Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells

Summary

We provide a novel strategy to isolate viral replication compartments (RC) from adenovirus (Ad)-infected human cells. This approach represents a cell-free system that can help to elucidate the molecular mechanisms regulating viral genome replication and expression as well as regulation of viral-host interactions established at the RC.

Abstract

During infection of human cells by adenovirus (Ad), the host cell nucleus is dramatically reorganized, leading to formation of nuclear microenvironments through the recruitment of viral and cellular proteins to sites occupied by the viral genome. These sites, called replication compartments (RC), can be considered viral-induced nuclear domains where the viral genome is localized and viral and cellular proteins that participate in replication, transcription and post-transcriptional processing are recruited. Moreover, cellular proteins involved in the antiviral response, such as tumor suppressor proteins, DNA damage response (DDR) components and innate immune response factors are also co-opted to RC. Although RC seem to play a crucial role to promote an efficient and productive replication cycle, a detailed analysis of their composition and associated activities has not been made. To facilitate the study of adenoviral RC and potentially those from other DNA viruses that replicate in the cell nucleus, we adapted a simple procedure based on velocity gradients to isolate Ad RC and established a cell-free system amenable to conduct morphological, functional and compositional studies of these virus-induced subnuclear structures, as well as to study their impact on host-cell interactions.

Introduction

Adenoviruses contain a double-stranded DNA genome that replicates in the infected cell nucleus. When the viral DNA enters the nucleus, it localizes adjacent to PML nuclear bodies¹. Following viral early gene expression, the nuclear architecture is dramatically reorganized, inducing formation of viral microenvironments, termed viral Replication Compartments (RC)². Since adenovirus (Ad) RC are sites where viral genome replication and expression of viral late genes take place, they provide an environment for recruitment of all the necessary viral and cellular factors that participate in these processes. Interestingly, a variety of cellular proteins responsible for the cellular antiviral response, such as the DNA damage response, the innate immune response and tumor suppression are co-opted to these viral sites². Hence, Ad RC can be considered regulatory hubs that promote efficient viral replication while concomitantly regulating the cellular antiviral response, indicating that these structures are key to the understanding of virus-host cell interactions. Nevertheless, the molecular mechanisms of RC formation, their composition and associated activities are poorly understood.

Adenoviral RC, as well as RC from other DNA viruses that replicate in the nucleus are not associated to membranes, in contrast to cytoplasmic RC³. Moreover, these virus-induced structures are likely to be composed entirely of proteins and nucleic acids. RC formed in cells infected with RNA viruses (usually termed viral factories) have been isolated, taking advantage of their cytoplasmic localization and membrane-bound status, which has facilitated their detailed morphological, functional and biochemical characterization⁴.

To our knowledge, nuclear viral RC have not been isolated, perhaps due to the complexity of the nuclear architecture and absence of intranuclear membranes that would facilitate their isolation. Their study has relied instead on immunofluorescence microscopy, FISH and transmission electron microscopy. However, despite complications inherent to isolating subnuclear structures, other nuclear domains such as nucleoli and Cajal Bodies have been isolated before ^5,6. Since nucleoli and RC are both composed of proteins and nucleic acids, and have a diameter between 0.5 - 5 µm, we hypothesized that RC should also be amenable to isolation. Therefore, in order to more precisely characterize the molecular composition and functions associated to RC, we established a novel method to isolate subnuclear fractions enriched with RC. To this end, we prepared sub-nuclear fractions using velocity gradients and sucrose cushions similar to procedures used to isolate nucleoli⁷ or other nuclear domains⁶ and established a cell-free system that allows the study of the molecular composition and associated activities of RC. This technique should therefore advance the understanding of virus-host cell interactions and represents a powerful tool that should also facilitate the detailed analysis of RC from other viruses that replicate in the nucleus and induce formation of replication compartments of similar dimensions to those formed in adenovirus-infected-cells, such as, herpesviruses, papillomaviruses or polyomaviruses.

