JoVE Logo

Sign In

A subscription to JoVE is required to view this content. Sign in or start your free trial.

In This Article

  • Summary
  • Abstract
  • Introduction
  • Protocol
  • Results
  • Discussion
  • Disclosures
  • Acknowledgements
  • Materials
  • References
  • Reprints and Permissions

Summary

This paper presents a comprehensive procedure to evaluate in vitro whether classic tumor angiogenesis exists in hemangioblastomas (HBs) and its role in HBs. The results highlight the complexity of HB-neovascularization and suggest that this common form of angiogenesis is only a complementary mechanism in the HB-neovascularization.

Abstract

The inactivation of the von Hippel-Lindau (VHL) tumor suppressor gene plays a crucial role in the development of hemangioblastomas (HBs) within the human central nervous system (CNS). However, both the cytological origin and the evolutionary process of HBs (including neovascularization) remain controversial, and anti-angiogenesis for VHL-HBs, based on classic HB angiogenesis, have produced disappointing results in clinical trials. One major obstacle to the successful clinical translation of anti-vascular treatment is the lack of a thorough understanding of neovascularization in this vascular tumor. In this article, we present a comprehensive procedure to evaluate in vitro whether classic tumor angiogenesis exists in HBs, as well as its role in HBs. With this procedure, researchers can accurately understand the complexity of HB neovascularization and identify the function of this common form of angiogenesis in HBs. These protocols can be used to evaluate the most promising anti-vascular therapy for tumors, which has high translational potential either for tumors treatment or for aiding in the optimization of the anti-angiogenic treatment for HBs in future translations. The results highlight the complexity of HB neovascularization and suggest that this common form angiogenesis is only a complementary mechanism in HB neovascularization.

Introduction

Hemangioblastomas (HBs) are benign vascular tumors that are found exclusively within the human central nervous system (CNS). They develop in patients with either von Hippel-Lindau (VHL) disease or sporadic lesions. VHL-HBs are difficult to cure through surgical treatment due to the frequent recurrence and multiple lesions that result from this genetic disorder1. Although the inactivation of the VHL tumor suppressor gene has been considered the root cause of the tumorigenesis of VHL-HBs, the cytological origin (including neovascularization) and evolutionary process of HBs remain largely controversial2. Therefore, a better understanding of HB-neovascular biological mechanisms may provide useful insights into the most promising anti-vascular strategies for VHL-HBs.

Recent research has suggested that HB-neovascularization is similar to the embryologic vasculogenesis3,4,5. Classic vascular endothelial growth factor (VEGF)-mediated angiogenesis that originated from the vascular endothelium and that is driven by VHL loss of function resulted in proliferation and neovascular formation, which has been challenged6. In 1965, Cancilla and Zimmerman found, using electron microscopy, that HBs originated from the endothelium7. Later it was found that stromal cells are derived from vasoformative element8. In 1982, Jurco et al. found that stromal cells are of endothelial origin9. Therefore, we hypothesized that human vascular endothelial cells are the original cells of HB-neovascularization10. Although it is better to use the primary cultures from HB cells derived from VHL patient surgeries, our previous research indicated that primary cultures from HB are not stable, and cell lines could not be established3. Moreover, the primary cultures in the 3D environment could not identify the cytological origin of HB-neovascularization because they include the progenitors of HB-vascular ingredients10,11. Therefore, as a primitive and classic model of endothelial cells, human vascular endothelial cells (HUVEC) could serve as an alternative cellular model for HBs.

The spheroid sprouting assay is a new model in tissue engineering12,13. In this paper, a 3D collagen-based coculture system in vitro using the spheroid sprouting assay was developed, with an overall goal to evaluate whether classic tumor angiogenesis exists in HBs, as well as its role in HBs.

Protocol

This method was performed in accordance with the approved guidelines and regulations of the Research Ethics Committee of Huashan Hospital, Fudan University. Corresponding standard safety measures were followed in each step. For a schematic presentation, please refer to Figure 1.

