Name: generation of escape variants of neutralizing influenza virus monoclonal antibodies
Uploaded: 2017-08-29T13:00:00
Duration: 7 min 55 s
Description: Watch this Scientific Journal Video about Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies at JoVE.com

This project has been funded in part with federal funds from the National Institute of Allergy and Infectious Diseases, National Institutes of Health, Department of Health and Human Services, under CEIRS contract HHSN272201400008C (F.K.); NIH U19AI109946-01 (F.K.); and P01AI097092-04S1 (P.E.L.).

<ol>
	<li>Shaw, M. L., Palese, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Orthomyxoviridae: the viruses and their replication. , (2013).</li><li>Nelson, M. I., Holmes, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+evolution+of+epidemic+influenza.">The evolution of epidemic influenza.</a> Nat Rev Genet. 8 (3), 196-205 (2007).</li><li>Lauring, A. S., Andino, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quasispecies+Theory+and+the+Behavior+of+RNA+Viruses.">Quasispecies Theory and the Behavior of RNA Viruses.</a> PLoS Pathog. 6 (7), e1001005 (2010).</li><li>Henry Dunand, C. J., Leon, P. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preexisting+human+antibodies+neutralize+recently+emerged+H7N9+influenza+strains.">Preexisting human antibodies neutralize recently emerged H7N9 influenza strains.</a> J Clin Invest. 125 (3), 1255-1268 (2015).</li><li>Dunand, C. J. H., Leon, P. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Both+Neutralizing+and+Non-Neutralizing+Human+H7N9+Influenza+Vaccine-Induced+Monoclonal+Antibodies+Confer+Protection.">Both Neutralizing and Non-Neutralizing Human H7N9 Influenza Vaccine-Induced Monoclonal Antibodies Confer Protection.</a> Cell Host Microbe. 19 (6), 800-813 (2016).</li><li>Tan, G. S., Lee, P. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+a+Broadly+Neutralizing+Monoclonal+Antibody+That+Targets+the+Fusion+Domain+of+Group+2+Influenza+A+Virus+Hemagglutinin.">Characterization of a Broadly Neutralizing Monoclonal Antibody That Targets the Fusion Domain of Group 2 Influenza A Virus Hemagglutinin.</a> J Virol. 88 (23), 13580-13592 (2014).</li><li>Tan, G. S., Leon, P. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Broadly-Reactive+Neutralizing+and+Non-neutralizing+Antibodies+Directed+against+the+H7+Influenza+Virus+Hemagglutinin+Reveal+Divergent+Mechanisms+of+Protection.">Broadly-Reactive Neutralizing and Non-neutralizing Antibodies Directed against the H7 Influenza Virus Hemagglutinin Reveal Divergent Mechanisms of Protection.</a> PLoS Pathog. 12 (4), e1005578 (2016).</li><li>Smith, K., Garman, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+generation+of+fully+human+monoclonal+antibodies+specific+to+a+vaccinating+antigen.">Rapid generation of fully human monoclonal antibodies specific to a vaccinating antigen.</a> Nat Protoc. 4 (3), 372-384 (2009).</li><li>Steel, J., Lowen, A. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influenza+virus+vaccine+based+on+the+conserved+hemagglutinin+stalk+domain.">Influenza virus vaccine based on the conserved hemagglutinin stalk domain.</a> mBio. 1 (1), (2010).</li><li>Krammer, F., Pica, N., Hai, R., Margine, I., Palese, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chimeric+hemagglutinin+influenza+virus+vaccine+constructs+elicit+broadly+protective+stalk-specific+antibodies.">Chimeric hemagglutinin influenza virus vaccine constructs elicit broadly protective stalk-specific antibodies.</a> J Virol. 87 (12), 6542-6550 (2013).</li><li>Wang, T. T., Tan, G. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaccination+with+a+synthetic+peptide+from+the+influenza+virus+hemagglutinin+provides+protection+against+distinct+viral+subtypes.">Vaccination with a synthetic peptide from the influenza virus hemagglutinin provides protection against distinct viral subtypes.</a> Proc Natl Acad Sci U S A. 107 (44), 18979-18984 (2010).</li><li>Impagliazzo, A., Milder, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+stable+trimeric+influenza+hemagglutinin+stem+as+a+broadly+protective+immunogen.">A stable trimeric influenza hemagglutinin stem as a broadly protective immunogen.</a> Science. 349 (6254), 1301-1306 (2015).</li><li>Krammer, F., Palese, P., Steel, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+Universal+Influenza+Virus+Vaccine+Design+and+Antibody+Mediated+Therapies+Based+on+Conserved+Regions+of+the+Hemagglutinin.">Advances in Universal Influenza Virus Vaccine Design and Antibody Mediated Therapies Based on Conserved Regions of the Hemagglutinin.</a> Current Topics in Microbiology and Immunology. , (2014).</li><li>Wohlbold, T. J., Nachbagauer, R., Margine, I., Tan, G. S., Hirsh, A., Krammer, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaccination+with+soluble+headless+hemagglutinin+protects+mice+from+challenge+with+divergent+influenza+viruses.">Vaccination with soluble headless hemagglutinin protects mice from challenge with divergent influenza viruses.