Protocol

1. HFF Cell Culture and Ad-infection

1. Propagate Ad5 WT virus in monolayers of HEK-293 cells and titer as fluorescent forming units (FFU) on HFF cells as described previously⁸.
2. Grow Human Foreskin fibroblasts (HFF) in 10 ml of DMEM/10% Fetal Bovine Serum (FBS) in sterile culture 100 mm dishes at 37 ºC and 5% CO₂ in a humidified incubator. Determine the cell number using a Neubauer chamber by counting cells in the four 16-square sets. The cell number per ml is obtained by calculating the average number of cells in the four 16-square sets and multiplying this number by 10⁴. For each time post-infection included in step 1.3, use 1 x 10⁷ HFF cells.
3. Mock-infect or infect HFF cells with adenovirus type 5 (Ad5) wild-type (WT) (H5pg4100⁸) in 100 mm tissue culture dishes using 1 ml of Ad5 in DMEM per dish at an MOI of 30 Focus Forming Unit, or FFU, per cell. Incubate for 2 hr in a humidified cell culture incubator at 37 ºC and 5% CO₂, carefully rocking the dishes every 15 min to ensure homogeneous distribution of the virus inoculum over the cells. After this time, remove the medium and add fresh DMEM supplemented with 10% FBS and incubate for 16, 24 or 36 hr in a humidified cell culture incubator at 37 ^ºC and 5% CO₂. Proceed to step 2.1.

2. Preparation of Sub-nuclear Fractions Enriched with Adenovirus RC

1. Harvest Ad5-infected or mock-infected HFF cells with a cell scrapper and collect the cells in sterile centrifuge tubes. Determine the cell number as in step 1.2. Use 1 x 10⁷ cells for each time post-infection specified in step 1.3.
2. Centrifuge the cells at 220 x g, 4 ºC for 5 min.
3. Resuspend the cell pellet in ice-cold PBS (137 mM NaCl, 2.7 mM KCl, 10 mM Na₂HPO₄ and 1.8 mM KH₂PO₄). Wash cell pellets 3 times using 5 ml of ice-cold PBS per wash. For this purpose, centrifuge the cells at 220 x g, 4 ºC for 5 min, decant and discard the supernatant (SN), and resuspend the cell pellet by gentle pipetting.
4. To disrupt the plasma membrane, resuspend the cell pellet in 700 µl of ice-cold hypotonic buffer (10 mM HEPES pH 7.9, 10 mM KCl, 1.5 mM MgCl₂, 0.5 mM DTT, 20 µg/ml phenylmethylsulfonyl fluoride (PMSF), a mixture of cysteine, serine, threonine and aspartyl protease inhibitors including 10 µg/ml bovine pancreatic trypsin inhibitor, 10 µg/ml pepstatin A and 10 µg/ml N-acetyl-L-leucyl-L-leucyl-L-argininal) and let the cells swell on ice for 3 hr.
5. Lyse the cells using a homogenizer with a loose-fitting A type teflon pestle. Perform 80 dounce strokes and monitor samples every 20 strokes by bright field microscopy to ensure that all cells have been lysed, but that nuclei have not been damaged or ruptured.
6. Centrifuge the cell homogenate at 300 x g, 4 ºC for 5 min. Store the SN as the cytoplasmic fraction at -20 ºC in a centrifuge tube.
7. To remove cellular debris from nuclei, resuspend the pellet in 750 µl of solution 1 (S1) (0.25 M sucrose, 10 mM MgCl₂ 20 µg/ml PMSF, a mixture of cysteine, serine, threonine and aspartyl protease inhibitors including 10 µg/ml bovine pancreatic trypsin inhibitor, 10 µg/ml pepstatin A and 10 µg/ml N-acetyl-L-leucyl-L-leucyl-L-argininal) and layer over an equal volume of solution 2 (S2) (0.35 M sucrose, 0.5 mM MgCl_2, 20 µg/ml PMSF, a mixture of cysteine, serine, threonine and aspartyl protease inhibitors including 10 µg/ml bovine pancreatic trypsin inhibitor, 10 µg/ml pepstatin A and 10 µg/ml N-acetyl-L-leucyl-L-leucyl-L-argininal). Centrifuge at 1,400 x g, 4 ºC for 5 min.
8. Discard the SN using a micropipette. Avoid disturbing the pellet.
9. Resuspend the pellet containing isolated nuclei in 750 µl of S2.
10. To isolate subnuclear fractions enriched with adenovirus RC (RCf), sonicate resuspended nuclei with an ultrasonic bath, using two 5 min pulses, or until all nuclei are lysed as observed by bright field microscopy. Use ice in ultrasonic bath as needed to keep samples at or below 4 °C.
11. Layer the sonicated nuclei over an equal volume of solution 3 (S3) (0.88 M sucrose, 0.5 mM MgCl₂) and centrifuge at 3,000 x g, 4 ºC for 10 min. Store the 1.5 ml supernatant as the nucleoplasmic fraction (Npl) at -70 ºC. Resuspend the pellet in 700 µl of S2 and store as RCf at -70 ºC.

3. Western Blot Analyses of RCf

NOTE: For Western Blot analysis of Npl and RCf fractions set aside 640 µl for Npl and 300 µl for RCf from the total volume obtained in step 2.11.

