<p class="jove_content">Marcella Birtele has been funded by European Union Horizon 2020 Program (H2020-MSCA-ITN-2015) under the Marie Sk&#322;odowska-Curie Innovative Training Networks and Grant Agreement No. 676408. Daniella Rylander Ottosson has been funded by Swedish Research Council (2017-01234).</p>

<ol>
	<li>Barker, R. A., Parmar, M., Studer, L., Takahashi, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+Trials+of+Stem+Cell-Derived+Dopamine+Neurons+for+Parkinson&#39;s+Disease:+Dawn+of+a+New+Era.">Human Trials of Stem Cell-Derived Dopamine Neurons for Parkinson&#39;s Disease: Dawn of a New Era.</a> <em style='font-style: italic'>Cell Stem Cell</em>. <b>21</b> (5), 569-573 (2017).</li><li>Southwell, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interneurons+from+embryonic+development+to+cell-based+therapy.">Interneurons from embryonic development to cell-based therapy.</a> <em style='font-style: italic'>Science</em>. <b>344</b> (6180), 1240622 (2014).</li><li>Parmar, M., Torper, O., Drouin-Ouellet, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-based+therapy+for+Parkinson&#39;s+disease:+A+journey+through+decades+toward+the+light+side+of+the+Force.">Cell-based therapy for Parkinson&#39;s disease: A journey through decades toward the light side of the Force.</a> <em style='font-style: italic'>European Journal of Neuroscience</em>. , (2018).</li><li>Torper, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Vivo+Reprogramming+of+Striatal+NG2+Glia+into+Functional+Neurons+that+Integrate+into+Local+Host+Circuitry.">In Vivo Reprogramming of Striatal NG2 Glia into Functional Neurons that Integrate into Local Host Circuitry.</a> <em style='font-style: italic'>Cell Reports</em>. <b>12</b> (3), 474-481 (2015).</li><li>Su, Z., Niu, W., Liu, M. L., Zou, Y., Zhang, C. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+conversion+of+astrocytes+to+neurons+in+the+injured+adult+spinal+cord.">In vivo conversion of astrocytes to neurons in the injured adult spinal cord.</a> <em style='font-style: italic'>Nature Communication</em>. <b>5</b>, 3338 (2014).</li><li>Liu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ascl1+Converts+Dorsal+Midbrain+Astrocytes+into+Functional+Neurons+In+Vivo.">Ascl1 Converts Dorsal Midbrain Astrocytes into Functional Neurons In Vivo.</a> <em style='font-style: italic'>Journal of Neuroscience</em>. <b>35</b> (25), 9336-9355 (2015).</li><li>Guo, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+direct+reprogramming+of+reactive+glial+cells+into+functional+neurons+after+brain+injury+and+in+an+Alzheimer&#39;s+disease+model.">In vivo direct reprogramming of reactive glial cells into functional neurons after brain injury and in an Alzheimer&#39;s disease model.</a> <em style='font-style: italic'>Cell Stem Cell</em>. <b>14</b> (2), 188-202 (2014).</li><li>Grande, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Environmental+impact+on+direct+neuronal+reprogramming+in+vivo+in+the+adult+brain.">Environmental impact on direct neuronal reprogramming in vivo in the adult brain.</a> <em style='font-style: italic'>Nature Communication</em>. <b>4</b>, 2373 (2013).</li><li>Niu, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+reprogramming+of+astrocytes+to+neuroblasts+in+the+adult+brain.">In vivo reprogramming of astrocytes to neuroblasts in the adult brain.</a> <em style='font-style: italic'>Nature Cell Biology</em>. <b>15</b> (10), 1164-1175 (2013).</li><li>Weinberg, M. S., Criswell, H. E., Powell, S. K., Bhatt, A. P., McCown, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+Vector+Reprogramming+of+Adult+Resident+Striatal+Oligodendrocytes+into+Functional+Neurons.">Viral Vector Reprogramming of Adult Resident Striatal Oligodendrocytes into Functional Neurons.</a> <em style='font-style: italic'>Molecular Therapy</em>. <b>25</b> (4), 928-934 (2017).</li><li>Pereira, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+Reprogramming+of+Resident+NG2+Glia+into+Neurons+with+Properties+of+Fast-Spiking+Parvalbumin-Containing+Interneurons.">Direct Reprogramming of Resident NG2 Glia into Neurons with Properties of Fast-Spiking Parvalbumin-Containing Interneurons.</a> <em style='font-style: italic'>Stem Cell Reports</em>. <b>9</b> (3), 742-751 (2017).</li><li>Rivetti di Val Cervo, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+functional+dopamine+neurons+from+human+astrocytes+in+vitro+and+mouse+astrocytes+in+a+Parkinson&#39;s+disease+model.">Induction of functional dopamine neurons from human astrocytes in vitro and mouse astrocytes in a Parkinson&#39;s disease model.</a> <em style='font-style: italic'>Nature Biotechnology</em>. <b>35</b> (5), 444-452 (2017).</li><li>Crosson, S. M., Dib, P., Smith, J. K., Zolotukhin, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Helper-free+Production+of+Laboratory+Grade+AAV+and+Purification+by+Iodixanol+Density+Gradient+Centrifugation.">Helper-free Production of Laboratory Grade AAV and Purification by Iodixanol Density Gradient Centrifugation.</a> <em style='font-style: italic'>Molecular Therapy Methods &#38; Clinial Development</em>. <b>10</b>, 1-7 (2018).</li><li>Torper, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+induced+neurons+via+direct+conversion+in+vivo.">Generation of induced neurons via direct conversion in vivo.</a> <em style='font-style: italic'>Proceedings of the National Academy of Sciences of the United States of America</em>. <b>110</b> (17), 7038-7043 (2013).</li><li>Kawaguchi, Y., Kubota, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Correlation+of+physiological+subgroupings+of+nonpyramidal+cells+with+parvalbumin-+and+calbindinD28k-immunoreactive+neurons+in+layer+V+of+rat+frontal+cortex.">Correlation of physiological subgroupings of nonpyramidal cells with parvalbumin- and calbindinD28k-immunoreactive neurons in layer V of rat frontal cortex.</a> <em style='font-style: italic'>Journal of Neurophysiology</em>. <b>70</b> (1), 387-396 (1993).</li><li>Grealish, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+A9+dopamine+neuron+component+in+grafts+of+ventral+mesencephalon+is+an+important+determinant+for+recovery+of+motor+function+in+a+rat+model+of+Parkinson&#39;s+disease.">The A9 dopamine neuron component in grafts of ventral mesencephalon is an important determinant for recovery of motor function in a rat model of Parkinson&#39;s disease.</a> <em style='font-style: italic'>Brain</em>. <b>133</b> (Pt 2), 482-495 (2010).</li><li>Thompson, L., Barraud, P., Andersson, E., Kirik, D., Bjorklund, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+dopaminergic+neurons+of+nigral+and+ventral+tegmental+area+subtypes+in+grafts+of+fetal+ventral+mesencephalon+based+on+cell+morphology,+protein+expression,+and+efferent+projections.">Identification of dopaminergic neurons of nigral and ventral tegmental area subtypes in grafts of fetal ventral mesencephalon based on cell morphology, protein expression, and efferent projections.</a> <em style='font-style: italic'>Journal of Neuroscience</em>. <b>25</b> (27), 6467-6477 (2005).</li></ol>

