Molecular and Immunologic Techniques in a Genetically Engineered Mouse Model of Gastrointestinal Stromal Tumor

Summary

The goal of this manuscript is to describe the Kit^V558Δ/+ mouse model and techniques for successful dissection and processing of mouse specimens.

Abstract

Gastrointestinal stromal tumor (GIST) is the most common human sarcoma and is typically driven by a single mutation in the KIT receptor. Across tumor types, numerous mouse models have been developed in order to investigate the next generation of cancer therapies. However, in GIST, most in vivo studies use xenograft mouse models which have inherent limitations. Here, we describe an immunocompetent, genetically engineered mouse model of gastrointestinal stromal tumor harboring a Kit^V558Δ/+ mutation. In this model, mutant KIT, the oncogene responsible for most GISTs, is driven by its endogenous promoter leading to a GIST which mimics the histological appearance and immune infiltrate seen in human GISTs. Furthermore, this model has been used successfully to investigate both targeted molecular and immune therapies. Here, we describe the breeding and maintenance of a Kit^V558Δ/+ mouse colony. Additionally, this paper details the treatment and procurement of GIST, draining mesenteric lymph node, and adjacent cecum in Kit^V558Δ/+ mice, as well as sample preparation for molecular and immunologic analyses.

Introduction

GIST is the most common sarcoma in humans with an incidence of about 6,000 cases in the United States of America¹. GIST appears to originate from the gastrointestinal pacemaker cells named the interstitial cells of Cajal, and is typically driven by a single mutation in the tyrosine kinase KIT or PDGFRA². Surgery is the mainstay of treatment for GIST and can be curative, but patients with advanced disease may be treated with the tyrosine kinase inhibitor (TKI), imatinib. Since its introduction over 20 years ago, imatinib has transformed the treatment paradigm in GIST, improving the survival in advanced disease from 1 to over 5 years^3,4,5. Unfortunately, imatinib is rarely curative due to acquired KIT mutations, so new treatments are needed for this tumor.

Mouse models are an important research tool in the investigation of novel therapies in cancer. Multiple subcutaneous xenograft and patient-derived xenograft models have been developed and investigated in GIST^6,7. However, immunodeficient mice do not fully represent human GIST since GISTs harbor differential immune profiles depending on their oncogenic mutation, and altering the gastrointestinal tumor microenvironment improves upon the effects of TKI therapy^8,9. The Kit^V558Δ/+ mouse has a heterozygous germline deletion in Kit exon 11, which encodes the juxtamembrane domain, the most commonly mutated site in human GIST¹⁰. Kit^V558Δ/+ mice develop a single cecal GIST with 100% penetrance, and tumors have similar histology, molecular signaling, immune infiltration, and response to therapy as human GIST^8,11,12,13. Here, we describe breeding, treatment, and specimen isolation and processing in Kit^V558Δ/+ mice for use in molecular and immunologic research in GIST.

Access restricted. Please log in or start a trial to view this content.

Protocol

All mice were housed under pathogen-free conditions at the University of Pennsylvania according to NIH guidelines and with approval of the University of Pennsylvania IACUC. Euthanasia was performed following the University of Pennsylvania Laboratory Animal Resources standard operating procedures.

1. Kit^V558Δ/+ mouse breeding

1. Backcross the Kit^V558Δ/+ mice more than 10 times onto a C57BL/6J background using C57BL/6J mice. To do this, breed the male Kit^V558Δ/+ mice with female C57BL/6J mice at a 1:2 ratio.
   NOTE: The homozygous Kit^{V558Δ/V558Δ} genotype is lethal in utero. It is possible to breed female Kit^V558Δ/+ mice with male C57BL/6J mice, but litter size is about half as that seen from female wildtype C57BL/6J mice. Furthermore, female Kit^V558Δ/+ mice produce limited litters after 4 months of age.
2. Genotype the pups at 7-14 days of age by toe clipping to confirm the presence of the Kit^V558Δ/+ genotype. Use the forward primer: TCTCCTCCAGAAACCCATGTATGAA; reporter 1: CCTCGACAACCTTCCA; reverse primer: TTGCGTCGGGTCTATGTAAACAT; and reporter 2: TCTCCTCGACCTTCCA for genotyping.