1. Mix 15 µl of each subnuclear fraction in Laemmli buffer 2x (4% SDS, 20% glycerol, 10% 2-mercaptoethanol, 0.004% bromophenol blue, 0.125 M Tris HCl pH 6.8) and boil at 95 ºC for 5 min. Load the samples in a 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) denaturing gel and separate proteins for 1.5 hr, at 20 milliamperes (mA).
2. Transfer proteins by electroblotting for 1.5 hr at 400 mA onto polyvinylidene difluoride (PVDF) membranes.
3. Block membrane for 2 hr at RT using 3% nonfat dry milk in PBS.
4. Incubate O/N at 4 ºC with primary antibody against viral E2A DNA-binding protein (B6-8⁹) at a 1:500 dilution in PBS/0.3% nonfat dry milk.
5. Wash membrane 3 times with PBS/0.1% Tween 20 for 10 min.
6. Incubate the membrane with mouse anti IgG secondary antibody coupled to horse-radish peroxidase (HRP) at a 1:10,000 dilution in PBS for 2 hr at RT.
7. Wash the membrane 3 times with PBS/0.1% Tween 20 for 10 min.
8. Develop the membrane using enhanced chemiluminescence and X-ray films.

4. Viral DNA Detection in RCf

NOTE: For DNA isolation from both Npl and RCf fractions, use 210 µl for Npl and 100 µl for RCf of the total volume obtained in step 2.11.

1. Incubate sub-nuclear fractions for 1 hr at 55 ºC with 1 mg/ml of proteinase K and 0.5% Tween 20.
2. Inactivate proteinase K by incubating the samples for 10 min at 95 °C.
3. Centrifuge the samples at 20,000 x g, at RT for 2 min.
4. Collect the SN. Precipitate the DNA with 1/10 volume of 3M sodium acetate and one volume of isopropanol, O/N at 4 °C.
5. Centrifuge the samples at 20,000 x g, at RT for 10 min.
6. Discard the SN using a micropipette. Wash the pellet with 70% ethanol and centrifuge at 20,000 x g, 4 °C for 5 min.
7. Resuspend the DNA in 10 µl of 10 mM Tris-HCl pH 7.4
8. Quantify DNA using a spectrophotometer by measuring the optical density (OD) at 260 nm.
9. To amplify viral DNA, use 100 ng of DNA from each subnuclear fraction in a standard PCR reaction using Taq DNA polymerase in 25 µl of reaction volume with primers that allow the amplification of a region within the Major Late transcription unit, from nucleotide 7273 to nucleotide 7353 (81 bp) (Fw: GAGCGAGGTGTGGGTGAGC; Rv: GGATGCGACGACACTGACTTCA). Use the following cycle conditions: Initial denaturation for 3 min at 95 ºC, followed by 20 cycles of amplification (1 min at 95 ºC, annealing for 1 min at 62 ºC and extension for 30 sec at 72 ºC) and a final extension step for 3 min at 72 ºC.
10. Run the PCR product in 2% agarose gels, at 90 V. Stain with ethidium bromide at 0.5 µg/ml final concentration and visualize DNA to corroborate viral DNA enrichment in the RCf. Handle ethidium bromide with extreme caution and always make sure to wear gloves, as this compound is a potent mutagen. Dispose ethidium bromide according to institutional guidelines.

5. Late Viral mRNA Detection in RCf

NOTE: For RNA isolation from both Npl and RCf fractions, use 640 µl for Npl and 300 µl for RCf from the total volume obtained in step 2.11.

1. Isolate RNA from subnuclear fractions using Trizol according with the manufacturer’s instructions. Resuspend the RNA in 50 µl of DEPC (diethilpyrocarbonate)-treated water.
2. Quantify the RNA using a spectrophotometer to measure the OD at 260 nm (approximately 3 µg are obtained). Store the RNA in 50 ng/µl aliquots at -70 ºC.
3. Check purified RNA for the absence of DNA contamination by performing a control PCR reaction in the absence of reverse transcriptase (RT), using 5 ng of total RNA and the cycle conditions described in step 4.9.
   1. If DNA contamination is absent no amplicon should be produced. If DNA contamination is present, incubate the samples with 10 U DNase I, 10 U of Rnase inhibitor, 0.1 M Tris-HCl pH 8.3, 0.5 M KCl and 15 mM MgCl₂ for 30 min at 37 ºC. Proceed to re-isolate RNA as in step 5.1.
4. To analyze viral mRNA associated to RCf, amplify 100 ng of RNA from each subnuclear fraction by RT-PCR using primers designed to detect adenoviral late mRNA from different gene families (Table 1).
   1. For reverse transcription (RT), use 100 ng of RNA, from each subnuclear fraction in a standard RT reaction using M-MuLV RT enzyme in 20 µl of reaction volume for 1 hr at 42 ºC and 10 min at 70 ºC.
   2. For amplification, use 1 µl of the cDNA in PCR reactions, as in step 4.9. Use the following cycle conditions: Initial denaturation for 3 min at 95 ºC, followed by 25 cycles of amplification (1 min at 95 ºC, annealing for 1 min at the temperature specified in Table 1 and extension for 30 sec at 72 ºC) and a final extension step for 3 min at 72 ºC.
5. Run the RT-PCR products in 2% agarose gels, at 90 V. Stain gels with ethidium bromide at 0.5 µg/ml final concentration and visualize to corroborate viral late mRNA association to the RCf. Handle ethidium bromide as indicated in step 4.10.