<p class="jove_content">The authors have nothing to disclose.</p>

<p class="jove_content">In vivo direct reprogramming can be achieved using AAV FLEX vectors in Cre-expressing mouse strains. It is important to note that differences between mouse strains with regards to reprogramming efficacy have been observed. For in vivo reprogramming in the striatum, the NG2-Cre mouse line has proved to be the more efficient when compared with other strains. Prior to starting to use a new animal strain, it is important to check the mouse provider guidelines regarding Cre expression over time, as the age of animals often impacts the specificity of this protein expression. In our studies, animals older than 12 weeks were not used for in vivo reprogramming as there was a risk for Cre expression in cells other than NG2 glia. The constant presence and monitoring of control animals injected only with Synapsin-FLEX-GFP construct is advised. This allows monitoring of the animals for GFP-positive cells that should not be present if no reprogramming genes (ALN) are used.</p>
<p class="jove_content">To identify the newly reprogrammed neurons, a neuron-specific identification method such as the one described in this protocol is of utmost importance. This allows for a proper identification and distinction of the reprogrammed neurons from the endogenous surrounding cells that is of particular relevance when the reprogramming in a homotopic region.</p>
<p class="jove_content">It is also important to target the correct structure for viral injection. Therefore, the stereotaxic surgery for viral injection is important and needs to be approached with accuracy, especially when targeting smaller structures of the brain.</p>
<p class="jove_content">We have previously shown<sup class="xref">11</sup> that it is not reliable to predict the outcome of in vivo reprogramming based on in vitro reprogramming experiments using the same reprogramming factors. All factors of interest therefore need to be tested in vivo. In our hands, many different factor combinations give the same subtype of neurons (i.e., interneurons<sup class="xref">11</sup> in vivo) despite the fact that these genes have been implicated in the development of other neurons.</p>
<p class="jove_content">Whole-cell patch clamp for reprogrammed neurons is a delicate technique and tissue processing is important for a good outcome. Perfusion with ice-cold Krebs&#160;solution improves tissue quality. Also, patched neurons need to be treated carefully. Even if maturation and phenotypic identity of reprogrammed neurons can be somewhat assessed using whole-cell patch clamp, these cells are not fully comparable to their endogenous counterparts. Additional types of analysis, such as genome sequencing (e.g., RNA sequencing) should be used to further confirm reprogrammed cell identity.</p>
<p class="jove_content">The technique described herein is could be considered for the development of future therapies where neuronal replacement is needed in the brain. Although in vivo reprogramming is still at its early stages and the translation into humans is not yet foreseen, this technique could provide a method to assess exogenous gene function in the brain and study cell maturation in vivo.</p>

<p class="jove_content">The overall goal of this method is to efficiently convert brain resident glia in vivo into functional and subtype-specific neurons such as parvalbumin-expressing interneurons. This provides a step forward towards the development of an alternative cell replacement therapy for brain diseases without the need for an exogenous cell source. It also creates a tool to study cell fate switches in situ.&#160;</p>
<p class="jove_content">The brain has only a limited capacity for generating new neurons. Therefore, in neurological diseases, there is a need of exogenous cell sources for brain repair. For this, different sources of cells have been subjected to intense research over the years, including cells from primary tissue, stem cell-derived cells and reprogrammed cells<sup class="xref">1</sup><sup>,</sup><sup class="xref">2</sup><sup>,</sup><sup class="xref">3</sup>. Direct reprogramming of resident brain cells into neurons is a recent approach that could provide an attractive method for brain repair as it uses the patient&#8217;s own cells for generating novel neurons inside the brain. To date, several reports have shown in vivo reprogramming through viral vector delivery in the brain<sup class="xref">4</sup><sup>,</sup><sup class="xref">5</sup><sup>,</sup><sup class="xref">6</sup><sup>,</sup><sup class="xref">7</sup><sup class="xref">8</sup><sup>,</sup><sup class="xref">9</sup> in different brain regions such as the cortex, spinal cord, striatum and the midbrain<sup class="xref">5</sup><sup>,</sup><sup class="xref">10</sup><sup>,</sup><sup class="xref">11</sup>, as well as in intact and lesioned brain<sup class="xref">5</sup><sup>,</sup><sup class="xref">8</sup><sup>,</sup><sup class="xref">11</sup><sup>,</sup><sup class="xref">12</sup>. Both inhibitory and excitatory neurons have been obtained<sup class="xref">4</sup><sup>,</sup><sup class="xref">8</sup>, but the precise phenotype or functionality of these cells has not yet been analyzed in detail.&#160;</p>
<p class="jove_content">In this protocol, we describe a more efficient reprogramming and cell-specific identification of in vivo reprogrammed neurons. We provide a protocol for functional assessment of the neuronal maturation and phenotype&#160;characterization based on functionality and immunohistochemical traits.&#160;</p>
<p class="jove_content">We used a Cre-inducible AAV vector and a GFP reporter to identify the in vivo reprogrammed neurons. This choice of viral vectors has the advantage of infecting both dividing and non-dividing cells of the brain, increasing the number of targeted cells, as an alternative to the use of retrovirus<sup class="xref">7</sup><sup>,</sup><sup class="xref">8</sup>. A neuron-specific synapsin-driven FLEX reporter (GFP), enabled us to specifically detect the newly generated neurons. Previous studies have used subtype-specific promoters for in vivo reprogramming<sup class="xref">7</sup><sup>,</sup><sup class="xref">9</sup>, that also allow the expression of reprogramming genes and reporters in specific cell types. However, that method requires further identification of reprogrammed neurons by postmortem analysis of the co-expression of reporter and neuronal markers. The use of a neuron-specific reporter, such as the one described herein, allows for a direct identification. This provides a direct proof of a successful conversion and allows a live cell identification that is required for patch-clamp electrophysiology.</p>

