The authors would like to thank Ekaterina V. Nikitina for kindly providing gDNA of EBV. Muhannad Ateiah, Maria Y. Berezovskaya, and Maria S. Rubel thank the Ministry of Education and Science of the Russian Federation (Grant No FSER-2022-0009) and the Priority 2030 program.

1. DNM design
<ol>
	<li>Select a unique region within the genome of interest. 
	NOTE: This work uses a region of the Epstein-Barr virus (EBV) genome in positions 13972-14154 (OR652423.1).</li>
	<li>Create a primer set for the amplification of the selected fragment, for example, via Primer3 tool embedded in Ugene26.</li>
	<li>Open the UNAFold web tool27 (see Table of Materials) and insert the selected region. Change&#160;the ...

Precision DNAzyme Nanomachines for Discriminative RNA and DNA Analysis

<ol>
	<li>Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolution+of+hybridization+probes+to+DNA+machines+and+robots.">Evolution of hybridization probes to DNA machines and robots.</a> Acc. Chem Res. 52, 1949-1956 (2019).</li><li>Guo, J., Ju, J., Turro, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescent+hybridization+probes+for+nucleic+acid+detection.">Fluorescent hybridization probes for nucleic acid detection.</a> Anal. Bioanal Chem. 402, 3115-3125 (2012).</li><li>Demidov, V. V., Frank-Kamenetskii, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+sides+of+the+coin:+affinity+and+specificity+of+nucleic+acid+interactions.">Two sides of the coin: affinity and specificity of nucleic acid interactions.</a> Tr Bioche Sc. 29 (2), 62-71 (2004).</li><li>Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Binary+probes+for+nucleic+acid+analysis.">Binary probes for nucleic acid analysis.</a> Chem Rev. 110, 4709-4723 (2010).</li><li>Marti, A. A., Jockusch, S., Stevens, N., Ju, J., Turro, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescent+hybridization+probes+for+sensitive+and+selective+DNA+and+RNA+detection.">Fluorescent hybridization probes for sensitive and selective DNA and RNA detection.</a> Acc Chem Res. 40 (6), 402-409 (2007).</li><li>Gerasimova, Y. V., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+bacterial+16S+rRNA+using+a+molecular+beacon-based+X+sensor.">Detection of bacterial 16S rRNA using a molecular beacon-based X sensor.</a> Biosens.Bioelectron. 41, 386-390 (2013).</li><li>Dark, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Accuracy+of+LightCycler+Septi+Fast+for+the+detection+and+identification+of+pathogens+in+the+blood+of+patients+with+suspected+sepsis:+a+systematic+review+and+meta-analysis.">Accuracy of LightCycler Septi Fast for the detection and identification of pathogens in the blood of patients with suspected sepsis: a systematic review and meta-analysis.</a> Intensive Care Med. 41, 21-33 (2015).</li><li>Maltzeva, Y. I., Gorbenko, D. A., Nikitina, E. V., Rubel, M. S., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visual+Detection+of+Stem-Loop+Primer+Amplification+(SPA)+products+without+denaturation+using+peroxidase-like+DNA+machines+(PxDM).">Visual Detection of Stem-Loop Primer Amplification (SPA) products without denaturation using peroxidase-like DNA machines (PxDM).</a> Int J Mol Sc. 24 (9), 7812 (2023).</li><li>Gorbenko, D. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+nanomachine+for+visual+detection+of+structured+RNA+and+double+stranded+DNA.">DNA nanomachine for visual detection of structured RNA and double stranded DNA.</a> Chem Comm. 58 (35), 5395-5398 (2022).</li><li>Roembke, B. T., Nakayama, S., Sintim, H. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleic+acid+detection+using+G-quadruplex+amplification+methodologies.">Nucleic acid detection using G-quadruplex amplification methodologies.</a> Methods. 64 (3), 185-198 (2013).</li><li>Mokany, E., Bone, S. M., Young, P. E., Doan, T. B., Todd, A. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MNAzymes,+a+versatile+new+class+of+nucleic+acid+enzymes+that+can+function+as+biosensors+and+molecular+switches.">MNAzymes, a versatile new class of nucleic acid enzymes that can function as biosensors and molecular switches.</a> JACS. 132 (3), 1051-1059 (2010).</li><li>Gerasimova, Y. V., Cornett, E., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+cleaving+deoxyribozyme+sensor+for+nucleic+acid+analysis:+the+limit+of+detection.">RNA cleaving deoxyribozyme sensor for nucleic acid analysis: the limit of detection.