</a> Vaccine. 33 (29), 3314-3321 (2015).</li><li>Ekiert, D. C., Bhabha, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antibody+recognition+of+a+highly+conserved+influenza+virus+epitope.">Antibody recognition of a highly conserved influenza virus epitope.</a> Science. 324 (5924), 246-251 (2009).</li><li>Ekiert, D. C., Friesen, R. H. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Highly+Conserved+Neutralizing+Epitope+on+Group+2+Influenza+A+Viruses.">A Highly Conserved Neutralizing Epitope on Group 2 Influenza A Viruses.</a> Science. 333 (6044), 843-850 (2011).</li><li>Dreyfus, C., Laursen, N. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+Conserved+Protective+Epitopes+on+Influenza+B+Viruses.">Highly Conserved Protective Epitopes on Influenza B Viruses.</a> Science. 337 (6100), 1343-1348 (2012).</li><li>Tran, E. E. H., Podolsky, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-electron+Microscopy+Structures+of+Chimeric+Hemagglutinin+Displayed+on+a+Universal+Influenza+Vaccine+Candidate.">Cryo-electron Microscopy Structures of Chimeric Hemagglutinin Displayed on a Universal Influenza Vaccine Candidate.</a> mBio. 7 (2), e00257 (2016).</li><li>Wiley, D. C., Wilson, I. A., Skehel, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+identification+of+the+antibody-binding+sites+of+Hong+Kong+influenza+haemagglutinin+and+their+involvement+in+antigenic+variation.">Structural identification of the antibody-binding sites of Hong Kong influenza haemagglutinin and their involvement in antigenic variation.</a> Nature. 289 (5796), 373-378 (1981).</li><li>Gerhard, W., Yewdell, J., Frankel, M. E., Webster, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antigenic+structure+of+influenza+virus+haemagglutinin+defined+by+hybridoma+antibodies.">Antigenic structure of influenza virus haemagglutinin defined by hybridoma antibodies.</a> Nature. 290 (5808), 713-717 (1981).</li><li>Jackson, D. C., Murray, J. M., White, D. O., Gerhard, W. U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enumeration+of+antigenic+sites+of+influenza+virus+hemagglutinin.">Enumeration of antigenic sites of influenza virus hemagglutinin.</a> Infect Immun. 37 (3), 912-918 (1982).</li><li>Matsuzaki, Y., Sugawara, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epitope+Mapping+of+the+Hemagglutinin+Molecule+of+A/(H1N1)pdm09+Influenza+Virus+by+Using+Monoclonal+Antibody+Escape+Mutants.">Epitope Mapping of the Hemagglutinin Molecule of A/(H1N1)pdm09 Influenza Virus by Using Monoclonal Antibody Escape Mutants.</a> J Virol. 88 (21), 12364-12373 (2014).</li><li>Tan, G. S., Krammer, F., Eggink, D., Kongchanagul, A., Moran, T. M., Palese, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+pan-H1+anti-hemagglutinin+monoclonal+antibody+with+potent+broad-spectrum+efficacy+in+vivo.">A pan-H1 anti-hemagglutinin monoclonal antibody with potent broad-spectrum efficacy in vivo.</a> J Virol. 86 (11), 6179-6188 (2012).</li><li>Geneva: World Health Organization. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> WHO manual on animal influenza diagnosis and surveillance. , (2002).</li><li>Brauer, R., Chen, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influenza+Virus+Propagation+in+Embryonated+Chicken+Eggs.">Influenza Virus Propagation in Embryonated Chicken Eggs.</a> J Vis Exp. (97), e52421 (2015).</li><li>Mart&#237;nez-Sobrido, L., Garc&#237;a-Sastre, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+Recombinant+Influenza+Virus+from+Plasmid+DNA.">Generation of Recombinant Influenza Virus from Plasmid DNA.</a> J Vis Exp. (42), e2057 (2010).</li><li>Hoffmann, E., Stech, J., Guan, Y., Webster, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Universal+primer+set+for+the+full-length+amplification+of+all+influenza+A+viruses.">Universal primer set for the full-length amplification of all influenza A viruses.</a> ArchVirol. 146 (12), 2275-2289 (2001).</li><li>Zhou, B., Lin, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Universal+Influenza+B+Virus+Genomic+Amplification+Facilitates+Sequencing,+Diagnostics,+and+Reverse+Genetics.">Universal Influenza B Virus Genomic Amplification Facilitates Sequencing, Diagnostics, and Reverse Genetics.</a> J Clin Microbiol. 52 (5), 1330-1337 (2014).</li><li>Sidhu, S. S., Kossiakoff, A. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+and+designing+protein+function+with+restricted+diversity.">Exploring and designing protein function with restricted diversity.</a> Curr Opin Chem Biol. 11, 347-354 (2007).</li><li>Chen, C. -. W., Chang, C. -. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Peptide+Scanning-assisted+Identification+of+a+Monoclonal+Antibody-recognized+Linear+B-cell+Epitope.">Peptide Scanning-assisted Identification of a Monoclonal Antibody-recognized Linear B-cell Epitope.</a> J Vis Exp. (121), e55417 (2017).</li></ol>