<table>
	<tbody>
		<tr>
			<td><strong>REAGENTS FOR AAV5 CLONING AND VIRAL VECTOR PREPARATION</strong></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>pAAV-CA-FLEX</td>
			<td>AddGene</td>
			<td>38042</td>
			<td></td>
		</tr>
		<tr>
			<td>Ascl1</td>
			<td>AddGene</td>
			<td>67291</td>
			<td>NM_008553.4</td>
		</tr>
		<tr>
			<td>Lmx1a</td>
			<td>AddGene</td>
			<td>33013</td>
			<td>NM_0033652.5</td>
		</tr>
		<tr>
			<td>Nurr1</td>
			<td>AddGene</td>
			<td>35000</td>
			<td>NM_013613.2</td>
		</tr>
		<tr>
			<td>GFP-syn</td>
			<td>AddGene</td>
			<td>30456</td>
			<td></td>
		</tr>
		<tr>
			<td>LoxP (FLEX) sequence 1</td>
			<td></td>
			<td></td>
			<td>GATCTccataacttcgtataaagtatcctatac<br/>gaagttatatcaaaataggaagaccaatgcttc<br/>accatcgacccgaattgccaagcatcaccatcg<br/>acccataacttcgtataatgtatgctatacgaa<br/>gttatactagtcccgggaaggcgaagacgcgga<br/>agaggctctaga</td>
		</tr>
		<tr>
			<td>LoxP (FLEX) sequences 2</td>
			<td></td>
			<td></td>
			<td>tactagtataacttcgtataggatactttatac<br/>gaagttatcattgggattcttcctattttgatc<br/>caagcatcaccatcgaccctctagtccacatct<br/>caccatcgacccataacttcgtatagcatacat<br/>tatacgaagttatgtccctcgaagaggttcgaa<br/>ttcgtttaaacGGTACCCTCGAC</td>
		</tr>
		<tr>
			<td>pDP5</td>
			<td>Plasmid Factory</td>
			<td>PF435</td>
			<td></td>
		</tr>
		<tr>
			<td>pDP6</td>
			<td>Plasmid Factory</td>
			<td>PF436</td>
			<td></td>
		</tr>
		<tr>
			<td>Phosphate-Buffered Saline (PBS)</td>
			<td>Thermo Fisher Scientific</td>
			<td>10010023</td>
			<td></td>
		</tr>
		<tr>
			<td>FBS (Fetal bovine serum)</td>
			<td>Thermo Fisher Scientific</td>
			<td>10500064</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin streptomycin</td>
			<td>Thermo Fisher Scientific</td>
			<td>15140122</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM (Dulbecco&#39;s Modified Eagle Medium)+ Glutamax</td>
			<td>Thermo Fisher Scientific</td>
			<td>61965026</td>
			<td></td>
		</tr>
		<tr>
			<td>DPBS (Dulbecco&#39;s Phosphate Buffer Saline)</td>
			<td>Thermo Fisher Scientific</td>
			<td>14190094</td>
			<td></td>
		</tr>
		<tr>
			<td>HEK293 cells</td>
			<td>Thermo Fisher Scientific</td>
			<td>85120602-1VL</td>
			<td></td>
		</tr>
		<tr>
			<td>Flasks</td>
			<td>BD Falcon</td>
			<td>10078780</td>
			<td>175 cm2</td>
		</tr>
		<tr>
			<td>Tris H-CL</td>
			<td>Sigma Aldrich</td>
			<td>10812846001</td>
			<td>
			<div>
			<div>For TE buffer use 10 mM, pH 8.0; for lysis buffer use 50mM, pH 8.5; for IE buffer use 20 mM, pH 8.0; for elution buffer use 20 mM, pH 8.0</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>EDTA: Invitrogen</td>
			<td>EDTA: AM9260G</td>
			<td>
			<div>
			<div>For TE buffer use 1 mM EDTA</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>Ultrapure water</td>
			<td></td>
			<td></td>
			<td>
			<div>
			<div>see Ultrapure water system</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>CaCl2</td>
			<td>SigmaAldrich</td>
			<td>C5080</td>
			<td>2.5 M</td>
		</tr>
		<tr>
			<td>Dulbecco&#180;s phosphate-buffered saline (DPBS)</td>
			<td>Thermo Fisher Scientific</td>
			<td>14190136</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>Sigma-Aldrich</td>
			<td>S3014</td>
			<td>
			<div>
			<div>FOR HBS use 140 mM; for Lysis Buffer use 150 mM; for IE buffer use 15 mM; for elution buffer use 250 mM</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>MgCl2</td>
			<td>Sigma-Aldrich</td>
			<td>M8266-100G</td>
			<td>
			<div>
			<div>For lysis Buffer: 1 mM</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>Ultracentrifuge sealing tubes</td>
			<td>Beckman Coulter</td>
			<td>Quick-Seal&#174;&#160;Polypropylene Tube</td>
			<td></td>
		</tr>
		<tr>
			<td>OptiPrep&#8482;&#160;Density Gradient Medium</td>
			<td>Sigma Aldrich</td>
			<td>D1556-250ML</td>
			<td></td>
		</tr>
		<tr>
			<td>10-mL syringe-18G needle</td>
			<td>BD</td>
			<td>305064</td>
			<td></td>
		</tr>
		<tr>
			<td>Laboratory glass bottles</td>
			<td>VWR</td>
			<td>?</td>
			<td></td>
		</tr>
		<tr>
			<td>Anion exchange filter</td>
			<td>PALL laboratory</td>
			<td>MSTG25Q6</td>
			<td>
			<div>
			<div>Acrodisc unit with Mustang Q membrane</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>Centrifugal filter unit</td>
			<td>Merck</td>
			<td>Z740210-24EA</td>
			<td>
			<div>
			<div>Amicon Ultra-4 device</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>Endotoxin-Free Plasmid DNA Isolation Kits</td>
			<td>Thermo Fisher Scientific</td>
			<td>A33073</td>
			<td></td>
		</tr>
		<tr>
			<td>Na2PO4</td>
			<td>Sigma-Aldrich</td>
			<td>S7907</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Sigma-Aldrich</td>
			<td>H7523</td>
			<td>15 mL</td>
		</tr>
		<tr>
			<td>Falcon tube</td>
			<td>Thermo Fisher Scientific</td>
			<td>Corning 352196</td>
			<td></td>
		</tr>
		<tr>
			<td>Falcon tube</td>
			<td>Thermo Fisher Scientific</td>
			<td>Corning 352070</td>
			<td></td>
		</tr>
		<tr>
			<td>Glass Vials</td>
			<td>Novatech</td>
			<td>30209-1232</td>
			<td>
			<div>
			<div>CGGCCTCAGFGAGCGA</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>Forward Primer for Inverted Terminal Repeat (ITR) sequence</td>
			<td></td>
			<td></td>
			<td>
			<div>
			<div>GGAACCCCTAGTGATGGAGTT</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>Reverse Primer for Inverted Terminal Repeat (ITR) sequence</td>
			<td></td>
			<td></td>
			<td>
			<div>
			<div>CACTCCCTCTCTGCGCGCTCG</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>5&#180;FAM / 3&#180;BHQ1 probe</td>
			<td>Jena Bioscience</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>0.22 mm filter</td>
			<td>Merck</td>
			<td>SLGV004SL</td>
			<td>Millex-GV filter</td>
		</tr>
		<tr>
			<td><strong>EQUIPMENT AAV5 VIRAL VECTOR PREPARATION</strong></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Freezer -20 &#176;C</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Freezer -80 &#176;C</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Fridge +4 &#176;C</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>AAV viral room</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Ultrapure Water system</td>
			<td>Merck</td>
			<td>Milli-Q&#174; IQ 7000</td>
			<td></td>
		</tr>
		<tr>
			<td>Vortex mixer</td>
			<td>VWR</td>
			<td>444-0004</td>
			<td></td>
		</tr>
		<tr>
			<td>Ultracentrifuge</td>
			<td>Beckman Coulter</td>
			<td>Beckman Optima LE-80K Ultracentrifuge</td>
			<td></td>
		</tr>
		<tr>
			<td>Autoclave</td>
			<td>Tuttnauer</td>
			<td>2540 EL</td>
			<td></td>
		</tr>
		<tr>
			<td>Polymerase Chain Reaction (PCR)</td>
			<td>BioRad</td>
			<td>C1000 Touch Thermal Cycler</td>
			<td></td>
		</tr>
		<tr>
			<td>Quantitative PCR (qPCR)</td>
			<td>Roche</td>
			<td>LightCycler&#174; 480 System</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>Thermo Fisher Scientific</td>
			<td>Sorvall ST16</td>
			<td></td>
		</tr>
		<tr>
			<td>Water Bath</td>
			<td>Thermo Fisher Scientific</td>
			<td>TSGP02</td>
			<td></td>
		</tr>
		<tr>
			<td><strong>ANIMAL MODEL</strong></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>NG2-Cre mice</td>
			<td>Jackson</td>
			<td>NG2-CrexB6129, Stock #008533</td>
			<td></td>
		</tr>
		<tr>
			<td><strong>REAGENTS FOR INJECTION OF REPROGRAMMING FACTORS INTO THE BRAIN</strong></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Water</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Saline</td>
			<td>Apoteket AB</td>
			<td></td>
			<td>70%</td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td>Solveco</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Isolfurane</td>
			<td>Apoteket AB</td>
			<td></td>
			<td>
			<div>
			<div>Dilute to 1% solution with warm water.</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>Virkon</td>
			<td>Viroderm</td>
			<td>7511&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>Pentobarbital</td>
			<td>Apoteket AB</td>
			<td>P0500000</td>
			<td>
			<div>
			<div>i.p. for terminal procedure at the dose of 60 mg/ml.</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>Sucrose</td>
			<td>Merck</td>
			<td>S0389-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypan Blu</td>
			<td>Thermo Fisher Scientific</td>
			<td>15250061</td>
			<td></td>
		</tr>
		<tr>
			<td>Retrobeads</td>
			<td>Lumafluor</td>
			<td>R170</td>
			<td></td>
		</tr>
		<tr>
			<td>Buprenorphine</td>
			<td>Apoteket AB</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td><strong>EQUIPMENT FOR INJECTION OF REPROGRAMMING FACTORS INTO THE BRAIN</strong></td>
			<td></td>
			<td></td>
			<td>