</a> Chem Bio Chem. 11, 811-817 (2010).</li><li>Gerasimova, Y. V., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Folding+16S+RNA+in+a+signal-producing+structure+for+detection+of+bacteria.">Folding 16S RNA in a signal-producing structure for detection of bacteria.</a> Angew Chem Int Ed. 52, 10586-10588 (2013).</li><li>Hu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allosteric+DNAzyme-based+encoder+for+molecular+information+transfer.">Allosteric DNAzyme-based encoder for molecular information transfer.</a> Chin. Chem Let. , 109232 (2023).</li><li>Peeters, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solid-phase+PCR-amplified+DNAzyme+activity+for+real-time+FO-SPR+detection+of+the+MCR-2+gene.">Solid-phase PCR-amplified DNAzyme activity for real-time FO-SPR detection of the MCR-2 gene.</a> Anal Chem. 92 (15), 10783-10791 (2020).</li><li>Wood, H. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Species+typing+of+nontuberculous+Mycobacteria+by+use+of+deoxyribozyme+sensors.">Species typing of nontuberculous Mycobacteria by use of deoxyribozyme sensors.</a> Clin Chem. 65 (2), 333-341 (2019).</li><li>Yan, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultralow+background+one-pot+detection+of+Lead+(II)+using+a+non-enzymatic+double-cycle+system+mediated+by+a+hairpin-involved+DNAzyme.">Ultralow background one-pot detection of Lead (II) using a non-enzymatic double-cycle system mediated by a hairpin-involved DNAzyme.</a> Biosen Bioelectron. 237, 115534 (2023).</li><li>Hasick, N. J., Radhika, R., Todd, A. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Subzymes:+Regulating+DNAzymes+for+point+of+care+nucleic+acid+sensing.">Subzymes: Regulating DNAzymes for point of care nucleic acid sensing.</a> Sens. Act. B: Chem. 297, 126704 (2019).</li><li>Safdar, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-only,+microwell-based+bioassay+for+multiplex+nucleic+acid+detection+with+single+base-pair+resolution+using+MNAzymes.">DNA-only, microwell-based bioassay for multiplex nucleic acid detection with single base-pair resolution using MNAzymes.</a> Biosen Bioelectron. 152, 112017 (2020).</li><li>Cox, A. J., Bengtson, H. N., Gerasimova, Y. V., Rohde, K. H., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+antenna+tile-associated+deoxyribozyme+sensor+with+improved+sensitivity.">DNA antenna tile-associated deoxyribozyme sensor with improved sensitivity.</a> Chem Bio Chem. 17 (21), 2038-2041 (2016).</li><li>Lyalina, T. A., Goncharova, E. A., Prokofeva, N. Y., Voroshilina, E. S., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+DNA+minimachine+for+selective+and+sensitive+detection+of+DNA.">A DNA minimachine for selective and sensitive detection of DNA.</a> Analyst. 144 (2), 416-420 (2019).</li><li>Ateiah, M., Gandalipov, E. R., Rubel, A. A., Rubel, M. S., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+Nanomachine+(DNM)+Biplex+Assay+for+Differentiating+Bacillus+cereus+Species.">DNA Nanomachine (DNM) Biplex Assay for Differentiating Bacillus cereus Species.</a> Int J Mol Sc. 24 (5), 4473 (2023).</li><li>El-Deeb, A. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Toward+a+home+test+for+COVID-19+diagnosis:+DNA+machine+for+amplification-free+SARS-CoV-2+detection+in+clinical+samples.">Toward a home test for COVID-19 diagnosis: DNA machine for amplification-free SARS-CoV-2 detection in clinical samples.</a> Chem Med Chem. 17 (20), 202200382 (2022).</li><li>Kirichenko, A., Bryushkova, E., Dedkov, V., Dolgova, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Novel+DNAzyme-based+fluorescent+biosensor+for+detection+of+RNA-containing+Nipah+henipavirus.">A Novel DNAzyme-based fluorescent biosensor for detection of RNA-containing Nipah henipavirus.</a> Biosensors. 13 (2), 252 (2023).</li><li>Akhmetova, M. M., Rubel, M. S., Afanasenko, O. S., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Barley+haplotyping+using+biplex+deoxyribozyme+nanomachine.">Barley haplotyping using biplex deoxyribozyme nanomachine.</a> Sens Act Rep. 4, 100132 (2022).</li><li>Okonechnikov, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unipro+UGENE:+a+unified+bioinformatics+toolkit.">Unipro UGENE: a unified bioinformatics toolkit.</a> Bioinformatics. 28, 1166-1167 (2012).