The authors declare no conflicts of interest.

Although the majority of residues identified via escape mutants have been accurate, one of the major caveats of this approach is that point mutations of escape variants may not necessarily map within the molecular footprint of the antibody as determined by structural analyses. This is due to the ability of a mutation at a certain residue to lead to a conformational change distal to the location of the mutated residue, analogous to an allosteric effect. Another limitation is that this methodology can only be implemented for neutralizing antibodies; antibodies that lack in vitro selective pressure will not lead to escape mutants. However, this limitation can be overcome with the use of a panel of escape variants generated by previously characterized neutralizing antibodies. Tan et al. used an escape variant of a neutralizing mAb to the H7N9 virus to map the epitope of a non-neutralizing antibody7.
Nonetheless, elucidating the epitopes of antibodies through the generation of escape variants provides a viable alternative to crystallography and cryo-electron microscopy, both of which require an extensive investment of equipment. Other alternatives are to determine the minimal binding region of mAbs using alanine scanning or peptide scanning/truncation mutants. Alanine scanning mutagenesis may require a significant amount of work in generating a large number of variants during screening29, while peptide scanning is limited to linear epitopes30. The method described in this protocol requires no special equipment or technique and in fact, makes use of existing in vitro neutralization assays modified to generate escape variants of the antibodies of interest.
The protocol for generating escape variants that require multiple passages (e.g., stalk-specific antibodies) is highly dependent on the starting concentration of antibody in passage 0. It is better to err on the side of caution and start at a log to half a log lower than the half maximal inhibitory concentration of an antibody and allow for robust virus growth. The researcher can speculate that a high titer virus culture in the presence of low immunological pressure will have a large genetic variation in the viral population. Escape variants can be selected for by gradually increasing the antibody concentration in the following passages. In the event that the virus growth decreases, the amount of viral supernatant can be increased in the next passage while maintaining the same amount of antibody concentration in the previous passage.
The aim of a majority of universal influenza vaccines is to elicit a robust antibody response towards the stalk region of the HA. The analyses of escape variants to stalk-specific antibodies are important in defining the relationship between influenza virus fitness and immunological pressure. Interestingly, escape mutant viruses resulting from stalk-specific mAbs were all attenuated in vivo in murine LD50 studies4. These studies provide a strong case for stalk-based vaccination platforms. Additionally, this protocol could be used to identify escape mutants to other anti-viral compounds, such as small molecule inhibitors. Finally, this methodology is not limited to influenza virus surface glycoproteins, but may also be more widely applied to determine the epitopes of other viral glycoproteins.