			<div>
			<div>From RSG Solingen.</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>Scissors</td>
			<td>VWR</td>
			<td>233-1552</td>
			<td>From Biochem.</td>
		</tr>
		<tr>
			<td>Tweezers</td>
			<td>VWR</td>
			<td>232-0007</td>
			<td></td>
		</tr>
		<tr>
			<td>Forcep</td>
			<td>VWR</td>
			<td>232-0120</td>
			<td></td>
		</tr>
		<tr>
			<td>Scalpel holder</td>
			<td>VWR</td>
			<td>RSGA106.621</td>
			<td>Number 20.</td>
		</tr>
		<tr>
			<td>Scalpel</td>
			<td>VWR</td>
			<td>RSGA106.200</td>
			<td></td>
		</tr>
		<tr>
			<td>Stereotaxic frame</td>
			<td>Stoelting Europe</td>
			<td>51500D</td>
			<td></td>
		</tr>
		<tr>
			<td>Mouse ear bars</td>
			<td>Stoelting Europe</td>
			<td>51648</td>
			<td>5 ul</td>
		</tr>
		<tr>
			<td>Syringe with Removable needle</td>
			<td>Hamilton Company</td>
			<td>65</td>
			<td>
			<div>
			<div>0,75 inner diameter and 1.5 outer diameter.</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>Glass capilaries</td>
			<td>Stoelting</td>
			<td>50811</td>
			<td></td>
		</tr>
		<tr>
			<td>Glass capillary puller</td>
			<td>Sutter company</td>
			<td>P-1000</td>
			<td></td>
		</tr>
		<tr>
			<td>Dental drill</td>
			<td>Agnthos AB</td>
			<td>1464</td>
			<td></td>
		</tr>
		<tr>
			<td>Shaver</td>
			<td>Agnthos AB</td>
			<td>GT420</td>
			<td></td>
		</tr>
		<tr>
			<td>Isoflurane Chamber and pump</td>
			<td>Agnthos AB</td>
			<td>8323101</td>
			<td>2 mL</td>
		</tr>
		<tr>
			<td>Syringes</td>
			<td>Merck</td>
			<td>Z118400-30EA</td>
			<td>25G</td>
		</tr>
		<tr>
			<td>Needles</td>
			<td>Merck</td>
			<td>Z192414&#160;Aldrich</td>
			<td></td>
		</tr>
		<tr>
			<td>Mouse and neonatal rat adaptor for stereotaxic fram</td>
			<td>Stoelting</td>
			<td>51625</td>
			<td></td>
		</tr>
		<tr>
			<td>Heating pad</td>
			<td>Braintree scientific, inc</td>
			<td>53800M</td>
			<td>
			<div>
			<div>From Covidien 2187.</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>Cotton gauze</td>
			<td>Fisher Scientific</td>
			<td>22-037-902</td>
			<td></td>
		</tr>
		<tr>
			<td>Rubber tube</td>
			<td>Elfa Distrelec</td>
			<td>HFT-A-9.5/4.8 PO-X BK 150</td>
			<td></td>
		</tr>
		<tr>
			<td>Cotton swabs</td>
			<td>Fisher Scientific</td>
			<td>18-366-473</td>
			<td></td>
		</tr>
		<tr>
			<td><strong>REAGENTS FOR WHOLE-CELL PATCH CLAMP RECORDINGS</strong></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>Sigma-Aldrich</td>
			<td>S3014</td>
			<td></td>
		</tr>
		<tr>
			<td>KCl</td>
			<td>Sigma-Aldrich</td>
			<td>P9333</td>
			<td></td>
		</tr>
		<tr>
			<td>NaH<sub>2</sub>PO<sub>4</sub>-H<sub>2</sub>O</td>
			<td>Sigma-Aldrich</td>
			<td>S9638</td>
			<td></td>
		</tr>
		<tr>
			<td>MgCl<sub>2</sub>-6 H<sub>2</sub>O</td>
			<td>Sigma-Aldrich</td>
			<td>M2670</td>
			<td></td>
		</tr>
		<tr>
			<td>CaCl<sub>2</sub>-6 H<sub>2</sub>O</td>
			<td>Sigma-Aldrich</td>
			<td>C8106</td>
			<td></td>
		</tr>
		<tr>
			<td>MgSO4-7 H<sub>2</sub>O</td>
			<td>Sigma-Aldrich</td>
			<td>230391</td>
			<td></td>
		</tr>
		<tr>
			<td>NaHCO<sub>3</sub></td>
			<td>Sigma-Aldrich</td>
			<td>S5761</td>
			<td></td>
		</tr>
		<tr>
			<td>Glucose</td>
			<td>Sigma-Aldrich</td>
			<td>G7021</td>
			<td>
			<div>
			<div>see Ultrapure Water system</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>Ultrapure Water</td>
			<td></td>
			<td></td>
			<td>Prepare 1 or 2M.</td>
		</tr>
		<tr>
			<td>KOH</td>
			<td>Sigma-Aldrich</td>
			<td>P5958-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>K-D-gluconate</td>
			<td>Sigma-Aldrich</td>
			<td>G4500&#160;Sigma</td>
			<td></td>
		</tr>
		<tr>
			<td>KCl</td>
			<td>Sigma-Aldrich</td>
			<td>P9541</td>
			<td></td>
		</tr>
		<tr>
			<td>KOH-EGTA (Etilene glycol-bis-N-tetracetic acid)</td>
			<td>Sigma-Aldrich</td>
			<td>E3889&#160;Sigma</td>
			<td></td>
		</tr>
		<tr>
			<td>KOH- Hepes acid (N-2-hydroxyethylpiperazine-N&#8217;-2-ethanesulfonic acid)</td>
			<td>Sigma-Aldrich</td>
			<td>H7523</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>Sigma-Aldrich</td>
			<td>S3014</td>
			<td></td>
		</tr>
		<tr>
			<td>Mg2ATP</td>
			<td>Sigma-Aldrich</td>
			<td>A9187</td>
			<td></td>
		</tr>
		<tr>
			<td>Na3GTP</td>
			<td>Sigma-Aldrich</td>
			<td>G8877</td>
			<td></td>
		</tr>
		<tr>
			<td>Biocytin</td>
			<td>Sigma-Aldrich</td>
			<td>B4261</td>
			<td></td>
		</tr>
		<tr>
			<td>Picrotoxin</td>
			<td>Merck</td>
			<td>P1675&#160;Sigma</td>
			<td></td>
		</tr>
		<tr>
			<td>CNQX</td>
			<td>Merck</td>
			<td>C239&#160;Sigma</td>
			<td></td>
		</tr>
		<tr>
			<td>Ice</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td><strong>EQUIPMENT FOR WHOLE-CELL PATCH CLAMP RECORDINGS</strong></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Borosilicate glass pipette</td>
			<td>Sutter Company</td>
			<td>B150-86-10</td>
			<td></td>
		</tr>
		<tr>
			<td>Glass capillary puller</td>
			<td>Sutter company</td>
			<td>P-1000</td>
			<td></td>
		</tr>
		<tr>
			<td>Vibratome</td>
			<td>Leica</td>
			<td>Leica VT1000 S</td>
			<td></td>
		</tr>
		<tr>
			<td>WaterBath</td>
			<td>Thermo Fisher Scientific</td>
			<td>TSGP02</td>
			<td></td>
		</tr>
		<tr>
			<td>Clampfit software</td>
			<td>Molecular Devices</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Multiclamp software</td>
			<td>Molecular Devices</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td><strong>REAGENTS FOR IMMUNOHISTOCHEMISTRY</strong></td>
			<td></td>
			<td></td>
			<td>
			<div>
			<div>Use at a concentration of 4%.&#160;CAUTION:&#160;PFA is a potent fixative. Avoid ingestion and contact with skin.</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>Paraformaldehyde (PFA)</td>
			<td>Merck Millipore</td>
			<td>1040051000</td>
			<td>
			<div>
			<div>Use at a concentration of 0.1%.</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Fisher Scientific</td>
			<td>10254640</td>
			<td>
			<div>
			<div>Donkey.Use at a concentration of 1 : 400.</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>Serum</td>
			<td>Merck Millipore</td>
			<td>S30-100ML</td>
			<td>
			<div>
			<div>Reconstitute the powder in Milli-Q water to 1 mg/mL. Aliquot and store at -20&#176;C,&#160;light sensitive. Use at a concentration of 1 : 500.</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>4&#8242;,6-Diamidino-2&#8242;-phenylindole dihydrochloride (DAPI)</td>
			<td>Sigma Aldrich</td>
			<td>D9542</td>
			<td>
			<div>
			<div>1: 600 in KPBS-T.</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>streptavidin- Cy3</td>
			<td>Thermo Fisher Scientific</td>
			<td>434315</td>
			<td>1:5000, rabbit.</td>
		</tr>
		<tr>
			<td>Anti-GAD65/67</td>
			<td>Abcam</td>
			<td></td>
			<td>1:2000, mouse.</td>
		</tr>
		<tr>
			<td>Anti-PV</td>
			<td>Sigma</td>
			<td>P3088</td>
			<td>1:200, goat.</td>
		</tr>
		<tr>
			<td>Anti-Chat</td>
			<td>Merk</td>
			<td>AB143</td>
			<td>1:5000, rabbit.</td>
		</tr>
		<tr>
			<td>Anti-NPY</td>
			<td>Immunostar</td>
			<td>22940</td>
			<td></td>
		</tr>
		<tr>
			<td>K<sub>2</sub>HPO<sub>4</sub></td>
			<td>Sigma-Aldrich</td>
			<td>P3786</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>Sigma-Aldrich</td>
			<td>S3014</td>
			<td></td>
		</tr>
		<tr>
			<td>KH<sub>2</sub>PO<sub>4</sub></td>
			<td>Sigma-Aldrich</td>
			<td>NIST200B</td>
			<td>1:1000, chicken.</td>
		</tr>
		<tr>
			<td>Anti-GFP</td>
			<td>Abcam</td>
			<td>ab13970</td>
			<td></td>
		</tr>
		<tr>
			<td>Mounting solution</td>
			<td>Merck</td>
			<td>10981</td>
			<td>
			<div>
			<div>Polyvinyl alcohol mounting medium with DABCO&#174;, antifading</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>OCT</td>
			<td>Agar Scientific</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol</td>
			<td>Sigma-Aldrich</td>
			<td>G9012-100ML</td>
			<td></td>
		</tr>
		<tr>
			<td>Distilled water</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-freeze solution</td>
			<td>Tissue Pro Technology</td>
			<td>AFS05-1000N, 1000 mL/ea.</td>
			<td></td>
		</tr>
		<tr>
			<td><strong>EQUIPMENT FOR IMMUNOHISTOCHEMISTRY</strong></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Inverted fluorescence microscope</td>
			<td>Leica</td>
			<td>DMI6000 B</td>
			<td></td>
		</tr>
		<tr>
			<td>Confocal microscope</td>
			<td>Leica</td>
			<td>TCS SP8 laser scanning confocal microscope.</td>
			<td></td>
		</tr>
		<tr>
			<td>Prism</td>
			<td>GraphPad</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Microtome</td>
			<td>Leica</td>
			<td>SM2010R</td>
			<td></td>
		</tr>
	</tbody>
</table>