</li><li>Zuker, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mfold+web+server+for+nucleic+acid+folding+and+hybridization+prediction.">Mfold web server for nucleic acid folding and hybridization prediction.</a> Nucleic Acids Res. 31 (13), 3406-3415 (2003).</li><li>Markham, N. R., Zuker, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DINAMelt+web+server+for+nucleic+acid+melting+prediction.">DINAMelt web server for nucleic acid melting prediction.</a> Nucleic Acids Res. 33, W577-W581 (2005).</li><li>Stancescu, M., Fedotova, T. A., Hooyberghs, J., Balaeff, A., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonequilibrium+hybridization+enables+discrimination+of+a+point+mutation+within+5-40+C.">Nonequilibrium hybridization enables discrimination of a point mutation within 5-40 C.</a> JACS. 138 (41), 13465-13468 (2016).</li><li>Dong, J., Ouyang, Y., Wang, J., O'Hagan, M. P., Willner, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assembly+of+dynamic+gated+and+cascaded+transient+DNAzyme+networks.">Assembly of dynamic gated and cascaded transient DNAzyme networks.</a> ACS Nano. 16 (4), 6153-6164 (2022).</li><li>Montserrat Pag&#232;s, A., Hertog, M., Nicola&#239;, B., Spasic, D., Lammertyn, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unraveling+the+kinetics+of+the+10-23+RNA-cleaving+DNAzyme.">Unraveling the kinetics of the 10-23 RNA-cleaving DNAzyme.</a> Int J Mol Sc. 24 (18), 13686 (2023).</li><li>Nguyen, C., Grimes, J., Gerasimova, Y. V., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular-beacon-based+tricomponent+probe+for+SNP+analysis+in+folded+nucleic+acids.">Molecular-beacon-based tricomponent probe for SNP analysis in folded nucleic acids.</a> Chem-eur J. 17 (46), 13052-13058 (2011).</li><li>MacDougall, D., Crummett, W. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Guidelines+for+data+acquisition+and+data+quality+evaluation+in+environmental+chemistry.">Guidelines for data acquisition and data quality evaluation in environmental chemistry.</a> Anal Chem. 52 (14), 2242-2249 (1980).</li><li>Gerasimova, Y. V., Yakovchuk, P., Dedkova, L. M., Hecht, S. M., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expedited+quantification+of+genetically+modified+ribosomal+RNA+by+binary+deoxyribozyme+sensors.">Expedited quantification of genetically modified ribosomal RNA by binary deoxyribozyme sensors.</a> RNA. 10, 1834-1843 (2015).</li><li>Gerasimova, Y. V., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Folding+16S+RNA+in+a+signal-producing+structure+for+detection+of+bacteria.">Folding 16S RNA in a signal-producing structure for detection of bacteria.</a> Angew Chem Int Ed. 52, 10586-10588 (2013).</li><li>. GC Content Calculator Available from: <a target="_blank" href="https://www.biologicscorp.com/tools/GCContent/#.ZEfxPiyOHYU">https://www.biologicscorp.com/tools/GCContent/#.ZEfxPiyOHYU</a> (2023)</li><li>Hussein, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNAzyme+nanomachine+with+fluorogenic+substrate+delivery+function:+advancing+sensitivity+in+nucleic+acid+detection.">DNAzyme nanomachine with fluorogenic substrate delivery function: advancing sensitivity in nucleic acid detection.</a> Anal Chem. 95 (51), 18667-18672 (2023).</li><li>Safdar, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-only,+microwell-based+bioassay+for+multiplex+nucleic+acid+detection+with+single+base-pair+resolution+using+MNAzymes.">DNA-only, microwell-based bioassay for multiplex nucleic acid detection with single base-pair resolution using MNAzymes.</a> Biosen Bioelectron. 152, 112017 (2020).</li><li>Gerasimova, Y. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deoxyribozyme+cascade+for+visual+detection+of+bacterial+RNA.">Deoxyribozyme cascade for visual detection of bacterial RNA.</a> Chem Bio Chem. 14, 2087-2090 (2013).</li><li>Eckert, K. A., Kunkel, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+polymerase+fidelity+and+the+polymerase+chain+reaction.">DNA polymerase fidelity and the polymerase chain reaction.</a> Gen Res. 1 (1), 17-24 (1991).</li><li>Pandya, K., Jagani, D., Singh, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas+systems:+Programmable+nuclease+revolutionizing+the+molecular+diagnosis.">CRISPR-Cas systems: Programmable nuclease revolutionizing the molecular diagnosis.</a> Mol Biotech. , (2023).</li></ol>

