Yazarlar Corus, MedSys Hücre Girişi, ZİNCİR ve Resina projeleri finanse edilmektedir.

Protokol Şekil &#39;de özetlenmiştir. 4. 1. Kan numuneleri <ol><li> Klinik yerinde EDTA tüpleri içinde en azından 3 ml kan toplanır. </li><li> Numuneler 4 ° C&#39;de bir haftaya kadar saklanabilir </li><li> Normal posta ile kısa sürede laboratuvara mümkün EDTA-kan örnekleri gönderin. </li></ol> 2. HIV RNA ve / veya DNA izolasyonu <ol><li> MagNA Pure Compact Nükleik Asit İzolasyon Ben kiti ve MagNA Pure Kompakt Sistem kullanarak, 1000 ul tam kan, serum veya plazma viral RNA ve / veya DNA edinin. </li><li> 50 ul TE tamponunda elde RNA veya DNA Zehir. Alternatif olarak, diğer nükleik asit saflaştırma prosedürleri kullanılabilir. </li></ol> 3. Env bölgenin Amplifikasyon Plazma RNA ya da DNA ya da proviral gelen env bölgesi (Şekil 2 ve 4) yükseltin. Env proteini çoğunluğunu kapsayan bir 1245 bp uzunluğunda bir ürün (nt 6556-7811 accordinHXB2 g) oluşturulur. <ol><li> RNA örnekleri: RT-PCR tepkimesinde <ol><li> Viral RNA&#39;nın RT reaksiyonu engelleyebilir çok karmaşık bir ikincil yapı (Şekil 4) sunuyor. Bu sorunu önlemek için, 10 dakika (önceden PCR tüp içinde ve PCR makine) için 65 ° C &#39;de 10 ul RNA inkübe edilir ve daha sonra da 50 ° C&#39; ye sıcaklığını düşürmek </li><li> Primerler Env-F ve Env-R içeren PCR ana karışımı 40 ul ekle. -House-Sistemi RT-PCR Master Mix: <table border="1"><tbody><tr><td></td><td> hacim / reaksiyon (ul) </td><td> nihai konsantrasyon </td></tr><tr><td> RNase içermeyen H2O </td><td> 14.4 </td><td></td></tr><tr><td> 5x Buffer (Qiagen OneStep RT-PCR Kit) </td><td> 10 </td><td> 1x </td></tr><tr><td> 5x Q-Çözüm </td><td> 10 </td><td> 1x </td></tr><tr><td> dNTP Mix (10 mM her biri) </td> &lt;td&gt; 2 </td><td> Her bir dNTP 400 uM </td></tr><tr><td> Enzim-Mix (Qiagen OneStep RT-PCR Kit) </td><td> 2 </td><td></td></tr><tr><td> Primer Env-F (100 uM) </td><td> 0.3 </td><td> 0.6 uM </td></tr><tr><td> Primer Env-R (100 uM) </td><td> 0.3 </td><td> 0.6 uM </td></tr><tr><td> RNaz İnhibitör (RNasin) </td><td> 1 </td><td> 5 adet / reaksiyon </td></tr></tbody></table> Env-F: 5&#39;-CAAAGCCTAAAGCCATGTGTAAA -3 &#39;(nt 6556 → 6586 HXB2 göre) Env-R: 5&#39;-AGTGCTTCCTGCTGCTCCTAAGAACCC -3 &#39;(← 7811 nt 7785) </li><li> 30 dakika için 50 ° C&#39;da RT reaksiyon çalıştırın. </li><li> Aşağıdaki gibi ilk PCR: <table border="1"><tbody><tr><td> 95 ° C, 15 dakika </td><td> 1 x </td></tr><tr><td> 95 ° C, 30 saniye 50 ° C, 30 saniye 72 ° C, 2 dakika </td&gt; <td> 1 x </td></tr><tr><td> 95 ° C, 30 saniye 56 ° C, 30 saniye 72 ° C, 2 dakika </td><td> 38 x </td></tr><tr><td> 72 ° C, 10 dak 4 ° C ∞ </td><td></td></tr></tbody></table></li></ol></li><li> DNA örnekleri: PCR reaksiyonu Proviral DNA örnekleri için, başlangıçta herhangi bir RT reaksiyonu tabi ve PCR reaksiyonu doğrudan başlayabilirsiniz. <ol><li> Provial DNA&#39;nın 10 ul PCR Master Mix 40 ul ekleyin. -House-Sistemi PCR Master Mix: <table border="1"><tbody><tr><td></td><td> hacim / reaksiyon (ul) </td><td> nihai konsantrasyon </td></tr><tr><td> RNase içermeyen H2O </td><td> 15.4 </td><td></td></tr><tr><td> 5x Buffer (HotStarTaq DNA Polimeraz) </td><td> 10 </td><td> 1x </td></tr><tr><td> 5x Q-Çözüm </td><td> 10 </td><td> 1x </td></tr><tr><td> dNTP Mix (10 mM her biri) </td><td> 2 </td><td> Her bir dNTP 400 uM </td></tr><tr><td> Enzim-Mix (HotStarTaq DNA Polimeraz) </td><td> 2 </td><td></td></tr><tr><td> Primer Env-F (100 uM) </td><td> 0.3 </td><td> 0.6 uM </td></tr><tr><td> Primer Env-R (100 uM) </td><td> 0.3 </td><td> 0.6 uM </td></tr></tbody></table> Env-F: 5&#39;-CAAAGCCTAAAGCCATGTGTAAA -3 &#39;(→ 6586 nt 6556) Env-R: 5&#39;-AGTGCTTCCTGCTGCTCCTAAGAACCC -3 &#39;(← 7811 nt 7785) </li><li> Daha önce RNA örnekleri (Adım 3.1.4) için tarif edildiği gibi PCR koşulları çalıştırın. </li></ol></li></ol> 4. V3 bölgenin Amplifikasyon: nested PCR <ol><li> Nested PCR için şablon olarak ilk PCR reaksiyonu (agaroz jel önceki analizi olmadan) 5 ul kullanın ve PCR Mas 95 ul ekleyinter karıştırın. İç içe-In-House PCR Master Mix <table border="1"><tbody><tr><td></td><td> hacim / reaksiyon (ul) </td><td> nihai konsantrasyon </td></tr><tr><td> H2O </td><td> 61.9 </td><td></td></tr><tr><td> 10x PCR Tamponu </td><td> 10 </td><td> 1x </td></tr><tr><td> 5x Q-Çözüm </td><td> 20 </td><td> 1x </td></tr><tr><td> dNTP Mix (10 mM her biri) </td><td> 2 </td><td> Her bir dNTP 200 uM </td></tr><tr><td> Primer Env-2F (100 uM) </td><td> 0.3 </td><td> 0.6 uM </td></tr><tr><td> Primer Env-2R (100 uM) </td><td> 0.3 </td><td> 0.6 uM </td></tr><tr><td> HotStarTaq DNA Polimeraz </td><td> 0.5 </td><td> 2,5 ünite / reaksiyon </td></tr></tbody></table> Env-2F: 5&#39;-GTCCAAAGGTATCCTTTGAGCCAATTC -3 &#39;(nt 6838 → 6864) <strong&gt; Env-2R: 5&#39;-CACCACTCTTCTCTTTGCCTTGGTGGGTGC -3 &#39;(← 7742 nt 7712) </li><li> Aşağıdaki gibi PCR: <table border="0"><tbody><tr><td> 93 ° C, 15 dakika </td><td> 1 x </td></tr><tr><td> 95 ° C, 30 saniye 50 ° C, 30 saniye 72 ° C, 90 saniye </td><td> 1 x </td></tr><tr><td> 95 ° C, 30 saniye 56 ° C, 30 saniye 72 ° C, 90 saniye </td><td> 43 x </td></tr><tr><td> 72 ° C, 10 dak 4 ° C ∞ </td><td></td></tr></tbody></table></li><li> Bir% 1 agaroz jeli (Şek. 4) PCR ürünü analiz edin. Beklenen ürün 902 bp-uzun. </li><li> Sıralama örnekleri saflaştırılması. <ol><li> Tedarikçi tarafından sağlanan protokolü, çözümler ve mikro-kolon kullanarak Qiagen PCR Arıtma kiti ile PCR ürünü arındırın. Bant yoğunluğuna bağlı olarak, 30-100 ul PE tampon Zehir. </li><li> Alternatif olarak, numune eksonükleaz ile daha da arıtılabilirBen ve Hızlı AP (Termo alkalen fosfataz). Bu amaç için, 15 ul PCR ürünü ile 6 ul Exo-AP karışımı ekleyin ve 37 dakika 15 ° C&#39;de inkübe <table border="1"><tbody><tr><td> 580 ul H 2 O </td></tr><tr><td> 66 ul hızlı AP </td></tr><tr><td> 13.4 ul Exo I </td></tr></tbody></table></li></ol></li></ol> 5. V3 Amplikon sekans reaksiyonu <ol><li> Sıra reaksiyon, aşağıdaki primerler yalnızca biri kullanılarak bir PCR reaksiyonu oluşur: Env-2: 5&#39;-GTACAATGYACACATGGAATTAGGC -3 (→ 6980 nt 6959) Env-5: 5&#39;-AAAATTCCCCTCCACAATTA - 3 &#39;(nt 7352 ← 7371) Env-6: 5&#39;-GGCCAGTAGTATCAACTCAAC - 3 &#39;(nt 6979 → 7000) Env-7: 5&#39;-TGTCCACTGATGGGAGGGGC - 3 &#39;(nt 7530 ← 7549) Env-10: 5 &#39;- GCAGAATAAAACAAATTATAAACATGTGGC - 3&#39; (nt 7478 ← 7507) Env-11: 5 &#39;- TACATTGCTTTTCCTACTTTCTGCCAC - 3&#39; (nt 7638 ← 7664) İlk tercih primerler şunlardır: Env-2, Env-6 veya Env-7, Env-11 </li><li> Şablon olarak saflaştırılmış V3 Amplikon 1 ul kullanın ve PCR master mix 9 ul ekleyin. Master Mix Sıralama: <table border="1"><tbody><tr><td> 4 ul dizisi karışımı (HIV-Genotiplendirme Takımı) </td></tr><tr><td> 4 ul H 2 O </td></tr><tr><td> 1 ul Astar (100 pmol / ul) </td></tr></tbody></table></li><li> Aşağıdaki gibi dizi tepkime çalıştırın: <table border="0"><tbody><tr><td> 96 ° C, 10 saniye </td><td></td></tr><tr><td> 50 ° C, 10 saniye </td><td> 36 x </td></tr><tr><td> 60 ° C, 45 saniye </td><td></td></tr><tr><td> 4 ° C ∞ </td><td></td></tr></tbody></table></li></ol> 6. Dizi analizi örnekleri saflaştırılması Dizileri USI Purifyng Sephadex G-50 ince. <ol><li> Sephadex G-50 ince olan &quot;sütununda loader&quot; kuyuların uygun sayıda doldurun. Çevirerek filtre plakası MAHVN4510 için Sephadex aktarın. </li><li> Filtre plakası içinde her bir oyuğa 300 ul Milli-Q H2O ekleyin ve en azından 2-8 3h için inkübe ° C </li><li> 910Xg ve 4-15 ° C sıcaklıkta 5 dk için levha santrifüje Flow-through atın. </li><li> Sıra ürün ve sonra şişmiş Sephadex plaka üzerinde pipeti sıra ile 10 ul H2O ekleyin. </li><li> Arıtılmış ürün elde etmek için, 5 dakika boyunca plaka santrifüj. 910Xg ve 4-15 ° C ve akan toplamak. </li></ol> 7. Sequencer ABI Prism 3130 XL saflaştırılmış örnekleri Sıralama <ol><li> Her çalışma öncesinde, tampon değiştirmek ve polimer (POP7) hacmini kontrol edin. Gerekirse, yeni bir ile eski polimer şişeyi değiştirin. </li><li> 18 saniyelik bir enjeksiyon süresi de dahil olmak üzere kaydedilen çalışma koşulları, kullanın. </li><li> Bu makine, 16 dizisi örnekleri ile bir run sinyal verilerinin toplanması yaklaşık 60 dk (36 cm kapiller) veya 150 dakika (50 cm kapiller) alır. </li></ol> 8. Sıra düzenleme <ol><li> Dizileri (Şekil 5) hizalamak ve düzenlemek için program Lasergene (DNA-Yıldız) kullanın. Diğer dizi düzenleme programları da kullanılabilir. Bir &quot;V3-Konsensus B&quot; ve referans olarak env uzlaşma dizisi kullanın. </li><li> Lasergene mevcut ve FASTA dosyası olarak depolamak tüm ham veriler kullanılarak analiz örnek bir konsensüs dizisini oluşturur. FASTA dosya örnek adını ve nükleotid sekansı içeren bir başlık, bir metin dosyası. </li></ol> 9. Veri yorumlama ve tropizm tahmin Dizileme <ol><li> Verileri yorumlama Sıralama web tabanlı yorumlama sistemi tarafından gerçekleştirilir geno2pheno [coreceptor] ( <a