2. Kit^V558Δ/+ mouse treatment

1. Age and sex match the Kit^V558Δ/+ mice prior to treatment. Use the age- and sex-matched mice in cohorts as tumors from female Kit^V558Δ/+ mice are larger than those in male mice. Treat the mice at 8-12 weeks old, at which time tumors are established (Figure 1).
2. Give tyrosine kinase inhibitors orally or by intraperitoneal (i.p.) injection; Kit^V558Δ/+ tumors are sensitive to tyrosine kinase inhibitors. Provide imatinib in a dose of 600 mg/L in drinking water or i.p. injections of 45 mg/kg twice daily. Measure tumor weight reduction using digital scales after dissection of tumor as shown in step 3, which is approximately 50% at 1 week and 80% at 4 weeks following treatment with imatinib (Figure 2).

3. Kit^V558Δ/+ mouse organ harvest

1. Euthanize mice by CO₂ narcosis at a flow rate of 60% chamber volume per min. Leave mice in the chamber for at least 2 min after respiration has ceased, then perform cervical dislocation to confirm death.
2. Sterilize all instruments, wear gloves throughout the procedure, and maintain a sterile field. Prepare the skin with 70% ethanol. Make a 2 cm midline vertical incision using scissors and enter the abdominal cavity. Sharply lyse any intra-abdominal adhesions.
3. To remove the draining mesenteric lymph node, follow the steps described below.
   1. Identify the cecum and lift its mesentery superiorly. Approximately midway to the base of the colonic mesentery, identify the mesenteric lymph node and sharply dissect it. The lymph node is off-white and about 0.5 cm x 0.5 cm in size.
   2. Divide lymph node tissue into thirds for protein isolation, histology, and single cell suspension, as needed. For single cell suspensions, place lymph node tissue in 20 mL of serum free media (RPMI) and keep on ice.
4. For isolation of the GIST and cecum, follow the steps described below.
   1. The cecum in Kit^V558Δ/+ mice is mostly replaced by a GIST. Carefully divide the ileocolic junction from the base of the tumor. To collect the cecum, divide the colon again, 2 cm proximal to the base of the tumor.
   2. In 50%-60% of Kit^V558Δ/+ mice, the head of the tumor contains a cap of cecal tissue, which typically contains serous fluid but may rarely contain pus (Figure 3). Sharply dissect the cap tissue away from the tumor tissue.
   3. Divide tumor tissue and/or cecum into thirds for protein isolation, histology, and single cell suspension, as needed. For single cell suspensions, place tumor tissue or cecum in HBSS with 2% FCS, enough to cover the sample and keep on ice.

4. Western blot analysis of GIST tissue

1. Prepare tissue lysis buffer containing 50 mM TrisHCl (pH 7.5), 150 mM NaCl, 5 mM EDTA, 1% nondenaturing detergent, 2 mM Na₃VO₄, 1 mM PMSF, 10 mM NaF, and 20 μl/ml proteinase inhibitor mixture.
2. Prepare a 1x Tris-buffered saline solution with 1% Tween 20 (TBST) by combining 1800 mL of deionized water, 2 mL of Tween 20, and 200 mL of 10x Tris-buffered saline (TBS).
3. Resuspend tissue from step 3.4.3 in a FACS tube in 5mL/g of tissue lysis buffer and homogenize twice with a mechanical homogenizer at 15,000 rpm for 15 s on ice. Incubate lysate for 30 min on ice.
4. Transfer lysate to a 1.5 mL microcentrifuge tube. Centrifuge at max speed for 20 min at 4 °C. Transfer supernatant into a new microcentrifuge tube.
5. Run lysates on a 4% to 15% gradient gel, then transfer to a nitrocellulose membrane, as described in¹⁴.
6. Wash membrane once in 1x TBS for 5 min and then block membrane in 5% milk for 1 h. Again, wash membrane once in 1x TBS for 10 min.
7. Incubate membrane in primary antibody diluted 1:1000 in 5% BSA at 4 °C overnight. Wash membrane 3x in 1x TBST for 10 min each. Incubate blot with secondary antibody diluted 1:2500 in 2.5% milk for 1 h at room temperature.
8. Wash membrane once in 1x TBS for 5 min. Add enough HRP substrate to cover membrane, typically 200-500 μL, and use a digital imager to detect and quantify chemiluminescence.