The design of DNA machines is straightforward but requires some experience in designing&#160;hybridization probes or functional DNA nanostructures. It is appropriate to keep the analyte fragment as short as possible to diminish the number of possible secondary structures and simplify DNM invasion to the secondary structure. The CG content should preferably be below 60% to avoid stable intramolecular structures. Successful assembly of the DNM is achieved at slow cooling rates. In some cases, DNMs can be spontaneously asse...

One of the earliest methods for&#160;nucleic acid detection is&#160;complementary binding of selective oligonucleotides to the analyzed RNA or DNA sequences. This method employs nucleic acid fragments (probes) that can form Watson-Crick base pairs with a targeted DNA or RNA analyte1. The complex is then differentiated from the analyte and the unbound probe by a variety of techniques. Certain methods, such as Northern blotting, in situ hybridization, or qPCR, are based on the&#160;phenomenon&#160;of complementary binding2. The most common hybridization probes have two significant drawbacks: low sensitivity (they can reach micromolar to nanomolar levels) as well as low selectivity to single nucleotide variations (SNV), including point mutations. The issue requires a sophisticated approach since the solutions to these drawbacks conflict with each other3. To provide the best selectivity, the detecting oligonucleotide should be kept short enough to form unstable hybrids with mismatched analytes. Such short oligonucleotides are not able to bind targeted nucleic acids tightly and unwind their secondary structures, thus often failing to provide a detectable signal. It is especially challenging to detect CG-rich fragments in biological RNA, or double-stranded DNA (dsDNA). On the other hand, long probes are insensitive to SNV3. To break the deadlock, the concept of a binary probe has been&#160;developed4.
Binary sensors split a single detection probe into two pieces and specialize its fragments, keeping one of them long to unwind the hairpins or invade the dsDNA. The second binary probe fragment remains short to be sensitive to a mismatched base, thus providing a means for detecting SNV. The signal will be produced if the two binary sensor parts are joined together4. The full complex can be visualized via FRET5, molecular beacon probe6,7, or G-quadruplexes with peroxidase-like activity8,9,10, or else RNA-cleaving11,12,13 DNAzyme. Binary sensors with a 10-23 DNAzyme core have been amply described. They have been adapted to detect single-stranded nucleic acid fragments&#160;created synthetically11, or single-stranded amplification products14,15. Detection without amplification is also possible, for example, in the case of 16S rRNA extracted from a cell culture, since this molecule is abundant in cells12,16. Binary sensors with a 10-23 DNAzyme core can also be adapted for non-nucleic acid detection, such as for lead ions17. Nevertheless, low sensitivity is still considered to be one of the major drawbacks of binary 10-23 DNAzyme sensors, and&#160;various approaches, including cascades18 or alternative signal-enhancing methods19, have been developed to address this issue. Unfortunately, the above techniques drastically increase the cost and instability of the sensor components, and so they have not come into practice.
The experiment described in this work uses 10-23 DNAzyme-based DNA-nanosensors referred to as DNA-nanomachines (DNM)20,21. These structures include binary sensors and also&#160;(1) DNA facilitators flanking the binary probe,&#160;unwinding the structured regions and&#160;invading into double-stranded DNAs, and (2) a DNA tile that holds all the DNM parts together in close proximity and increases the chances of signal formation (Figure 1). Altogether, the 10-23 DNAzyme-based DNMs decrease the limit of detection (LOD) down to the picomolar range21; they can be used to detect 16rRNA in cell lysates22 or report the presence of viral RNA without amplification23,24. At the same time, the DNMs remain sensitive to the SNV and can even be used to genotype alleles in heterozygous organisms25. The DNM method can be used as a complementary technique to any amplification type for product visualization or identification of the product in a complex mixture with high selectivity. The DNMs, unlike conventional TaqMan and beacon probes, do not require heating of the sample and so can be used in end-point detection protocols, making the overall detection cost-effective.
This article describes the in silico development of a DNM and demonstrates procedures for assembly and functional characterization of DNM. The work was performed using a synthetic fragment of Epstein-Barr virus (EBV) corresponding to the positions 13972-14154 of the viral DNA (OR652423.1) (see Table of materials).