href="http://coreceptor.bioinf.mpi-inf.mpg.de/index.php">http://coreceptor.bioinf.mpi-inf.mpg.de/</a>index.php). Tropizm tahmin için, farklı FPR ayarlar seçilebilir. Varsayılan ayar Alman-Avusturya tedavisi kurallarına göre yapılır. FPR ≥% 20 için, virüs R5 olarak sınıflandırılır zaman FPR ≥ 20 ve% FPR &lt;% 12.5 için X4. </li><li> Sunucuya FASTA dosya yükleyin. Bu sunucu, amino asitler haline nükleotid sekansı tercüme V3-Konsensüs dizisi B ile hizalanır ve bir alt sınıflandırma üretir. Buna ek olarak, yanlış pozitif oran (FPR) olarak ifade edilir (Şek. 4) coreceptor bir kullanım tahmin oluşturur. </li></ol> 10. Temsilcisi Sonuçlar Geno2pheno [coreceptor] çıkış tropizm bir kademeli yorumunu gösterir. Coreceptor kullanımı olasılığını bağlı olarak yorumlanması metin ve arka plan rengini olası bir, düşük riskli düşündüren ve nihayet kırmızı, sarı, MVC için güvenli bir yönetim düşündüren, yeşil (&lt;% 20 FPR) arasında değişir. Kırmızı öneririz renktirMVC reçete değil ing. Buna ek olarak, sunucu hasta ve örnek veri ile doldurulur basılabilir bir pdf raporu oluşturur ve hekim gönderildi. Geno2pheno [coreceptor] çıkışı örnekleri Şekil tasvir edilmektedir. 6. <img alt="Şekil 1" src="/files/ftp_upload/3264/3264fig1.jpg" /> Şekil. 1. HIV şematik çoğaltma. Virion reseptörü olarak hücresel CD4 bağlamak gerekir ve coreceptor olarak CCR5 veya CXCR4 birine. Coreceptor CCR5 Maraviroc gibi CCR5 antagonistleri (MVC, Celsentri, Selzentry) ile bloke edilebilir. Viral ve hücresel membran füzyon sonra, viral nükleokapsit sitoplazma içinde serbest bırakılır. Nükleokapsid demonte ve virüs RNA&#39;sının, kompleks sitoplazma içine serbest kalır. Viral ters transkriptaz (RT) sonra çekirdek taşınır ve HIV integraz göre ev sahibi genom içine entegre edilmiştir proviral DNA içine genomik RNA aktarır. Hücresel RNA polimeraz traproviral genomdan viral genomik ve haberci RNA&#39;lar nscribe. Virüs proteinleri sitoplazmada üretilir ve hücre yüzeyine taşınır. Hücreleri olgunlaşmamış bulaşıcı olmayan virionlar gibi virüs partikülleri tomurcuk. HIV proteaz bulaşıcı parçacıklara üreten proteinleri parçalayarak. Adımlardan biri inhibisyonu replikasyon döngüsünün bir ara yol açar. Onlar inhibe ettiği antiretroviral ilaçlar ve çoğaltma adım kırmızı olarak işaretlenmiştir. Viral RNA ve DNA proviral (malzeme tropizm veya direnç analizi için kullanılan) yeşil işaretlenir. <img alt="Şekil 2," src="/files/ftp_upload/3264/3264fig2.jpg" /> Şekil 2. HIV proviral genom. HIV partikül farklı yapısal proteinleri ve evler viral ve hücresel kaynaklı hem çeşitli enzimler ve proteinler ile inşa edilmiştir. Şekil gösterisiviral genom içerisindeki genin yerini s. Yüzey gp120 ve gp41 viryonunun yüzeyi üzerinde sivri oluşturan ve membran füzyon gerçekleştirmek için insan hücre temas proteinleri. Şeklin alt kısmında, PCR amplifikasyon ürünleri ve protokolünde kullanılan primerler gösterilmiştir. <img alt="Şekil 3" src="/files/ftp_upload/3264/3264fig3.jpg" /> Şekil 3. Viral yükü düşük (VL) olan hastaların oranı Köln Viroloji, Üniversitesi (Almanya) Enstitüsü&#39;nde ilaç direnci ya tropizm belirlenmesi için analiz ölçümleri. <img alt="Şekil 4," src="/files/ftp_upload/3264/3264fig4.jpg" /> Şekil 4. Deneme Genel şeması .. Lütfen <a href="http://www.jove.com/files/ftp_upload/3264/3264fig4_lg.jpg">buraya tıklayın</a> Bu rakam bir büyük halini görmek için. <img alt="Şekil 5," src="/files/ftp_upload/3264/3264fig5.jpg" /> Şekil 5,. Sıra Lasergene ile düzenleme. V3 Amplikon en az bir ileri ve bir geri astar ile sıralı. Lasergene referans sekanslar &quot;V3-Konsensus B&quot; sequencer elde edilen ve env &quot;. Abi&quot; dosyaları alignes. Lasergene tüm satır veri mevcut kullanarak bir uzlaşma dizisi oluşturur. Onlar örnek uzlaşma dizisi katkıda kalmamak referans dizileri (ve daha sonra gri renkli görüntülenir) işaretlenebilir. <img alt="Şekil 6" src="/files/ftp_upload/3264/3264fig6.jpg" /> Şekil 6. Geno2pheno tarafından oluşturulan tropizm tahmin raporları [coreceptor] tool.The raporları kaydedilir ve bilgisayarda tamamlanması pdf dosyaları olarak oluşturulur. Ek veriler gibi bize hastanın adı, kan çıkarma tarihi, vb, elle bir pdf yazar program kullanılarak eklenebilir. Özgül yorum da eklenebilir. These veri kullanıcının bilgisayarında değil geno2pheno [coreceptor] sunucusunda özeldir. Lütfen <a href="http://www.jove.com/files/ftp_upload/3264/3264fig6_lg.jpg">buraya tıklayın</a> Bu rakam bir büyük halini görmek için.