Similar to other RNA viruses, influenza A viruses possess an error-prone polymerase that allows for the generation of a multitude of antigenic variants with each round of replication1,2,3. The influenza A virus has an astonishing ability to adapt and evade the human immune response via antigenic drift, which is achieved through an accumulation of mutations on the surface glycoproteins that leads to the loss of antibody binding. Antigenic drift of the viral surface glycoproteins, HA and neuraminidase (NA), necessitates the need to reformulate and administer the vaccine annually.
Technological advancements in the isolation and generation of antigen-specific antibodies have yielded a high number of vaccine-induced mAbs4,5,6,7,8. In turn, the characterization of the epitopes of mAbs that broadly neutralize influenza A viruses has greatly aided the development of several universal influenza vaccine candidates9,10,11,12,13,14. Elucidating the antigenic footprint of a mAb reveals the structural determinants of neutralization and allows for an informed approach towards vaccine design. However, it is neither realistic nor cost-effective for laboratories to structurally characterize extensive panels of mAbs through x-ray crystallography or cryo-electron microscopy in order to map epitopes on the viral antigen15,16,17,18.
X-ray crystallography or cryo-electron microscopy requires expensive equipment, specialized techniques and potentially an extensive amount of time to generate data. An alternative and faster approach is utilizing the rapid generation of diverse viral populations via the error-prone RNA-dependent RNA polymerase to generate escape mutants to determine the epitopes of mAbs19,20,21,22,23. The generation of escape variants does not require any special equipment or technique and can be performed with conventional laboratory reagents and equipment.
Here, we describe a method that allows for the mapping of critical residues required for mAb binding that recognize the influenza HA.