in vivo direct reprogramming of resident glial cells into interneurons by intracerebral injection of viral vectors

<p class="jove_content">Converting resident glia in the brain into functional and subtype-specific neurons in vivo provides a step forward towards the development of alternative cell replacement therapies while also creating tools to study cell fate in situ. To date, it has been possible to obtain neurons via in vivo reprogramming, but the precise phenotype of these neurons or how they mature has not been analyzed in detail. In this protocol, we describe a more efficient conversion and cell-specific identification of the in vivo reprogrammed neurons, using an AAV-based viral vector system. We also provide a protocol for functional assessment of the reprogrammed cells&#8217; neuronal maturation. By injecting flip-excision (FLEX) vectors, containing the reprogramming and synapsin-driven reporter genes&#160;to specific cell types in the brain that serve as the target for cell reprogramming. This technique allows for the easy identification of newly reprogrammed neurons. Results show that the obtained reprogrammed neurons functionally mature over time, receive synaptic contacts and show electrophysiological properties of different types of interneurons. Using the transcription factors Ascl1, Lmx1a and Nurr1, the majority of the reprogrammed cells have properties of fast-spiking, parvalbumin-containing interneurons.</p>

<p class="jove_content" fo:keep-together.within-page="1">The injection of AAV vectors is used to successfully reprogram resident NG2 glia cells into neurons in the NG2-Cre mouse striatum (<strong class="xfig">Figure 1A</strong>). To specifically target NG2 glia, FLEX vectors with reprogramming/reporter genes, are inserted in an antisense direction and flanked by two pairs of antiparallel, heterotypic loxP sites (<strong class="xfig">Figure 1B</strong>). Each of the three reprogramming genes (Ascl1, Lmx1a and Nurr1) is placed under the control of the ubiquitous cba promoter on individual vectors. In order to make sure GFP expression is restricted to reprogrammed neurons originating from a Cre-expressing cell, GFP is placed under the control of the neuron-specific synapsin promoter, (also in a FLEX vector).</p>
<p class="jove_content" fo:keep-together.within-page="1">The use of the combination of reprogramming and reporter constructs allows for the generation of GFP-positive neurons in the mouse striatum (<strong class="xfig">Figure 1C</strong><strong>,C&#8217;</strong>). The use of the reporter construct without the presence of reprogramming genes does not yield GFP-positive neurons (<strong class="xfig">Figure 1D</strong>).</p>
<p class="jove_content" fo:keep-together.within-page="1">The reprogrammed neurons that are biocytin-filled are visible after post-mortem immuno-staining (<strong class="xfig">Figure 2A</strong>). If conversion is successful, there should be extensive neuronal morphology. The electrophysiological recordings of reprogrammed neurons show presence of postsynaptic functional connections with spontaneous activity measures (<strong class="xfig">Figure 2B</strong><strong>,C</strong>). This can be blocked with either ionotropic GABAergic or glutamatergic blocker (Picrotoxin or CNQX), suggesting both excitatory and inhibitory synaptic input to the reprogrammed neurons. The occurrence of spontaneous activity increases with time post viral injection (<strong class="xfig">Figure 2D</strong>), indicating a gradual maturation.</p>
<p class="jove_content" fo:keep-together.within-page="1">Current-induced action potentials are present in functional neurons. The action potentials increase in number over time after conversion (<strong class="xfig">Figure 2E</strong>). This further indicates maturation in neuronal function. In an immature neuron, current will induce either none or very few action potentials (<strong class="xfig">Figure 2F</strong>).</p>
<p class="jove_content" fo:keep-together.within-page="1">The firing patterns of a neuron is cell type specific as it depends&#160;on factors such as the morphology of the cells and channel expression<sup class="xref">15</sup>. The recorded patterns in the in vivo reprogrammed neurons can be distinguished into groups and compared to that of endogenous neuronal subtypes, e.g.&#160;fast-spiking interneurons (Cell Type B, <strong class="xfig">Figure 3B</strong>) or other cell types (<strong class="xfig">Figure 3A</strong><strong>,C,D</strong>). The observed electrophysiological differences can be confirmed by the presence of specific subtype markers and co-expression with GFP (<strong class="xfig">Figure 3E</strong><strong>-H</strong>). Altogether, this data indicates that the reprogrammed neurons present in the striatum have properties of different types of interneurons, such as Parvalbumin-, ChAt- and NPY- expressing interneurons, as well as striatal medium spiny neuron identity (DARPP32+) (<strong class="xfig">Figure 3E</strong><strong>-H</strong>).</p>
<p class="jove_content" fo:keep-together.within-page="1"><img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/59465/59465fig1.jpg" /><br />
<strong>Figure 1: In vivo reprogramming of resident NG2 glia into neurons.</strong> (<strong>A</strong>) Schematic representation of AAV virus-mediated in vivo reprogramming of striatal NG2 glia. (<strong>B</strong>) Schematic representation of AAV5 FLEX constructs used for in vivo reprogramming, in which gene expression is regulated by Cre expression in the targeted cells. (<strong>C</strong> and <strong>C&#8217;</strong>) In vivo reprogrammed neurons, resulting from Syn-GFP + ALN injection into the Striatum. (<strong>D</strong>) Absence of reprogrammed neurons when no reprogramming factors are added into the viral cocktail, and only reporter construct is injected in vivo. Scale bars = 100 &#956;m (C),25 &#956;m (C&#39;), 25 &#956;m (D). <a href="https://www.jove.com/files/ftp_upload/59465/59465fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a></p>
<p class="jove_content" fo:keep-together.within-page="1"><img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/59465/59465fig2.jpg" /><br />
<strong>Figure 2: In vivo reprogrammed neurons are functional and show maturation over time. </strong>(<strong>A</strong>)&#160;Biocytin-filled reprogrammed neuron, shows mature neuronal morphology, including dendritic spines. Traces shows (<strong>B</strong>) inhibitory (GABAergic) activity that is blocked with picrotoxin, a GABA<sub>A</sub> receptor antagonist and (<strong>C</strong>) excitatory activity that is blocked with CNQX, an AMPA receptor antagonist. (<strong>D</strong>) The number of neurons with postsynaptic activity increases over time. (<strong>E</strong>) Patched neurons show repetitive firing already at 5 weeks post-injection (w.p.i.) and continue to show that at 8 and 12 w.p.i. (<strong>F</strong>)&#160;Current-induced action potential and postsynaptic activity of an immature neuron, showing few synaptic events and few action potentials compared to B and D. Scale bar = 25 &#956;m <a href="https://www.jove.com/files/ftp_upload/59465/59465fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a></p>
<p class="jove_content" fo:keep-together.within-page="1"><img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/59465/59465fig3v2.jpg" /><br />
<strong>Figure 3: In vivo reprogrammed neurons show immunohistochemical and electrophysiological properties of striatal interneurons. </strong>(<strong>A-D</strong>) The firing patterns of&#160;in vivo reprogrammed neurons can be of distinct types: (<strong>A</strong>) Type A is similar to endogenous medium spiny neuron (DARPP32+); (<strong>B</strong>) similar to fast-spiking (PV+) interneurons; (<strong>C</strong>) similar to low-threshold spiking neurons with prominent sag (NPY+); (<strong>D</strong>) neurons firing with large after-hyperpolarization (Chat+). (<strong>E-H</strong>) Confocal images showing co-localization of GFP and the interneuron markers PV (<strong>E</strong>), ChAT (<strong>F</strong>), NPY (<strong>G</strong>), and projection neuron marker DARPP32 (<strong>H</strong>). All scale bars = 50 &#956;m. <a href="https://www.jove.com/files/ftp_upload/59465/59465fig3v2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a></p>