<ol>
	<li>Heger, E., Schuelter, E., Klimkait, T., Lengauer, T., Kaiser, R., Walter, H., Sierra, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=European+coreceptor+proficiency+panel+test.">European coreceptor proficiency panel test.</a> , (2011).</li><li>Lengauer, T., Sander, O., Sierra, S., Thielen, T., Kaiser, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bioinformatic+prediction+of+HIV+coreceptor+usage.">Bioinformatic prediction of HIV coreceptor usage.</a> Nature Biotech. 25 (12), 1407-1410 (2007).</li><li>McGovern, R., Dong, W., Zhong, X., Knapp, D., Thielen, A., Chapman, D., Lewis, M., James, I., Valdez, H., Harrigan, P. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Population-based+Sequencing+of+the+V3-loop+Is+Comparable+to+the+Enhanced+Sensitivity+Trofile+Assay+in+Predicting+Virologic+Response+to+Maraviroc+of+Treatment-na+ve+Patients+in+the+MERIT+Trial.">Population-based Sequencing of the V3-loop Is Comparable to the Enhanced Sensitivity Trofile Assay in Predicting Virologic Response to Maraviroc of Treatment-na ve Patients in the MERIT Trial.</a> , (2010).</li><li>Reuter, S., Braken, P., Jensen, B., Sierra-Aragon, S., Oette, M., Balduin, M., Kaiser, R., Haussinger, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maraviroc+in+treatment-experienced+patients+with+HIV-1+infection+-+experience+from+routine+clinical+practice.">Maraviroc in treatment-experienced patients with HIV-1 infection - experience from routine clinical practice.</a> Eur. J. Med. Res. 15 (6), 231-237 (2010).</li><li>Recordon-Pinson, P., Soulie, C., Flandre, P., Descamps, D., Lazrek, M., Charpentier, C., Montes, B., Trabaud, M. A., Cottalorda, J., Schneider, V., Morand-Joubert, L., Tamalet, C., Desbois, D., Mace, M., Ferre, V., Vabret, A., Ruffault, A., Pallier, C., Raymond, S., Izopet, J., Reynes, J., Marcelin, A. G., Masquelier, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+the+genotypic+prediction+of+HIV-1+coreceptor+use+versus+a+phenotypic+assay+and+correlation+with+the+virological+response+to+maraviroc:+the+ANRS+GenoTropism+study.">Evaluation of the genotypic prediction of HIV-1 coreceptor use versus a phenotypic assay and correlation with the virological response to maraviroc: the ANRS GenoTropism study.</a> Antimicrob. Agents. Chemother. 54 (8), 3335-3340 (2010).</li><li>Swenson, L. C., Knapp, D., Harrigan, P. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calibration+and+accuracy+of+the+geno2pheno+co-receptor+algorithm+for+predicting+HIV+tropism+for+single+and+triplicate+measurements+of+V3+genotype.">Calibration and accuracy of the geno2pheno co-receptor algorithm for predicting HIV tropism for single and triplicate measurements of V3 genotype.</a> , (2010).</li><li>Macartney, M. J., Cameron, J., Strang, A., Garc&#237;a, A., Booth, C., Marshall, N., Johnson, M., Geretti, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+a+genotypic+assay+for+the+prediction+of+HIV-1+coreceptor+tropism+and+guiding+the+use+of+CCR5+antagonists+in+clinical+practice.">Use of a genotypic assay for the prediction of HIV-1 coreceptor tropism and guiding the use of CCR5 antagonists in clinical practice.</a> , (2010).</li><li>Sierra, S., Thielen, A., Reuter, S., Jensen, B., Esser, S., F&#228;tkenheuer, G., Lengauer, T., Pfister, H., Sichtig, N., Kaiser, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tropism+determination+and+clinical+outcome+of+61+patients+under+MVC+treatment.">Tropism determination and clinical outcome of 61 patients under MVC treatment.</a> , (2010).</li><li>Obermeier, M., Carganico, A., Bieniek, B., Schleehauf, D., Dupke, S., Fischer, K., Freiwald, M., Neifer, S., Schuler, C., Mayr, C., Klausen, G., K&#246;ppe, S., &#252;&#252;nsche, T., Berg, T., Baumgarten, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tropism+testing+from+proviral+DNA+-+analysis+of+a+subgroup+from+the+Berlin+Maraviroc+cohort.">Tropism testing from proviral DNA - analysis of a subgroup from the Berlin Maraviroc cohort.</a> , (2010).</li><li>Vandekerckhove, L. P., Wensing, A. M., Kaiser, R., Brun-Vezinet, F., Clotet, B., De Luca, A., Dressler, S., Garcia, F., Geretti, A. M., Klimkait, T., Korn, K., Masquelier, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=European+guidelines+on+the+clinical+management+of+HIV-1+tropism+testing.">European guidelines on the clinical management of HIV-1 tropism testing.</a> Lancet Infect Dis. 11 (5), 394-407 (2011).</li><li>Walter, H., Eberle, J., M&#246;ller, H., Noah, C., Wolf, E., St rmer, M., Braun, P., Krn, K., D umer, M., Berg, T., Obermeier, M., Thielen, A., Kaiser, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Empfehlung+zur+Bestimmung+des+HIV-1-Korezeptor-Gebrauchs+(DAIG+Recommendations+for+the+HIV-1+tropism+testing).">Empfehlung zur Bestimmung des HIV-1-Korezeptor-Gebrauchs (DAIG Recommendations for the HIV-1 tropism testing).</a> , (2011).</li><li>Obermeier, M. J., Carganico, A., Dupke, S., Schranz, D., Cordes, C., Freiwald, M., Klausen, G., K&#246;ppe, S., Schuler, C., Mayr, C., Schleehauf, D., Berg, T., Krznaric, I., Baumgarten, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+application+of+genotypic+co-receptor+tropism+testing+from+viral+RNA+and+proviral+DNA:+week+24+analysis+of+the+Berlin+maraviroc+cohort.">Clinical application of genotypic co-receptor tropism testing from viral RNA and proviral DNA: week 24 analysis of the Berlin maraviroc cohort.</a> Journal of the International AIDS Society. 13, 129-129 (2010).</li><li>Toma, J., Frantzell, A., Hoh, R., Martin, J., Deeks, S., Petropoulos, C., Huang, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determining+HIV-1+Co-receptor+Tropism+Using+PBMC+Proviral+DNA+Derived+from+Aviremic+Blood+Samples.">Determining HIV-1 Co-receptor Tropism Using PBMC Proviral DNA Derived from Aviremic Blood Samples.</a> , (2010).</li></ol>