5. Immunohistochemistry of GIST tissue

1. Fix tissue from step 3.3.2 or 3.4.3 in 4% paraformaldehyde at 4 °C overnight. Store tissue in 70% EtOH until ready for processing. Embed and section blocks at 5 μm thickness onto glass slides, as described^15,16.
2. Complete immunohistochemical detection using a basic immunodetection kit, as previously described¹⁷.

6. Single cell suspension of mesenteric lymph node

1. Pour RPMI media with lymph node specimen from step 3.3.2 over a 100 μm filter. Move filter to new 50 mL conical and mash lymph node with the soft end of a 3 mL plastic syringe. Wash filter with 20 mL of RPMI media.
2. Centrifuge the filtrate at 450 x g at 4 °C for 5 min. Aspirate the supernatant. 
3. Resuspend pellet in 20 mL of 1% FBS in PBS (bead buffer) and pour over a 40 μm filter. Collect the cell filtrate. Count cells using a hemocytometer.
4. Centrifuge the filtrate at 450 x g at 4 °C for 5 min. Aspirate the supernatant. Resuspend in bead buffer at 6 x 10⁷ cells/mL for flow cytometry.

7. Single cell suspension of GIST

1. Prepare collagenase buffer by adding 250 mg of collagenase IV, one tablet of EDTA-free protease inhibitor and 100 µL of DNase I to 50 mL of HBSS. Rotate for 10 min at room temperature until dissolved.
2. Place GIST in a sterile dish and add 2.5 mL of collagenase buffer. Mince tumor using a sterile scalpel and scissors until the tumor is in fine fragments. Use a large bore pipette to aspirate the tumor and collagenase into a 50 mL tube.
3. Incubate in a shaking incubator at 100 rpm at 37 °C for 30 min. Quench reaction with 2 mL of FBS.
4. Pour collagenase with GIST specimen over a 100 μm filter and mash tumor with the soft end of a 3 mL plastic syringe and collect in a 50 mL tube. Wash filter with 20 mL of HBSS. Centrifuge the filtrate at 450 x g, 4 °C for 5 min. Aspirate the supernatant.
5. Resuspend the pellet in 20 mL of bead buffer and pour over a 40 μm filter. Collect the filtrate and count cells using a hemocytometer. Centrifuge the filtrate at 450 x g, 4 °C for 5 min. Aspirate the supernatant. Resuspend in bead buffer at 6 x 10⁷ cells/mL for flow cytometry.

8. Single cell suspension of cecum

1. Prepare collagenase buffer as in step 7.1. Using scissors, split the cecum longitudinally to expose the inner mucosa. Cut into 0.5 cm sections and place in a 50 mL tube with 5 mL of HBSS with 2% FBS. Shake vigorously for 30 s, centrifuge at 450 x g for 20 s, then aspirate the supernatant.
2. Add 5 mL of HBSS with 2 mM EDTA. Incubate in a shaking incubator at 37 °C at 100 rpm for 15 min. Centrifuge at 450 x g for 20 s. Aspirate the supernatant.
3. Add 5 mL of HBSS. Shake vigorously for 30 s, centrifuge at 450 x g for 20 s, then aspirate the supernatant. Repeat once more.
4. Add 5 mL of collagenase buffer. Incubate in a shaking incubator at 37 °C for 30 min at 100 rpm. Shake vigorously every 10 min. Quench reaction with 2 mL of FBS.
5. Pour collagenase with cecum specimen over a 100 μm filter and mash with the soft end of a 3 mL plastic syringe. Wash filter with 20 mL of HBSS. Collect filtrate.
6. Centrifuge the filtrate at 450 x g for 5 min at 4 °C. Aspirate the supernatant. Resuspend pellet in 20 mL of bead buffer and pour over a 40 μm filter. Collect filtrate and count cells using a hemocytometer.
7. Centrifuge the filtrate at 450 x g for 5 min at 4 °C. Aspirate the supernatant. Resuspend in bead buffer at 6 x 10⁷ cells/mL for flow cytometry.