Watch this Scientific Journal Video about In Vivo Direct Reprogramming of Resident Glial Cells into Interneurons by Intracerebral Injection of Viral Vectors at JoVE.com

In Vivo Direct Reprogramming of Resident Glial Cells into Interneurons by Intracerebral Injection of Viral Vectors

In vivo reprogramação direta de células gliais residentes em interneurônios por injeção intracerebral de vetores virais

<p class="jove_content">This protocol aims at generating directly reprogrammed interneurons in vivo, using an AAV-based viral system in the brain and a FLEX synapsin-driven GFP reporter, which allows for cell identification and further analysis in vivo.</p>

Converting resident glia in the brain into functional and subtype-specific neurons in vivo provides a step forward towards the development of alternative ...

in-vivo-direct-reprogramming-resident-glial-cells-into-interneurons

Research

JoVE Journal

Neuroscience

9.3K visualizações.  Lund University. Este protocolo mostra que é possível gerar novos neurônios diretamente no cérebro a partir de glia residente e que essas células reprogramadas amadurecem em neurônios específicos do subtipo. A principal vantagem é o vírus AAV dependente de cre que permite o direcionamento específico do NG2-glia e do repórter GFP que rotula os neurônios reprogramados para análise. Gerar novos neurônios no cérebro pode levar ao desenvolvimento futuro de terapias de substituição celular no cére...

Vídeo: In Vivo Direct Reprogramming of Resident Glial Cells into Interneurons by Intracerebral Injection of Viral Vectors

Intracranial Injection of Adeno-associated Viral Vectors

<p class="jove_content">Intracranial injection of viral vectors engineered to express a fluorescent protein is a versatile labeling technique for visualization of specific subsets of cells in different brain regions both <em>in vivo</em> and in brain sections. Unlike the injection of fluorescent dyes, viral labeling offers targeting of individual cell types and is less expensive and time consuming than establishing transgenic mouse lines. In this technique, an adeno-associated viral (AAV) vector is injected intracranially using stereotaxic coordinates, a micropipette and an automated pump for precise delivery of AAV to the desired area with minimal damage to the surrounding tissue. Injection parameters can be tailored to individual experiments by adjusting the animal age at injection, injection location, volume of injection, rate of injection, AAV serotype and the promoter driving gene expression. Depending on the conditions chosen, virally-induced transgene expression can allow visualization of groups of cells, individual cells or fine cellular processes, down to the level of dendritic spines. The experiment shown here depicts an injection of double-stranded AAV expressing green fluorescent protein for the labeling of neurons and glia in the mouse primary visual cortex.</p>

<p class="jove_content">Here we present the intracranial injection of AAV vectors for fluorescent labeling of neurons and glia in the visual cortex. </p>

Injeção intracraniana da adeno-associado vetores virais

Intracranial injection of viral vectors engineered to express a fluorescent protein is a versatile labeling technique for visualization of specific ...

Neurociência

Autologous Blood Injection to Model Spontaneous Intracerebral Hemorrhage in Mice

<p class='jove_content'>Investigation of the pathophysiology of injury after intracerebral
hemorrhage (ICH) requires a reproducible animal model.  While ICH
accounts for 10-15% of all strokes, there remains no specific
effective therapy.  The autologous blood injection model in mice
involves the stereotaxic injection of arterial blood into the basal
ganglia mimicking a spontaneous hypertensive hemorrhage in man.  The
response to hemorrhage can then be studied in vivo and the
neurobehavioral deficits quantified, allowing for description of the
ensuing pathology and the testing of potential therapeutic agents. The
procedure described in this protocol uses the double injection
technique to minimize risk of blood reflux up the needle track, no
anticoagulants in the pumping system, and eliminates all dead space
and expandable tubing in the system.</p>


<p class="jove_content">The autologous blood injection model of intracerebral hemorrhage in mice described in this protocol uses the double injection technique to minimize risk of blood reflux up the needle track, no anticoagulants in the pumping system, and eliminates all dead space and expandable tubing in the system.</p>

Injeção de sangue autólogo de Modelo hemorragia intracerebral espontânea em ratos

Investigation of the pathophysiology of injury after intracerebral
hemorrhage (ICH) requires a reproducible animal model.  While ICH
accounts for 10-15% ...

Transfection of Mouse Retinal Ganglion Cells by <em>in vivo</em> Electroporation

<p class="jove_content">The targeting and refinement of RGC projections to the midbrain is a popular and powerful model system for studying how precise patterns of neural connectivity form during development.  In mice, retinofugal projections are arranged in a topographic manner and form eye-specific layers in the Lateral Geniculate Nucleus (dLGN) of the thalamus and the Superior Colliculus (SC).  The development of these precise patterns of retinofugal projections has typically been studied by labeling populations of RGCs with fluorescent dyes and tracers, such as horseradish peroxidase<sup>1-4</sup>.  However, these methods are too coarse to provide insight into developmental changes in individual RGC axonal arbor morphology that are the basis of retinotopic map formation. They also do not allow for the genetic manipulation of RGCs.</p>
<p class="jove_content">Recently, electroporation has become an  effective method for providing precise spatial and temporal control for delivery of charged molecules into the retina<sup>5-11</sup>. Current retinal electroporation protocols do not allow for genetic manipulation and tracing of retinofugal projections of a single or small cluster of RGCs in postnatal mice. It has been argued that postnatal <em>in vivo</em> electroporation is not a viable method for transfecting RGCs since the labeling efficiency is extremely low and hence requires targeting at embryonic ages when RGC progenitors are undergoing differentiation and proliferation<sup>6</sup>. </p>
<p class="jove_content">In this video we describe an <em>in vivo</em> electroporation protocol for targeted delivery of genes, shRNA, and fluorescent dextrans to murine RGCs postnatally. This technique provides a cost effective, fast and relatively easy platform for efficient screening of candidate genes involved in several aspects of neural development including axon retraction, branching, lamination, regeneration and synapse formation at various stages of circuit development. In summary we describe here a valuable tool which will provide further insights into the molecular mechanisms underlying sensory map development.</p>


Transfection of Mouse Retinal Ganglion Cells by in vivo Electroporation

<p class="jove_content">We demonstrate an <em>in vivo</em> electroporation protocol for transfecting single or small clusters of retinal ganglion cells (RGCs) and other retinal cell types in postnatal mice over a wide range of ages. The ability to label and genetically manipulate postnatal RGCs <em>in vivo</em> is a powerful tool for developmental studies.</p>

Transfecção de células de camundongo por Ganglionares da Retina<em> In vivo</em> Eletroporação

The targeting and refinement of RGC projections to the midbrain is a popular and powerful model system for studying how precise patterns of neural ...