1. Cell Culture and Plasmid Construct

  1. Routinely maintain the human umbilical vein endothelial cell (HUVEC) in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 100 unit/mL of penicillin, and 100 µg/mL of streptomycin in a humidified 5% CO2 incubator at 37 °C.
  2. Digest PLKO.1 plasmid with ApaI and EcoRI for the synthesis of shRNA fragment. Ensure that the oligonucleotide sequence of VHL shRNA vector is CCGGGATCTGGAAGACCACCCAAATCTCGAGA TTTGGGTGGTCTTCCAGATCTTTTTG14.
  3. Then, mix 20 µΜ system with forward 5 µL of oligo, 5 µL of reverse oligo, 5 µL of 10x NEB buffer and 35 µL of ddH2O together (The total volume is 50 µL). Heat the mixture at 98 °C for 4 min, and slowly cool down to room temperature in a few hours.
  4. Ligate the annealed oligos and PLKO.1 plasmid together with T4 ligase at 4 °C for overnight. 16 h later, add 5 µL of ligation mix into 25 µL competent DH5α cells. Then, screen the successfully ligated plasmids, and verify the inserted fragment by sequencing.

2. Lentivirus Package and Infection

  1. In total, mix 10 µg of the PLKO.1-shVHL or PLKO.1-shScramble vector, 7.5 µg of packing plasmid psPAX2, and 2.5 µg of envelope plasmid pMD2.G in 500 µL of the DMEM media without fetal bovine serum (FBS) for 25 min.
  2. Add 7 mLDMEM without FBS to the solution prepared above.
  3. Culture 293FT cells in the DMEM without FBS in a 10-cm diameter tissue culture dishes. Ensure that the number of 293FT cells is 1 x 107 using a cell counter.
  4. Add 1 mL of the solution prepared above to the medium of 293FT cells for transfection.
    Note: The 293FT cell line is derived from the 293F cell line and stably express the SV40 large T antigen. Therefore, it is a suitable host for lentiviral production.
  5. Replace the culture medium with the DMEM containing 10% FBS after 6 h.
  6. Collect the media using a pipette at 48 h after transfection.
    Note: The virus exists in the DMEM containing 10% FBS. The dead cells float on the medium. Use 0.45 µm sterile membrane to filter the dead cells and impurities. Generally, there is no need to check multiplicity of infection (MOI). This is to establish a stable cells line. At the last step, all living cells without successful infection will die by puromycin. The shScramble group and HUVEC cells are the control group. Ensure that all the HUVEC cells die with the used puromycin concentration by 72 h. Every well has the same number of cells.
  7. Culture the HUVEC cells in the lentiviral media for 72 h. Then, add puromycin to the media of the HUVEC cells at a concentration of 2 µg/mL for 24 h. Use HUVEC cells without any treatment as the control group. Ensure that all control cells die by this time.
    Note: The living cells represent a stable cell line of VHL knockdown cells and shSramble cells. The plating density is 5,000/well in 96-well plates.

3. Generation of Endothelial Cell Spheroids

  1. Trypsinize the HUVECs cells and resuspend in the DMEM medium with 10% FBS. With a moderate number of cells in a 10-cm culture dish, add 1 mL of typsin-EDTA.
  2. Seed the cells in a 3D round-bottom 96-well plate, at a cell density of 1 × 103 cells/well. Use a well that can accommodate a spheroid of 0.50 µL to suspend the spheroid. Count cells using a cell counter system following the manufacturer's instructions.
  3. Incubate the cells at 37 °C and 5% CO2 continuously for 72 h. Under these conditions, ensure that the suspended cells form the cell spheroids automatically. Replace half of the culture medium after 36 h.

4. In vitro Angiogenesis Assay

  1. Thaw the gel solution at 4 °C and dilute it with the reduced serum medium at a dilution ratio of 1:5.
  2. Suck the spheroids from the DMEM culture medium with a micropipette. After washing the spheroids with 5 mL of the reduced serum medium, suspend the spheroids gently and cautiously in the diluted gel. Ensure that there are no air bubbles.
  3. Embed 300 µL of mixed liquid in a 15-well plate. After incubation at 37 °C and 5% CO2 for 1 h, add 400 µL the reduced serum medium to each well. Fill sterile water around the wells to generate a humidified environment to hinder evaporation.
  4. Thereafter, culture the plate at 37 °C in 5% CO2 at 100% humidity for 1 h.
  5. Carefully aspirate the old medium and replace it by 600 µL of reduced serum medium with 1% endothelial cell growth supplements in each well.
  6. After 12 h or 24 h, take images under an inverted light microscope (40*).