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>1.5 mL tube</td>
			<td>Biofil</td>
			<td>CFT011015</td>
			<td></td>
		</tr>
		<tr>
			<td>100 bp+ DNA Ladder</td>
			<td>Evrogen</td>
			<td>NL002</td>
			<td></td>
		</tr>
		<tr>
			<td>100-1000 &#181;L pipette</td>
			<td>Kirgen</td>
			<td>KG-Pro1000</td>
			<td></td>
		</tr>
		<tr>
			<td>10-100 &#181;L pipette</td>
			<td>Kirgen</td>
			<td>KG-Pro100</td>
			<td></td>
		</tr>
		<tr>
			<td>1-10 &#181;L pipette</td>
			<td>Kirgen</td>
			<td>KG-Pro10</td>
			<td></td>
		</tr>
		<tr>
			<td>20-200 &#181;L pipette</td>
			<td>Kirgen</td>
			<td>KG-Pro200</td>
			<td></td>
		</tr>
		<tr>
			<td>2-20 &#181;L pipette</td>
			<td>Kirgen</td>
			<td>KG-Pro20</td>
			<td></td>
		</tr>
		<tr>
			<td>4x Gel Loading Dye</td>
			<td>Evrogen</td>
			<td>PB020</td>
			<td></td>
		</tr>
		<tr>
			<td>Acrylamide 4K</td>
			<td>AppliChem</td>
			<td>A1090,0500</td>
			<td></td>
		</tr>
		<tr>
			<td>Ammonium persulfate</td>
			<td>Carl Roth</td>
			<td>2809447</td>
			<td></td>
		</tr>
		<tr>
			<td>Biorender</td>
			<td>Biorender</td>
			<td></td>
			<td>https://www.biorender.com</td>
		</tr>
		<tr>
			<td>Bisacrylamide</td>
			<td>Molekula</td>
			<td>22797959</td>
			<td></td>
		</tr>
		<tr>
			<td>Boric Acid</td>
			<td>TechSnab</td>
			<td>H-0202</td>
			<td></td>
		</tr>
		<tr>
			<td>ChemiDoc imaging system</td>
			<td>BioRad</td>
			<td>12003153</td>
			<td></td>
		</tr>
		<tr>
			<td>Costar 96-Well Black Polystyrene Plate</td>
			<td>Corning</td>
			<td>COS3915</td>
			<td></td>
		</tr>
		<tr>
			<td>DinaMelt</td>
			<td>RNA Institute</td>
			<td></td>
			<td>http://www.unafold.org/Dinamelt/applications/two-state-melting-hybridization.php</td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>Amresco</td>
			<td>Am-O105</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethidium bromide</td>
			<td>BioLabMix</td>
			<td>EtBr-10</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Amresco</td>
			<td>Am-O485</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnesium chloride</td>
			<td>AppliChem</td>
			<td>131396</td>
			<td></td>
		</tr>
		<tr>
			<td>Mini Protean Tetra Cell</td>
			<td>BioRad</td>
			<td>1658001EDU</td>
			<td></td>
		</tr>
		<tr>
			<td>pipette 10 &#181;L tips</td>
			<td>Kirgen</td>
			<td>KG1111-L</td>
			<td></td>
		</tr>
		<tr>
			<td>pipette 1000 &#181;L tips</td>
			<td>Kirgen</td>
			<td>KG1636</td>
			<td></td>
		</tr>
		<tr>
			<td>pipette 200 &#181;L tips</td>
			<td>Kirgen</td>
			<td>KG1212-L</td>
			<td></td>
		</tr>