Bu video makalede ViiV Sağlık ve GlaxoSmithKline tarafından desteklenmektedir.

3-9 klinik deneylerinde gösterildiği gibi V3 sekans, güvenilir bir viral tropizm tahmin sağlar. Aslında, genotipik belirlenmesi mevcut Avrupa ve Alman-Avusturya yönergelere 10 düşünülmektedir. Fenotipik testi ile karşılaştırıldığında, sadece kısa bir devir süresi (dayanıklılık testi için eşdeğer) değil, aynı zamanda maliyeti daha yüksektir. Buna ek olarak, genotipik test önemli bir avantaj sonuçlar FPR olarak sınıflandırılır ve bu yüzden, hastanın ihtiyaçlarına göre uyarlanabilir olmasıdır. Trofile sonuçlar, diğer yandan, sadece R5 veya X4 rapor vardır ve ham verilere erişimi verilmez. Avusturya-Alman esaslarına her bir hastanın ihtiyaçlarına 11 cut-off özel FPR adapte izin verirken, şu anda, Avrupa yönergeleri, 20% 10 bir FPR kesme öneririz. Bu doğrultuda, antiretroviral ilaçlar seçenekleri geniş bir yelpazede, yüksek FPR cut-off (&gt;% 20) olan hastalar için recomm vardırsona erdi. Tersine, sınırlı tedavi seçenekleri ile ağır ön tedavi edilen hastalarda, düşük FPR cut-off (&gt;% 5) kullanılabilir. Tedavisi rehberlik Bu tür şu anda kısmen-aktif ilaçlar azaltılmış tedavi seçenekleri olan hastalar için tedavi dahil edilebilir NRTIs, NNRTI&#39;ler, işlem yönergeleri ve Inis için test direnç ile devam etmektedir. Buna ek olarak, genotipik güdümlü terapi değişiklikleri, artan sayıları ile klinik-ilgili FPR kesilmelerine sürekli bioinformaticians, virologlar ve klinisyenlerin bir panel tarafından ayarlanır edilmektedir. Genotipik tropizm testi diğer önemli bir avantajı çok düşük hatta saptanamayan viral yük (VL) ile klinik örneklerin analiz olasılığıdır. Bu durumda, RNA plazma amplifiable olmadığı zaman, proviral DNA dizilimini edilebilir ve güvenilir 9,12 tahmin etmek için kullanılır. Unutmayın ki, düşük veya belirlenemeyen viral yükü olan hastaların sayısı hızla son yıllarda artmıştır. , T Bugünerofile tahlil sadece VL olan hastalarda &lt;1000 kopya / ml &#39;den, numunelerin analizine izin verir. Ancak, ön çalışmalar proviral DNA ayrıca Trofile 13 tarafından test edilmesi adecuate olabileceğini göstermiştir.