5. Data Analysis

  1. Upload the images to an online image analysis platform to obtain sprout length data (Table of Materials).
  2. On the webpage, create an account by email.
  3. Then upload the images by clicking the upload button.
  4. Download the result by clicking the download button.
    Note: The software will generate the processed image and the data. The data contain five parts: cumulative sprout length, mean sprout length, the standard deviation of sprout length, sprout area and spheroid area. In the processed image, each parameter is outlined in a different color to ease identification in the processed image: Red represents sprouts skeleton, yellow the number of sprouts, blue the sprout structure, white sprout end, and orange spheroid.

Results

Original images are taken by inverted light microscope. The typical images of the control group and the VHL group are shown in Figure 2-A1 and Figure 2-A2. The sprouting length of the control group is shorter than that of the VHL group.

After uploading the Images, the online platform provides analysis results directly. The output consis...

Discussion

Recently, multiple fields of vascular biology research were stimulated by the study of the angiogenic endothelium15. In this article, we developed an endothelial spheroid sprouting technique as an experimental model to study the vessel formation that originates from the VHL gene's loss of function in manipulated endothelial cells to identify novel candidate molecules of the angiogenic cascade. To the best of our knowledge, this is the first report to examine the angiogenic effects of the endog...

Disclosures

The authors have nothing to disclose.

Acknowledgements

This work was supported by grants from the Shanghai Committee of Science and Technology (15411951800, 15410723200). The authors wish to thank Prof. YuMei Wen and Prof. Chao Zhao of the Pathogenic Microorganism Department of Fudan University for their technical assistance.

Materials

NameCompanyCatalog NumberComments
human umbilical vein endothelial cellFudan IBS Cell CenterFDCC-HXN180
dulbecco’s modified eagle’s medium Gibco11995040
fetal bovine serumGibco 26400044
PLKO.1-puro vectorAddgene#8453
packing plasmid psPAX2 Addgene#12260
envelope plasmid pMD2.GAddgene#12259
3D round-bottom 96-well platesS-BioMS-9096M
matrigelBD Biosciences354234
Opti-MEM mediumGibco31985-070reduced serum medium 
15-well plateIbidi81501Air bubbles in the gel can be reduced by equilibrating the μ–Slide angiogenesis before usage inside the incubator overnight
endothelial cell growth supplementsSciencell#1052
10-cm culture dishCorningScipu000813
PuromycinGibcoA1113802
typsin-EDTAGibco25200056
Automated Cell Counter System  BioTech
Image Analysis software Winmasishttp://mywim.wimasis.com 