<table border="0" cellpadding="0" cellspacing="0" width="1159">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Falcon 96-well clear flat bottom TC-treated culture microplate with Lid</td>
			<td style="width:197px;">Corning, Inc.</td>
			<td align="right" style="width:119px;">353072</td>
			<td style="width:429px;">Assay plate use for the microneutralization assay</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Falcon 96-well clear V-bottom plate</td>
			<td style="width:197px;">Corning, Inc.</td>
			<td align="right" style="width:119px;">353263</td>
			<td>Assay plate use for the hemagglutination inhibition assay</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">1X Minimal Essential Medium (MEM)</td>
			<td style="width:197px;">Gibco</td>
			<td align="right" style="width:119px;">11095080</td>
			<td>Infection medium</td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;">Tosyl phenylalanyl chloromethyl (TPCK)-treated trypsin</td>
			<td>Sigma-Aldrich</td>
			<td style="width:119px;">T8802</td>
			<td>Cleaves immature HA0 to HA1 and HA2</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Biotinylated anti-NP primary antibody (IAV)</td>
			<td>EMD Millipore</td>
			<td style="width:119px;">MAB8258B</td>
			<td>An antibody that recognizes the NP protein of influenza A viruses</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Biotinylated anti-NP primary antibody (IBV)</td>
			<td style="width:197px;">EMD Millipore</td>
			<td style="width:119px;">MAB8260B-5</td>
			<td>An antibody that recognizes the NP protein of influenza B viruses</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Streptavidin-HRP antibody</td>
			<td>EMD Millipore</td>
			<td style="width:119px;">18-152</td>
			<td>This is used as a secondary antibody for the biotinylated anti-NP antibody</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">HRP substrate (SIGMAFAST-OPD)</td>
			<td style="width:197px;">Sigma-Aldrich</td>
			<td style="width:119px;">P9187-5SET</td>
			<td>o-phenylenediamine dihydrochloride water soluble substrate for HRP</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">96-well V-bottom plate</td>
			<td style="width:197px;">Nunc</td>
			<td align="right" style="width:119px;">249662</td>
			<td>Assay plate used for the hemagglutination assay</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Chicken red blood cells</td>
			<td>Lampire Biological Laboratories</td>
			<td align="right" style="width:119px;">7201403</td>
			<td>Used to assess the ability of influenza virus to agglutinate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">TRIzol</td>
			<td style="width:197px;">Ambion</td>
			<td align="right" style="width:119px;">15596026</td>
			<td>Extraction of RNA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Superscript III</td>
			<td style="width:197px;">Invitrogen</td>
			<td align="right" style="width:119px;">12574018</td>
			<td>Reverse transcriptase</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Gel Extraction Kit</td>
			<td style="width:197px;">Qiagen</td>
			<td align="right" style="width:119px;">28704</td>
			<td>Isolation of amplified PCR product</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Lipofectamine 2000</td>
			<td style="width:197px;">Invitrogen</td>
			<td align="right" style="width:119px;">11668027</td>
			<td>Transfection reagent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Anti-human IgG (H+L) Alexa Fluor 488</td>
			<td style="width:197px;">Invitrogen</td>
			<td style="width:119px;">A-11013</td>
			<td>Fluorescent secondary antibody for human antibodies</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Anti-mouse IgG (H+L) Alexa Fluor 488</td>
			<td style="width:197px;">Invitrogen</td>
			<td style="width:119px;">A-11001</td>
			<td>Fluorescent secondary antibody for murine antibodies</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">6-well polystyrene microplate</td>
			<td style="width:197px;">Corning, Inc.</td>
			<td align="right" style="width:119px;">353934</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">UltraPure Agarose</td>
			<td style="width:197px;">Invitrogen</td>
			<td align="right" style="width:119px;">16500500</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Nalgene long term storage Cryo-tubes</td>
			<td style="width:197px;">ThermoFisher Scientific</td>
			<td style="width:119px;">5012-0020</td>
			<td>Freezing of viral culture supernatant</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">reassortant A/California/04/09 (H1)</td>
			<td style="width:197px;">Palese Laboratory</td>
			<td style="width:119px;"></td>
			<td>reassortant virus expressing the HA and NA of A/California/04/09 (H1N1) with the internal segments of A/Puerto Rico/8/34 (H1N1)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">reassortant A/Shanghai/1/13 (H7)</td>
			<td style="width:197px;">Palese Laboratory</td>
			<td style="width:119px;"></td>
			<td>reassortant virus expressing the HA and NA of A/Shanghai/1/13 (H7N9) with the internal segments of A/Puerto Rico/8/34 (H1N1)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Bovine serum albumin solution (35%)</td>
			<td style="width:197px;">Sigma-Aldrich</td>
			<td style="width:119px;">A7979</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Qiagen gel extration kit</td>
			<td style="width:197px;">Qiagen</td>
			<td align="right" style="width:119px;">28704</td>
			<td>Silica-membrane-based purification of DNA fragments</td>
		</tr>
	</tbody>
</table>

generation of escape variants of neutralizing influenza virus monoclonal antibodies

Influenza viruses exhibit a remarkable ability to adapt and evade the host immune response. One way is through antigenic changes that occur on the surface glycoproteins of the virus. The generation of escape variants is a powerful method in elucidating how viruses escape immune detection and in identifying critical residues required for antibody binding. Here, we describe a protocol on how to generate influenza A virus escape variants by utilizing human or murine monoclonal antibodies (mAbs) directed against the viral hemagglutinin (HA). With the use of our technique, we previously characterized critical residues required for the binding of antibodies targeting either the head or stalk of the novel avian H7N9 HA. The protocol can be easily adapted for other virus systems. Analyses of escape variants are important for modeling antigenic drift, determining single nucleotide polymorphisms (SNPs) conferring resistance and virus fitness, and in the designing of vaccines and/or therapeutics.