<table border="1"><tbody><tr><td> Reaktif Adı </td><td> Şirket </td><td> Katalog numarası </td><td> Yorumlar </td></tr><tr><td> MagNA Pure Compact Nükleik Asit İzolasyon Kiti I </td><td> Roche Diagnostics </td><td> 04 802 993 001 </td><td></td></tr><tr><td> MagNA Pure Kompakt Sistem </td><td> Roche Diagnostics </td><td> 03731146001 </td><td></td></tr><tr><td> T3000 termalcycler </td><td> Biometra </td><td> 050-723 </td><td></td></tr><tr><td> One Step RT-PCR Kit </td><td> Qiagen </td><td> 210215 </td><td></td></tr><tr><td> HotStarTaq Master Mix Takımı </td><td> Qiagen </td><td> 203445 </td><td></td></tr><tr><td> QIAquick PCR Arıtma Kiti </td><td> Qiagen </td><td> 28106 </td><td></td></tr><tr><td> Ekzonükleaz I (Exo I) </td><td> Fermentas </td><td> EN0582 </td><td></td></tr><tr><td> Termosensitif Alkalin Fosfataz Fastap </td><td> Fermentas </td><td> EF0651 </td> &lt;td&gt; </td></tr><tr><td> BigDye Terminator v3.1 Cycle Dizileme Takımı </td><td> Applied Biosystems </td><td> 4337457 </td><td></td></tr><tr><td> Sephadex G-50 Superfine </td><td> GE Healthcare </td><td> 17-0041-01 </td><td></td></tr><tr><td> ABI Prism 3130 XL kılcal sıralayıcı </td><td> Applied Biosystems </td><td> 3130XL </td><td></td></tr></tbody></table>