Expansion of Embryonic and Adult Neural Stem Cells by <em>In Utero</em> Electroporation or Viral Stereotaxic Injection

<p class="jove_content">Somatic stem cells can divide to generate additional stem cells (expansion) or more differentiated cell types (differentiation), which is fundamental for tissue formation during embryonic development and tissue homeostasis during adulthood <sup>1</sup>. Currently, great efforts are invested towards controlling the switch of somatic stem cells from expansion to differentiation because this is thought to be fundamental for developing novel strategies for regenerative medicine <sup>1,2</sup>. However, a major challenge in the study and use of somatic stem cell is that their expansion has been proven very difficult to control.</p>
<p class="jove_content">Here we describe a system that allows the control of neural stem/progenitor cell (altogether referred to as NSC) expansion in the mouse embryonic cortex or the adult hippocampus by manipulating the expression of the cdk4/cyclinD1 complex, a major regulator of the G1 phase of the cell cycle and somatic stem cell differentiation <sup>3,4</sup>. Specifically, two different approaches are described by which the cdk4/cyclinD1 complex is  overexpressed in NSC <em>in vivo</em>. By the first approach, overexpression of the cell cycle regulators is obtained by injecting plasmids encoding for cdk4/cyclinD1 in the lumen of the mouse telencephalon followed by <em>in utero</em> electroporation to deliver them to NSC of the lateral cortex, thus, triggering episomal expression of the transgenes <sup>5-8</sup>. By the second approach, highly concentrated HIV-derived viruses are stereotaxically injected in the dentate gyrus of the adult mouse hippocampus, thus, triggering constitutive expression of the cell cycle regulators after integration of the viral construct in the genome of infected cells <sup>9</sup>. Both approaches, whose basic principles were already described by other video protocols <sup>10-14</sup>, were here optimized to i) reduce tissue damage, ii) target wide portions of very specific brain regions, iii) obtain high numbers of manipulated cells within each region, and iv) trigger high expression levels of the transgenes within each cell. Transient overexpression of the transgenes using the two approaches is obtained by different means <em>i.e.</em> by natural dilution of the electroporated plasmids due to cell division or tamoxifen administration in Cre-expressing NSC infected with viruses carrying cdk4/cyclinD1 flanked by loxP sites, respectively <sup>9,15</sup>.</p>
<p class="jove_content">These methods provide a very powerful platform to acutely and tissue-specifically manipulate the expression of any gene in the mouse brain. In particular, by manipulating the expression of the cdk4/cyclinD1 complex, our system allows the temporal control of NSC expansion and their switch to differentiation, thus, ultimately increasing the number of neurons generated in the mammalian brain. Our approach may be critically important for basic research and using somatic stem cells for therapy of the mammalian central nervous system while providing a better understanding of i) stem cell contribution to tissue formation during development, ii) tissue homeostasis during adulthood, iii) the role of adult neurogenesis in cognitive functions, and perhaps, iv) better using somatic stem cells in models of neurodegenerative diseases.</p>

Expansion of Embryonic and Adult Neural Stem Cells by In Utero Electroporation or Viral Stereotaxic Injection

<p class="jove_content">Controlling the expansion of somatic stem cells is a major factor hampering their study and use in therapy. Here we describe a system to temporally control neural stem cells expansion during development and adulthood, which can be used to increase the number of neurons generated in the mouse brain.</p>

Expansão da embrionárias e adultas células-tronco neurais por<em&gt; In Utero</em&gt; Eletroporação ou injeção estereotáxica Viral

Somatic stem cells can divide to generate additional stem cells (expansion) or more differentiated cell types (differentiation), which is fundamental for ...

Lineage-reprogramming of Pericyte-derived Cells of the Adult Human Brain into Induced Neurons

<p class="jove_content">Direct lineage-reprogramming of non-neuronal cells into induced neurons (iNs) may provide insights into the molecular mechanisms underlying neurogenesis and enable new strategies for <em>in vitro</em> modeling or repairing the diseased brain. Identifying brain-resident non-neuronal cell types amenable to direct conversion into iNs might allow for launching such an approach <em>in situ</em>, <em>i.e.</em> within the damaged brain tissue. Here we describe a protocol developed in the attempt of identifying cells derived from the adult human brain that fulfill this premise. This protocol involves: (1) the culturing of human cells from the cerebral cortex obtained from adult human brain biopsies; (2) the <em>in vitro</em> expansion (approximately requiring 2-4 weeks) and characterization of the culture by immunocytochemistry and flow cytometry; (3) the enrichment by fluorescence-activated cell sorting (FACS) using anti-PDGF receptor-&#946; and anti-CD146 antibodies; (4) the retrovirus-mediated transduction with the neurogenic transcription factors sox2 and ascl1; (5) and finally the characterization of the resultant pericyte-derived induced neurons (PdiNs) by immunocytochemistry (14 days to 8 weeks following retroviral transduction). At this stage, iNs can be probed for their electrical properties by patch-clamp recording. This protocol provides a highly reproducible procedure for the <em>in vitro</em> lineage conversion of brain-resident pericytes into functional human iNs.</p>

<p class="jove_content">Targeting brain-resident cells for direct lineage-reprogramming offers new perspectives for brain repair. Here we describe a protocol of how to prepare cultures enriched for brain-resident pericytes from the adult human cerebral cortex and convert these into induced neurons by retrovirus-mediated expression of the transcription factors Sox2 and Ascl1.</p>

Lineage-reprogramação de células pericyte derivados do Adulto Cérebro Humano em neurônios induzidos

Direct lineage-reprogramming of non-neuronal cells into induced neurons (iNs) may provide insights into the molecular mechanisms underlying neurogenesis ...

Inducing Plasticity of Astrocytic Receptors by Manipulation of Neuronal Firing Rates

<p class="jove_content">Close to two decades of research has established that astrocytes <em>in situ</em> and <em>in vivo</em> express numerous G protein-coupled receptors (GPCRs) that can be stimulated by neuronally-released transmitter. However, the ability of astrocytic receptors to exhibit plasticity in response to changes in neuronal activity has received little attention. Here we describe a model system that can be used to globally scale up or down astrocytic group I metabotropic glutamate receptors (mGluRs) in acute brain slices. Included are methods on how to prepare parasagittal hippocampal slices, construct chambers suitable for long-term slice incubation, bidirectionally manipulate neuronal action potential frequency, load astrocytes and astrocyte processes with fluorescent Ca<sup>2+</sup> indicator, and measure changes in astrocytic Gq GPCR activity by recording spontaneous and evoked astrocyte Ca<sup>2+</sup> events using confocal microscopy. In essence, a &#8220;calcium roadmap&#8221; is provided for how to measure plasticity of astrocytic Gq GPCRs. Applications of the technique for study of astrocytes are discussed. Having an understanding of how astrocytic receptor signaling is affected by changes in neuronal activity has important implications for both normal synaptic function as well as processes underlying neurological disorders and neurodegenerative disease.</p>

<p class="jove_content">Here we describe an adaptation of protocols used to induce homeostatic plasticity in neurons for the study of plasticity of astrocytic G protein-coupled receptors. Recently used to examine changes in astrocytic group I mGluRs in juvenile mice, the method can be applied to measure scaling of various astrocytic GPCRs, in tissue from adult mice <em>in situ</em> and <em>in vivo</em>, and to gain a better appreciation of the sensitivity of astrocytic receptors to changes in neuronal activity.</p>

Induzir Plasticidade de astrocítica Receptores de Manipulação de Neuronal queima de moeda

Close to two decades of research has established that astrocytes in situ and in vivo express numerous G protein-coupled receptors (GPCRs) that can be ...

