfusion of brain tissue, leading to oxygen and glucose deprivation, and the consequent ...

Analysis of Astrocyte Territory Volume and Tiling in Thick Free-Floating Tissue Sections

Astrocytes possess an astounding degree of morphological complexity that enables them to interact with nearly every type of cell and structure within the brain. Through these interactions, astrocytes actively regulate many critical brain functions, including synapse formation, neurotransmission, and ion homeostasis. In the rodent brain, astrocytes grow in size and complexity during the first three postnatal weeks and establish distinct, non-overlapping territories to tile the brain. This protocol provides an established method for analyzing astrocyte territory volume and astrocyte tiling using free-floating tissue sections from the mouse brain. First, this protocol describes the steps for tissue collection, cryosectioning, and immunostaining of free-floating tissue sections. Second, this protocol describes image acquisition and analysis of astrocyte territory volume and territory overlap volume, using commercially available image analysis software. Lastly, this manuscript discusses the advantages, important considerations, common pitfalls, and limitations of these methods. This protocol requires brain tissue with sparse or mosaic fluorescent labeling of astrocytes, and is designed to be used with common lab equipment, confocal microscopy, and commercially available image analysis software.

This protocol describes methods for sectioning, staining, and imaging free-floating tissue sections of the mouse brain, followed by a detailed description of the analysis of astrocyte territory volume and astrocyte territory overlap or tiling.

Análise do volume do território de astutação e revestimento em seções de tecido livre grossa

Astrocytes possess an astounding degree of morphological complexity that enables them to interact with nearly every type of cell and structure within the ...

Oclusão da artéria média distal para desenvolver um modelo de camundongo com AVC isquêmico

Induction of Acute Ischemic Stroke in Mice Using the Distal Middle Artery Occlusion Technique

Ischemic stroke remains the predominant cause of mortality and functional impairment among the adult populations globally. Only a minority of ischemic stroke patients are eligible to receive intravascular thrombolysis or mechanical thrombectomy therapy within the optimal time window. Among those stroke survivors, around two-thirds suffer neurological dysfunctions over an extended period. Establishing a stable and repeatable experimental ischemic stroke model is extremely significant for further investigating the pathophysiological mechanisms and developing effective therapeutic strategies for ischemic stroke. The middle cerebral artery (MCA) represents the predominant location of ischemic stroke in humans, with the MCA occlusion serving as the frequently employed model of focal cerebral ischemia. In this protocol, we describe the methodology of establishing the distal MCA occlusion (dMCAO) model through transcranial electrocoagulation in C57BL/6 mice. Since the occlusion site is located at the cortical branch of MCA, this model generates a moderate infarcted lesion restricted to the cortex. Neurological behavioral and histopathological characterization have demonstrated visible motor dysfunction, neuron degeneration, and pronounced activation of microglia and astrocytes in this model. Thus, this dMCAO mouse model provides a valuable tool for investigating the ischemiastroke and worth of popularization.

Autor em destaque: Estabelecendo um modelo confiável de oclusão distal de MCA em camundongos para pesquisa de AVC

Here, we present a protocol to establish a distal middle cerebral artery occlusion (dMCAO) model through transcranial electrocoagulation in C57BL/6J mice and evaluate the subsequent neurological behavior and histopathological features.

Indução de AVC Isquêmico Agudo em Camundongos Usando a Técnica de Oclusão Distal da Artéria Média

Ischemic stroke remains the predominant cause of mortality and functional impairment among the adult populations globally. Only a minority of ischemic ...

As diferenças sexuais no mouse do hipocampo astrócitos após

Resumo

Explore mais vídeos

Capítulos neste vídeo

Isolamento e Cultura de astrócitos corticais de rato

Sex Stratified Neuronal Cultures to Study Ischemic Cell Death Pathways

Avaliação de dendríticas Arborização no giro dentado do hipocampo em Ratos Região

Monitoramento de Astrocyte de reatividade e proliferação in Vitro sob condições isquêmicas

Neurocomportamentais avaliações em um modelo do rato de lesão cerebral hipóxica-isquêmica Neonatal

Ex Vivo pressurizado Hipocampal Capilar-Parenchymal Arteriole Preparação para estudo funcional

Um modelo de cultura celular para estudar o papel das interações neurônio-glia na isquemia

Análise do volume do território de astutação e revestimento em seções de tecido livre grossa

Indução de AVC Isquêmico Agudo em Camundongos Usando a Técnica de Oclusão Distal da Artéria Média

Indução de AVC Isquêmico Agudo em Camundongos Usando a Técnica de Oclusão Distal da Artéria Média