prediction of hiv-1 coreceptor usage (tropism) by sequence analysis using a genotypic approach

Maraviroc (MVC) coreceptor antagonistleri sınıfından ilk lisanslı antiretroviral ilaç olduğunu. Bu, insan bağışıklık hücreleri (Şekil 1) enfekte etmek için, HIV suşu çoğunluğu tarafından kullanılan ana bilgisayar coreceptor CCR5, bağlanır. Diğer HIV izolatlarının farklı coreceptor, CXCR4 kullanabilirsiniz. Kullanıldığı reseptör, Env proteini (Şekil 2) tarafından virüs olarak belirlenir. Ikinci coreceptor bağlı olarak, sırasıyla virüs R5 veya X4 olarak sınıflandırılır. MVC inhibe CCR5 reseptör hedef hücre içine R5 virüslerin girişine bağlanır. Hastalığın seyri sırasında, X4 virüsler ortaya ve R5 virüsler büyümek olabilir. EMA ve FDA tarafından talep olarak coreceptor kullanımı (ayrıca tropizm denir) belirlenmesi, bu nedenle önceki MVC idaresi zorunludur. MVC verimliliği MOTİVE, BAŞARI ve 1029 için çalışmalara Bu sophi dayanan yüksek kaliteli bir testtir Monogram, San Francisco, ABD Trofile testi ile yapılmıştırsticated rekombinant testleri. Avrupalı ​​doktorlar değil, aynı zamanda eş zamanlı direnç testleri verin desantralize uzman laboratuarlar ile çalışmak eğilimindedir beri günlük rutin için bu test için kabul, ABD dışında oldukça düşüktür. Bu laboratuvarlar çeşitli kalite güvence değerlendirme 2011 1 sunulmadan sonuncusu uğramıştır. Şimdi birkaç yıl için, HIV env-V3 gen bölgesi (V3), 2 sıra analize dayalı tropizm tespitler gerçekleştirdik. Bu bölge güvenilir bir tahmin yapmak için yeterli bilgi taşır. Kısa ciro süresi (direnç testi eşdeğeri), daha düşük maliyetler, hastaların ihtiyaçlarına sonuçları uyum olasılığı çok düşük hatta saptanamayan viral yük (VL klinik örneklerin analiz olanağı: coreceptor kullanım genotipik belirlenmesi gibi avantajlar sunuyor ), özellikle bu yana VL ile analiz örnek sayısı, &lt;1000 kopya / ml &#39;kabaca (Şekil 3) son yıllarda artmıştır. Tropizm testi için ana adım (Şekil 4) bu video gösterilmiştir: 1. Kan örneği toplanması 2. Plazma ve / veya HIV proviral DNA kan mononükleer hücrelerin HIV RNA&#39;nın izolasyonu 3. Env bölgenin Amplifikasyon 4. V3 bölgenin amplifikasyonu 5. V3 Amplikon sekans reaksiyonu 6. Dizi analizi örnekleri saflaştırılması 7. Saflaştırılmış örnekleri Sekans 8. Sıra düzenleme 9. Veri yorumlama ve tropizm tahmin Dizileme

Watch this Scientific Journal Video about Prediction of HIV-1 Coreceptor Usage Tropism by Sequence Analysis using a Genotypic Approach at JoVE.com

Prediction of HIV-1 Coreceptor Usage Tropism by Sequence Analysis using a Genotypic Approach

HIV-1 coreceptor kullanımının tahmin antiretroviral ilaçlara, örneğin coreceptor antagonistlerinin yeni bir sınıfını idaresi için gereklidir. Bu, bir dizi analizi ile yapılabilir<em&gt; Env</emInternet tabanlı bir tercüme sistemi aracılığıyla&gt; gen ve sonraki yorumlanması (geno2pheno<sub&gt; [Coreceptor]</sub&gt;).