Limbal Approach-Subretinal Injection of Viral Vectors for Gene Therapy in Mice Retinal Pigment Epithelium

<p class='jove_content'>The eye is a small and enclosed organ which makes it an ideal target for gene therapy. Recently various strategies have been applied to gene therapy in retinopathies using non-viral and viral gene delivery to the retina and retinal pigment epithelium (RPE). Subretinal injection is the best approach to deliver viral vectors directly to RPE cells. Before the clinical trial of a gene therapy, it is inevitable to validate the efficacy of the therapy in animal models of various retinopathies. Thus, subretinal injection in mice becomes a fundamental technique for an ocular gene therapy. In this protocol, we provide the easy and replicable technique for subretinal injection of viral vectors to experimental mice. This technique is modified from the intravitreal injection, which is widely used technique in ophthalmology clinics. The representative results of RPE/choroid/scleral complex flat-mount will help to understand the efficacy of this technique and adjust the volume and titer of viral vectors for the extent of gene transduction.</p>

<p class='jove_content'>Subretinal injection is a surgical technique for effective gene delivery to retinal pigment epithelium in the mouse eye.  Here we describe an easy and replicable method for subretinal injection of viral vectors to retinal pigment epithelium in experimental mice.</p>

Limbo Abordagem-Subretinal injeção de vetores virais para terapia genética em ratos Retinal Pigment Epithelium

The eye is a small and enclosed organ which makes it an ideal target for gene therapy. Recently various strategies have been applied to gene therapy in ...

Intracerebroventricular and Intravascular Injection of Viral Particles and Fluorescent Microbeads into the Neonatal Brain

<p class="jove_content">In the study on the pathogenesis of viral encephalitis, the infection method is critical. The first of the two main infectious routes to the brain is the hematogenous route, which involves infection of the endothelial cells and pericytes of the brain. The second is the intracerebroventricular (ICV) route. Once within the central nervous system (CNS), viruses may spread to the subarachnoid space, meninges, and choroid plexus via the cerebrospinal fluid. In experimental models, the earliest stages of CNS viral distribution are not well characterized, and it is unclear whether only certain cells are initially infected. Here, we have analyzed the distribution of cytomegalovirus (CMV) particles during the acute phase of infection, termed primary viremia, following ICV or intravascular (IV) injection into the neonatal mouse brain. In the ICV injection model, 5 &#181;l of murine CMV (MCMV) or fluorescent microbeads were injected into the lateral ventricle at the midpoint between the ear and eye using a 10-&#181;l syringe with a 27 G needle. In the IV injection model, a 1-ml syringe with a 35 G needle was used. A transilluminator was used to visualize the superficial temporal (facial) vein of the neonatal mouse. We infused 50 &#181;l of MCMV or fluorescent microbeads into the superficial temporal vein. Brains were harvested at different time points post-injection. MCMV genomes were detected using the <em>in situ</em> hybridization method. Fluorescent microbeads or green fluorescent protein expressing recombinant MCMV particles were observed by fluorescent microscopy. These techniques can be applied to many other pathogens to investigate the pathogenesis of encephalitis.</p>

<p class='jove_content'>Here, we describe a simple method of intracerebroventricular and intravascular injection of viral particles or fluorescent microbeads into the neonatal mouse brain. The localization pattern of the virus and nanoparticles could be detected by microscopic evaluation or by <em>in situ</em> hybridization. </p>

Intracerebroventricular e intravascular A injeção de Viral partículas e fluorescentes microesferas no cérebro Neonatal

In the study on the pathogenesis of viral encephalitis, the infection method is critical. The first of the two main infectious routes to the brain is the ...

Cannula Implantation into the Cisterna Magna of Rodents

<p class="jove_content">Cisterna magna cannulation (CMc) is a straightforward procedure that enables direct access to the cerebrospinal fluid (CSF) without operative damage to the skull or the brain parenchyma. In anesthetized rodents, the exposure of the dura mater by blunt dissection of the neck muscles allows the insertion of a cannula into the cisterna magna (CM). The cannula, composed either by a fine beveled needle or borosilicate capillary, is attached via a polyethylene (PE) tube to a syringe. Using a syringe pump, molecules can then be injected at controlled rates directly into the CM, which is continuous with the subarachnoid space. From the subarachnoid space, we can trace CSF fluxes by convective flow into the perivascular space around penetrating arterioles, where solute exchange with the interstitial fluid (ISF) occurs. CMc can be performed for acute injections immediately following the surgery, or for chronic implantation, with later injection in anesthetized or awake, freely moving rodents. Quantitation of tracer distribution in the brain parenchyma can be performed by epifluorescence, 2-photon microscopy, and magnetic resonance imaging (MRI), depending on the physico-chemical properties of the injected molecules. Thus, CMc in conjunction with various imaging techniques offers a powerful tool for assessment of the glymphatic system and CSF dynamics and function. Furthermore, CMc can be utilized as a conduit for fast, brain-wide delivery of signaling molecules and metabolic substrates that could not otherwise cross the blood brain barrier (BBB).</p>

<p class="jove_content">Here we describe a protocol to perform cisterna magna cannulation (CMc), a minimally invasive way to deliver tracers, substrates and signaling molecules into the cerebrospinal fluid (CSF). Combined with different imaging modalities, CMc enables glymphatic system and CSF dynamics assessment, as well as brain-wide delivery of various compounds.</p>

Cânula de implantação para a Cisterna Magna de roedores

Cisterna magna cannulation (CMc) is a straightforward procedure that enables direct access to the cerebrospinal fluid (CSF) without operative damage to ...

Rat Model of Widespread Cerebral Cortical Demyelination Induced by an Intracerebral Injection of Pro-Inflammatory Cytokines

<p class="jove_content">Multiple sclerosis (MS) is the most common immune-mediated disease of the central nervous system (CNS) and progressively leads to physical disability and death, caused by white matter lesions in the spinal cord and cerebellum, as well as by demyelination in grey matter. Whilst conventional models of experimental allergic encephalomyelitis are suitable for the investigation of the cell-mediated inflammation in the spinal and cerebellar white matter, they fail to address grey matter pathologies. Here, we present the experimental protocol for a novel rat model of cortical demyelination allowing the investigation of the pathological and molecular mechanisms leading to cortical lesions. The demyelination is induced by an immunization with low-dose myelin oligodendrocyte glycoprotein (MOG) in an incomplete Freund&#39;s adjuvant followed by a catheter-mediated intracerebral delivery of pro-inflammatory cytokines. The catheter, moreover, enables multiple rounds of demyelination without causing injection-induced trauma, as well as the intracerebral delivery of potential therapeutic drugs undergoing a preclinical investigation. The method is also ethically favorable as animal pain and distress or disability are controlled and relatively minimal. The expected timeframe for the implementation of the entire protocol is around 8 - 10 weeks.</p>

<p class="jove_content">The protocol presented here allows the reproduction of a widespread grey matter demyelination of both cortical hemispheres in adult male Dark Agouti rats. The method comprises of intracerebral implantation of a catheter, subclinical immunization against myelin oligodendrocyte glycoprotein, and intracerebral injection of a pro-inflammatory cytokine mixture through the implanted catheter.</p>

Modelo de Rato de Demyelinação Cortical Cerebral Generalizada Induzida por uma injeção intracerebral de citocinas pró-inflamatórias

Multiple sclerosis (MS) is the most common immune-mediated disease of the central nervous system (CNS) and progressively leads to physical disability and ...