6. Immunofluorescence Visualization of RCf

NOTE: Carry-out this procedure under a laminar flow cabinet to avoid contamination of the samples with any dust particles, and filter all solutions before use.

1. Spot 5 µl of the RCf fraction obtained in step 2.10 directly on a silane-coated slide.
2. Let the spot dry for about 5 min at RT.
3. Re-hydrate by slowly and indirectly pipetting 500 µl of PBS in a drop beside the RCf spot and letting it flow by tilting the slide. Drain off the excess PBS from the side.
4. Block by covering the sample with 500 µl of PBS/5% bovine serum albumin (BSA) for 2 hr at RT.
5. Wash the slide 3 times by gently and indirectly pipetting 500 µl of PBS onto the sample. Tilt the slide to drain off the excess PBS.
6. Incubate the sample with primary antibody against viral E2A DNA-binding protein (B6-8⁹) at a 1:500 dilution in PBS for 2 hr at RT. Cover the spotted sample with 20 µl of the antibody solution and incubate in a humid chamber to avoid drying.
7. Wash the sample 3 times with PBS/0.02% Tween 20 by gently and indirectly pipetting 500 µl of PBS onto the sample. Tilt the slide to drain off the excess wash solution.
8. Incubate the samples with mouse anti IgG secondary antibody coupled to a fluorophore that is excited at 488 nm at a 1:2,000 dilution in PBS, for 1 hr at 4 ºC. Cover the spotted sample with 20 µl of the antibody solution and incubate in a humid chamber to avoid drying.
9. Wash the sample 3 times with PBS/0.02% Tween 20 by gently and indirectly pipetting 500 µl of PBS onto the sample. Tilt the slide to drain off the excess wash solution.
10. Cover the spotted sample on the slide with a coverslip using 2 µl PBS/10% glycerol as mounting medium. Seal with clear nail polish and store al -20 ºC.
11. Analyze the samples using a fluorescence microscope, with a 63x objective and a 1.4 Numeric Aperture (NA) at a wavelength of 488 nm.

Results

Since viral replication compartments (RC) are subnuclear viral-induced structures composed of proteins and nucleic acids, similar to other nuclear domains, they proved to be amenable to isolation by velocity gradients based on biochemical features. Critical steps in the fractionation protocol are illustrated in Figure 1. At each step the samples need to be monitored by bright field microscopy to ensure integrity of the different sub-cellular fractions. For example, when swelling the cells, incubation tim...

Discussion

In order to elucidate the molecular mechanisms that govern regulation of cellular activities by viral infection understanding the composition and activities associated with RC would be instrumental. Therefore, to make a detailed analysis of RC, we established a cell-free system that takes advantage of the size and biochemical composition of these virus-induced structures, to isolate subnuclear fractions enriched with RC using a simple procedure that relies on velocity gradients with sucrose cushions. Critical steps of th...

Materials

Name	Company	Catalog Number	Comments
DMEM	Gibco	12100-046	Warm in 37 ºC water bath before use
Fetal Bovine Serum	Gibco	12484-028
Sucrose, Ultra Pure	Research Organics	0928S	Prepare a 2.55 M stock solution and store at 4 ºC
Dounce homogenizer	Kontess Glass Company	884900-0000
Branson 1800 Ultrasonic Bath	Branson	Z769533 SIGMA	Turn on 15 min before use.
Goat anti-Mouse IgG1 Secondary Antibody, Alexa Fluor 488 conjugate	Life Technologies	A-21121	Use at a 1:2,000 dilution in PBS
Silane-Prep Slides	Sigma	S4651-72EA	Open in a laminar flow cabinet
SuperSignal West Pico Chemiluminescent Substrate	Pierce ThermoScientific	34080