		<tr>
			<td>Pixelmator Pro</td>
			<td>Pixelmator Team</td>
			<td></td>
			<td>https://www.pixelmator.com/pro/</td>
		</tr>
		<tr>
			<td>Potassium chloride</td>
			<td>Carl Roth</td>
			<td>1782751</td>
			<td></td>
		</tr>
		<tr>
			<td>PowerPac Basic Power Supply</td>
			<td>BioRad</td>
			<td>1645050</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAse/DNAse free water</td>
			<td>Invitrogen</td>
			<td>10977049</td>
			<td></td>
		</tr>
		<tr>
			<td>Sealing film for PCR plates</td>
			<td>Sovtech</td>
			<td>P-502</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium chloride</td>
			<td>Vekton</td>
			<td>HCh (0,1)</td>
			<td></td>
		</tr>
		<tr>
			<td>Spark multimode microplate reader</td>
			<td>Tecan</td>
			<td>Spark- 10M</td>
			<td></td>
		</tr>
		<tr>
			<td>T100 amplificator</td>
			<td>BioRad</td>
			<td>10014822</td>
			<td></td>
		</tr>
		<tr>
			<td>TEMED</td>
			<td>Molekula</td>
			<td>68604730</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris(hydroxymethyl)aminomethane</td>
			<td>Amresco</td>
			<td>Am-O497</td>
			<td></td>
		</tr>
		<tr>
			<td>UNAFold</td>
			<td>RNA Institute</td>
			<td></td>
			<td>http://www.unafold.org/mfold/applications/dna-folding-form.php</td>
		</tr>
		<tr>
			<td>Water bath</td>
			<td>LOIP</td>
			<td>LB-140</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligos used</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Analyte:</td>
			<td rowspan="2">Evrogen</td>
			<td rowspan="2"></td>
			<td rowspan="2">direct order, standard desalting purification</td>
		</tr>
		<tr>
			<td>GAGCACTTGGTCAGGCACACGG 
			ACAGGGTCAGCGGAGGACGCG 
			TGGCACAGCAGCCCGGGGTAG 
			GTCCCCTGGACCTGCCGCTGG 
			CGGACTACGCCTTCGTTGC</td>
		</tr>
		<tr>
			<td>Tile-Arm3:</td>
			<td rowspan="2">Evrogen</td>
			<td rowspan="2"></td>
			<td rowspan="2">direct order, standard desalting purification</td>
		</tr>
		<tr>
			<td>CCG GGCTGCTGTGCCATTTT 
			TTGCTGACTACTGTCACCTCT 
			CTGCTAGTCT</td>
		</tr>
		<tr>
			<td>Dzb-Tile: AGACTAGCAGAGAGGTGACAG 
			TAGTCAGCTTTTTTCGCGTCCTC 
			CGCTGACCACAACGAGAGGAA 
			ACCTT</td>
			<td>Evrogen</td>
			<td></td>
			<td>direct order, standard desalting purification</td>
		</tr>
		<tr>
			<td>Dza: TGCCCAGGGAGGCTAGCTCT 
			GTCCGTGTGCCTGACCA</td>
			<td>Evrogen</td>
			<td></td>
			<td>direct order, standard desalting purification</td>
		</tr>
		<tr>
			<td>F-sub oligonucleotide: AAGGTT(FAM)TCCTCrGrU 
			CCCTGGGCA-BHQ1</td>
			<td>DNA-Syntez</td>
			<td></td>
			<td>direct order, HPLC purification</td>
		</tr>
	</tbody>
</table>