References

  1. Lonser, R. R., et al. von Hippel-Lindau disease. Lancet. 361 (9374), 2059-2067 (2003).
  2. Hussein, M. R. Central nervous system capillary haemangioblastoma: the pathologist's viewpoint. Int J Exp Pathol. 88 (5), 311-324 (2007).
  3. Ma, D., et al. Hemangioblastomas might derive from neoplastic transformation of neural stem cells/progenitors in the specific niche. Carcinogenesis. 32 (1), 102-109 (2011).
  4. Zhuang, Z., et al. Tumor derived vasculogenesis in von Hippel-Lindau disease-associated tumors. Sci Rep. 4, 4102 (2014).
  5. Glasker, S., et al. VHL-deficient vasculogenesis in hemangioblastoma. Exp Mol Pathol. 96 (2), 162-167 (2014).
  6. Wizigmann-Voos, S., Breier, G., Risau, W., Plate, K. H. Up-regulation of vascular endothelial growth factor and its receptors in von Hippel-Lindau disease-associated and sporadic hemangioblastomas. Cancer Res. 55 (6), 1358-1364 (1995).
  7. Cancilla, P. A., Zimmerman, H. M. The fine structure of a cerebellar hemangioblastoma. J Neuropathol Exp Neurol. 24 (4), 621-628 (1965).
  8. Kawamura, J., Garcia, J. H., Kamijyo, Y. Cerebellar hemangioblastoma: histogenesis of stroma cells. Cancer. 31 (6), 1528-1540 (1973).
  9. Jurco, S., et al. Hemangioblastomas: histogenesis of the stromal cell studied by immunocytochemistry. Hum Pathol. 13 (1), 13-18 (1982).
  10. Ma, D., et al. Identification of tumorigenic cells and implication of their aberrant differentiation in human hemangioblastomas. Cancer Biol Ther. 12 (8), 727-736 (2011).
  11. Ma, D., et al. CD41 and CD45 expression marks the angioformative initiation of neovascularisation in human haemangioblastoma. Tumour Biol. 37 (3), 3765-3774 (2016).
  12. Sharifpanah, F., Sauer, H. Stem Cell Spheroid-Based Sprout Assay in Three-Dimensional Fibrin Scaffold: A Novel In Vitro Model for the Study of Angiogenesis. Methods Mol Biol. 1430, 179-189 (2016).
  13. Cai, H., et al. Long non-coding RNA taurine upregulated 1 enhances tumor-induced angiogenesis through inhibiting microRNA-299 in human glioblastoma. Oncogene. 36 (3), 318-331 (2017).
  14. Xu, J., et al. Construction of Conveniently Screening pLKO.1-TRC Vector Tagged with TurboGFP. Appl Biochem Biotechnol. 181 (2), 699-709 (2017).
  15. Laib, A. M., et al. Spheroid-based human endothelial cell microvessel formation in vivo. Nat Protoc. 4 (8), 1202-1215 (2009).
  16. D'Alessio, A., Moccia, F., Li, J. H., Micera, A., Kyriakides, T. R. Angiogenesis and Vasculogenesis in Health and Disease. Biomed Res Int. 2015, 126582 (2015).
  17. Finkenzeller, G., Graner, S., Kirkpatrick, C. J., Fuchs, S., Stark, G. B. Impaired in vivo vasculogenic potential of endothelial progenitor cells in comparison to human umbilical vein endothelial cells in a spheroid-based implantation model. Cell Prolif. 42 (4), 498-505 (2009).
  18. Morin, K. T., Tranquillo, R. T. In vitro models of angiogenesis and vasculogenesis in fibrin gel. Exp Cell Res. 319 (16), 2409-2417 (2013).
  19. Blacher, S., et al. Cell invasion in the spheroid sprouting assay: a spatial organisation analysis adaptable to cell behaviour. PLoS One. 9 (5), 97019 (2014).
  20. Straume, O., et al. Suppression of heat shock protein 27 induces long-term dormancy in human breast cancer. Proc Natl Acad Sci U S A. 109 (22), 8699-8704 (2012).
  21. Naumov, G. N., Akslen, L. A., Folkman, J. Role of angiogenesis in human tumor dormancy: animal models of the angiogenic switch. Cell Cycle. 5 (16), 1779-1787 (2006).
  22. Naumov, G. N., Folkman, J., Straume, O. Tumor dormancy due to failure of angiogenesis: role of the microenvironment. Clin Exp Metastasis. 26 (1), 51-60 (2009).
  23. Wang, Y., Yang, J., Du, G., Ma, D., Zhou, L. Neuroprotective effects respond to cerebral ischemia without susceptibility to HB-tumorigenesis in VHL heterozygous knockout mice. Mol Carcinog. 56 (10), 2342-2351 (2017).
  24. Stratmann, R., Krieg, M., Haas, R., Plate, K. H. Putative control of angiogenesis in hemangioblastomas by the von Hippel-Lindau tumor suppressor gene. J Neuropathol Exp Neurol. 56 (11), 1242-1252 (1997).
  25. Correa de Sampaio, P., et al. A heterogeneous in vitro three dimensional model of tumour-stroma interactions regulating sprouting angiogenesis. PLoS One. 7 (2), 30753 (2012).

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Explore More Articles

Spheroid Sprouting AssayHemangioblastomaNeovascularizationTumor AngiogenesisVasculogenesisHUVECShRNALentiviral VectorEndothelial CellAngiogenesisTumor Vasculogenic Mimicry

This article has been published

Video Coming Soon

JoVE Logo

Privacy

Terms of Use

Policies

Research

Education

ABOUT JoVE

Copyright © 2025 MyJoVE Corporation. All rights reserved