We have previously used variations of this method to generate escape variants to human and murine mAbs induced by the seasonal influenza virus vaccine, H7N9 vaccination, or sequential DNA/recombinant HA protein vaccination4,5,6,7. As described above, antibodies were first characterized using the HI and microneutralization assays in order to inform us of which specific protocol to continue with next4,5. Antibodies 07-5D03, 07-5F01, 07-5G01, 07-4B03, 07-4E02 and 07-4D05 were found to have HI and neutralization activities against the avian H7N9 virus (A/Shanghai/1/2013) (Table 1), and thus protocol 1 (step 2.1) was utilized. For mAbs with neutralizing that lack HI activity, such as 41-5E04, 045-051310-2B06, 042-100809-2F04 and S6-B01 (Table 1), protocol 2 (step 2.2) was used to generate escape variants. Escape mutant mapping revealed that many of the antibodies recognize critical residues in distinct locations on the viral HA4,5 (Figure 4). While the majority of the HI-positive antibodies have escape mutant residues near previously reported antigenic sites of the H7 HA, the HI-negative antibodies generated escape mutants with point mutations in the stalk region4,5.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Antibody</td>
			<td>HI Activity</td>
			<td>NEUT Activity</td>
		</tr>
		<tr>
			<td>07-5D03</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-5F01</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-5G01</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-4B03</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-4E02</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-4D05</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>41-5E04</td>
			<td>-</td>
			<td>+</td>
		</tr>
		<tr>
			<td>045-051310-2B06</td>
			<td>-</td>
			<td>+</td>
		</tr>
		<tr>
			<td>042-100809-2F04</td>
			<td>-</td>
			<td>+</td>
		</tr>
		<tr>
			<td>S6-B01</td>
			<td>-</td>
			<td>+</td>
		</tr>
	</tbody>
</table>
Table 1: Table of antibody HI and neutralization activity. Ten H7-specific mAbs isolated from individuals vaccinated with an experimental H7N9 vaccine exhibit different in vitro antiviral activities5.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td></td>
			<td colspan="4">Forward Primer (5&#39; to 3&#39;)</td>
			<td colspan="4">Reverse Primer&#160; (5&#39; to 3&#39;)</td>
			<td colspan="2">Thermocylcer conditions</td>
		</tr>
		<tr>
			<td>IAV</td>
			<td colspan="4">TATTCGTCTCAGGGAGCAAAAGCAGGGG</td>
			<td colspan="4">ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT</td>
			<td colspan="2">42 &#186;C for 60 min, 94 &#186;C for 2 min/5 cycles of 94 &#186;C for 20 s, 50 &#186;C for 30 s and 68 &#186;C for 3 min 30 s, followed by 40&#160; cycles of 94 &#186;C for 20 s, 58 &#186;C for 30 s, and 68 &#186;C for 3 min 30 s with a final extension time at 68 &#186;C for 10 min</td>
		</tr>
		<tr>
			<td>IBV</td>
			<td colspan="4">GGGGGGAGCAGAAGCAGAGC</td>
			<td colspan="4">CCGGGTTATTAGTAGTAACAAGAGC</td>
			<td colspan="2">45 &#186;C for 60 min, 55 &#186;C for 30 min, 94 &#186;C for 2 min/5 cycles of 94 &#186;C for 20 s, 40 &#186;C for 30 s and 68 &#186;C for 3 min 30 s, followed by 40&#160; cycles of 94 &#186;C for 20 s, 58 &#186;C for 30 s, and 68 &#186;C for 3 min 30 s with a final extension time at 68 &#186;C for 10 min</td>
		</tr>
	</tbody>
</table>
Table 2: Universal influenza virus primers. Primer pairs for the amplification of the HA segments of influenza A27 and B28 viruses and their respective thermocycler conditions.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56067/56067fig1.jpg" /> 
Figure 1: HI assay. (A) A schematic for the setting up a HI assay to test the activity of two mouse H1-specific mAbs 7B2 (head-specific) and 6F12 (stalk-specific) using a 96-well V-bottom plate, and (B) an example of the results of an HI assay23. <a href="https://cloudflare.jove.com/files/ftp_upload/56067/56067fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56067/56067fig2.jpg" /> 
Figure 2: Microneutralization assay. A schematic for setting up a microneutralization assay to test the activity of two human mAbs 4D055 and CR911417. <a href="https://cloudflare.jove.com/files/ftp_upload/56067/56067fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56067/56067fig3.jpg" /> 
Figure 3: Generation of escape mutants. The methodology suggested will be dependent on the HI and the microneutralization activity exhibited by the antibody. The generation of escape mutants against (A) neutralizing HI-positive antibodies may require a single passage in eggs, while (B) neutralizing HI-negative antibodies may involve multiple passages with increasing antibody amounts in cell tissue culture. <a href="https://cloudflare.jove.com/files/ftp_upload/56067/56067fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/56067/56067fig4.jpg" /> 
Figure 4: An example of an epitope map of the novel avian H7N9 HA generated with escape mutant variants. Vaccine-induced antibodies isolated from individuals vaccinated with a candidate H7N9 influenza A vaccine were used to generate escape mutant variants. Each residue indicated in red represents the location of critical amino acids required for efficient binding of a mAb. Data were adapted from Dunand-Henry et al., 20154. <a href="https://cloudflare.jove.com/files/ftp_upload/56067/56067fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies at JoVE.com

Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies

We describe a method by which we identify critical residues required for the binding of human or murine monoclonal antibodies that target the viral hemagglutinin of influenza A viruses. The protocol can be adapted to other virus surface glycoproteins and their corresponding neutralizing antibodies.

Influenza viruses exhibit a remarkable ability to adapt and evade the host immune response. One way is through antigenic changes that occur on the surface ...

Research

JoVE Journal

Immunology and Infection

Generation of Recombinant Influenza Virus from Plasmid DNA

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally ...

Isolation of Fidelity Variants of RNA Viruses and Characterization of Virus Mutation Frequency

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the ...

High-throughput Detection Method for Influenza Virus

Influenza virus is a respiratory pathogen that causes a high degree of morbidity and mortality every year in multiple parts of the world. Therefore, ...

Influenza Virus Propagation in Embryonated Chicken Eggs

Influenza infection is associated with about 36,000 deaths and more than 200,000 hospitalizations every year in the United States. The continuous ...

Generation of Recombinant Human IgG Monoclonal Antibodies from Immortalized Sorted B Cells

Finding new methods for generating human monoclonal antibodies is an active research field that is important for both basic and applied sciences, ...

Generation of Murine Monoclonal Antibodies by Hybridoma Technology

Monoclonal antibodies are universal binding molecules and are widely used in biomedicine and research. Nevertheless, the generation of these binding ...

Influenza A Virus Studies in a Mouse Model of Infection

Influenza viruses cause over 500,000 deaths worldwide1 and are associated with an annual cost of 12 - 14 billion USD in the United States alone ...

Measuring Influenza Neutralizing Antibody Responses to A(H3N2) Viruses in Human Sera by Microneutralization Assays Using MDCK-SIAT1 Cells

Measuring Influenza Neutralizing Antibody Responses to AH3N2 Viruses in Human Sera by Microneutralization Assays Using MDCK-SIAT1 Cells

Neutralizing antibodies against hemagglutinin (HA) of influenza viruses are considered the main immune mechanism that correlates with protection for ...

Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood

Monoclonal antibodies (mAbs) are powerful tools useful for both fundamental research and in biomedicine. Their high specificity is indispensable when the ...

Generation of Monoclonal Antibodies Against Natural Products

The analysis of the bioactive components present in foods and natural products has become a popular area of study in many fields, including traditional ...