dnazyme 10-23 - based nanomachines for nucleic acid recognition

DNAzyme-based nanomachines (DNM) for the detection of DNA and RNA sequences (analytes) are multifunctional structures made of oligonucleotides. Their functions include tight analyte binding, highly selective analyte recognition, fluorescent signal amplification by multiple catalytic cleavages of a fluorogenic reporter substrate, and fluorogenic substrate attraction for an increase in sensor response. Functional units are attached to a common DNA scaffold for their cooperative action. The RNA-cleaving 10-23 DNMs feature&#160;improved sensitivity in comparison with non-catalytic hybridization probes. The stability of the DNM and the increased chances of substrate recognition are provided&#160;by a double-stranded DNA fragment,&#160;a tile. DNM can differentiate two analytes with a single nucleotide difference in a folded RNA and a double-stranded DNA and detect analytes at concentrations ~1000 times lower than other protein-free hybridization probes. This article presents the concept behind the diagnostic potential of DNA-nanomachine activity and overviews DNM design, assembly, and application&#160;in nucleic acid detection assays.

Author Spotlight: Advancements in DNA Nanosensors &amp;#8211; Addressing Sensitivity and Selectivity Challenges in Molecular Detection

DNAzyme 10-23 - Based Nanomachines for Nucleic Acid Recognition

The biggest breakthrough our lab made in the field of hybridization probe was made in 2007 by Dmitry Kolpashchikov, who suggested an ADL splitting hybridization probes in halves assessing each of the half its own function, for example, increasing selectivity to mismatches and single nucleotide variations along to unwinding complex probes. The second breakthrough was made a decade later when it was suggested to add additional multi component binding arms. Along with the Unitan platform.Such designs were able to work even with complex targets, for example, double stranded nucleic acids, and highly structured nucleic acids. The biggest challenges our lab faces right now are coming from the problem of low sensitivity of DNA nano sensors in comparison to conventional amplification techniques. By now, the DNA nano sensors in amplification free assay presents low selectivity, and we are trying to overcome this problem with new molecular designs and new ways of DNA nano sensor detection.The main advantages of our DNA sensors are their sensitivity in terms of low detected concentration of the analyte and selectivity. For example, their ability to detect single nucleotide polymorphism Also as an advantage compared to other diagnostics techniques. Our DNA sensors are able to unwind and detect complex RNA structures and double stranded DNA.The new scientific question, our results have paved the way for is, is it possible to find double stranded DNA using protein free hybridization props? The protein independent prop could be easily accessible by automated DNA synthesis, easier to be delivered in cells and be compatible with chemical modification and complex nano structures developed by DNA nanotechnology combined with DNA enzymes such as Dnase lipids and DNA enzymes. Such a prop could become a basis for protein free nucleases a useful tool for gene editing and therapy.

The aim of the first experiment was to show the assembly of the DNM before&#160;the synthetic fragment of the analyte. All the constituent DNM strands were added to the reaction buffer and assembled in the beaker. The assembled DNM complex was assessed for its correct size and homogeneity by native PAGE. Native PAGE shows the assembled DNM with the analyte in lane 1 and two DNM strands in lanes 2 and 4. If the DNA nanomachine were&#160;not assembled, 2 or 3 separate bands would be visible instead of a single low-mobility...

Read this Scientific Article Protocol about DNAzyme 10-23 - Based Nanomachines for Nucleic Acid Recognition at JoVE.com

The DNAzyme-based nanomachines can be used for highly selective and sensitive detection of nucleic acids. This article describes a detailed protocol for the design of DNAzyme-based nanomachines with a 10-23 core using free software and their application in the detection of an Epstein-Barr virus fragment as an example.

DNAzyme-based nanomachines (DNM) for the detection of DNA and RNA sequences (analytes) are multifunctional structures made of oligonucleotides. Their ...

dnazyme-10-23-based-nanomachines-for-nucleic-acid-recognition