Access restricted. Please log in or start a trial to view this content.

Results

The Kit^V558Δ/+ mouse model allows for the investigation of therapeutics in an immunocompetent mouse model. Kit^V558Δ/+ mice have an average lifespan of 8 months due to progressive bowel obstruction (Figure 4). Tumors from Kit^V558Δ/+ mice express canonical markers of GIST including the tyrosine kinase KIT and the transmembrane channel DOG1 (Figure 5...

Access restricted. Please log in or start a trial to view this content.

Discussion

The Kit^V558Δ/+ mouse model is a powerful research tool in the molecular and immunologic analysis of GIST. Although the breeding strategy requires a single cross, using Kit^V558Δ/+ mouse cohorts in experiments analyzing tumor response requires extensive breeding. Mice should be age- and sex-matched to ensure similar tumor weights, and 10% of mice die before 8 weeks of age when tumors are established. Less extensive breeding strategies are possible if using advanced ima...

Access restricted. Please log in or start a trial to view this content.

Materials

Name	Company	Catalog Number	Comments
100 micron filter	EMSCO	1194-2360
1x RBC lysis buffer	Life Technologies	00-4333-57
3mL syringe	Thermo Fisher Scientific/BD Biosciences	14823435
4–15% Mini-PROTEAN TGX Precast Protein Gels, 10-well, 30 µl	Bio-Rad	4561083
4% Paraformaldehyde Solution	Thermo Fisher Scientific	AAJ19943K2
40 micron filter	EMSCO	1194-2340
5M NaCl	Sigma Aldrich	S6546
70 micron filter	EMSCO	1194-2350
AKT antibody (C67E7)	Cell Signaling	4691
C57BL/6J mice	The Jackson Laboratory
Collagenase IV	Sigma Aldrich	C5138
Complete mini edta free protease inhibitor	Thomas Scientific	C852A34
Countess II Automated Cell Counter	Thermo Fisher Scientific
Disposable Scalpels	Thermo Fisher Scientific/Exel International	14-840-00
Dnase I	Thomas Scientific	C756V81
Dog1 antibody	abcam	ab64085
EDTA	Sigma Aldrich	E9884
ERK antibody (p44/42)	Cell Signaling	9102
FBS	Thomas Scientific	C788U23
FIJI software	FIJI		https://imagej.net/software/fiji
Fisherbrand 850 Homogenizer	Thermo Fisher Scientific	15-340-169
HBSS	University of Pennsylvania Cell Center
Imatinib mesylate	Selleck Chemicals	S1026
KIT antibody (D13A2)	Cell Signaling	3074
KitV558Δ/+ Genotyping	Transnetyx
Microcentrifuge tubes (1.5mL)	Thermo Fisher Scientific	05-408-129
Mouse on Mouse Immunodetection Kit, Basic	Vector Laboratories	BMK-2202
Nitrocellulose Membrane, Precut, 0.45 µm	Rio-Rad	1620145
Nonfat Dry Milk	Thermo Fisher Scientific	NC9121673
Nonidet P 40 Substitute	Sigma Aldrich	74385
p-AKT antibody (S473)	Cell Signaling	4060
p-ERK antibody (p44/42)	Cell Signaling	9101
p-KIT antibody (Y719)	Cell Signaling	3391
PMSF Protease Inhibitor	Thermo Fisher Scientific	36978
Proeinase K	Thermo Fisher Scientific	BP170050
Round-Bottom Polystyrene Test (FACS) Tubes	Falcon/Thermo Fisher Scientific	14-959-2A
RPMI	University of Pennsylvania Cell Center
Sodium fluoride (NaF)	Sigma Aldrich	201154
Sodium orthovanadate (Na3VO4)	Sigma Aldrich	S6508
SuperSignal West Dura Extended Duration Substrate	Thermo Fisher Scientific	34076
TBS buffer (10x)	University of Pennsylvania Cell Center
Tissue culture dish (100mm2)	Thermo Fisher Scientific/Falcon	08-772E
TrisHCL	Thermo Fisher Scientific	BP1757500
Tween 20	Rio-Rad	1706531
vivaCT 80 platform	Scanco medical