Bir Genotipik Yöntemi&#39;ne Dizi Analizi ile HIV-1 coreceptor Kullanımı (tropizm) Tahmin

Maraviroc (MVC) is the first licensed antiretroviral drug from the class of coreceptor antagonists. It binds to the host coreceptor CCR5, which is used by ...

<a class="grey_button" href="http://www.jove.com/video/4153"> Espa&ntilde;ol </a>

prediction-hiv-1-coreceptor-usage-tropism-sequence-analysis-using

Research

JoVE Journal

Immunology and Infection

Prediction of HIV-1 Coreceptor Usage (Tropism) by Sequence Analysis using a Genotypic Approach

13.1K Görüntüleme.  University of Cologne.  Español 

Video: Prediction of HIV-1 Coreceptor Usage Tropism by Sequence Analysis using a Genotypic Approach

Assessment of Immunologically Relevant Dynamic Tertiary Structural Features of the HIV-1 V3 Loop Crown R2 Sequence by ab initio Folding

The antigenic diversity of HIV-1 has long been an obstacle to vaccine design, and this variability is especially pronounced in the V3 loop of the virus' surface envelope glycoprotein. We previously proposed that the crown of the V3 loop, although dynamic and sequence variable, is constrained throughout the population of HIV-1 viruses to an immunologically relevant &beta;-hairpin tertiary structure. Importantly, there are thousands of different V3 loop crown sequences in circulating HIV-1 viruses, making 3D structural characterization of trends across the diversity of viruses difficult or impossible by crystallography or NMR. Our previous successful studies with folding of the V3 crown1, 2 used the ab initio algorithm 3 accessible in the ICM-Pro molecular modeling software package (Molsoft LLC, La Jolla, CA) and suggested that the crown of the V3 loop, specifically from positions 10 to 22, benefits sufficiently from the flexibility and length of its flanking stems to behave to a large degree as if it were an unconstrained peptide freely folding in solution. As such, rapid ab initio folding of just this portion of the V3 loop of any individual strain of the 60,000+ circulating HIV-1 strains can be informative. Here, we folded the V3 loop of the R2 strain to gain insight into the structural basis of its unique properties. R2 bears a rare V3 loop sequence thought to be responsible for the exquisite sensitivity of this strain to neutralization by patient sera and monoclonal antibodies4, 5. The strain mediates CD4-independent infection and appears to elicit broadly neutralizing antibodies. We demonstrate how evaluation of the results of the folding can be informative for associating observed structures in the folding with the immunological activities observed for R2.

Assessment of Immunologically Relevant Dynamic Tertiary Structural Features of the HIV-1 V3 Loop Crown R2 Sequence by ab initio Folding

The crown region of different V3 loop sequences of the surface envelope glycoprotein (gp120) of HIV-1 can be structurally characterized in many cases by in silico folding of positions 10 to 22 of the loop using a state-of-the-art ab initio folding algorithm. Here we demonstrate the folding and evaluation of this region of the V3 loop from the R2 strain of HIV-1, a uniquely neutralization sensitive strain with puzzling functional properties.

HIV-1 V3 döngü Taç R2 Sıra immünolojik İlgili Dinamik Tersiyer Yapısal Özellikler Değerlendirilmesi Ab initio Katlanır

The antigenic diversity of HIV-1 has long been an obstacle to vaccine design, and this variability is especially pronounced in the V3 loop of the virus' ...

İmmünoloji ve Enfeksiyon

Specific Marking of HIV-1 Positive Cells using a Rev-dependent Lentiviral Vector Expressing the Green Fluorescent Protein

Most of HIV-responsive expression vectors are based on the HIV promoter, the long terminal repeat (LTR). While responsive to an early HIV protein, Tat, the LTR is also responsive to cellular activation states and to the local chromatin activity where the integration has occurred. This can result in high HIV-independent activity, and has restricted the usefulness of LTR-based reporter to mark HIV positive cells 1,2,3. Here, we constructed an expression lentiviral vector that possesses, in addition to the Tat-responsive LTR, numerous HIV DNA sequences that include the Rev-response element and HIV splicing sites 4,5,6. The vector was incorporated into a lentiviral reporter virus, permitting highly specific detection of replicating HIV in living cell populations. The activity of the vector was measured by expression of the green fluorescence protein (GFP). The application of this vector as reported here offers a novel alternative approach to existing methods, such as in situ PCR or HIV antigen staining, to identify HIV-positive cells. The vector can also express therapeutic genes for basic or clinical experimentation to target HIV-positive cells.

We have developed a lentiviral vector that possesses, in addition to the Tat-responsive LTR, the Rev-response element (RRE) that can regulate reporter gene expression in an HIV-1 Tat- and Rev-dependent fashion. The vector permits the specific detection of replicating HIV in living cells via the expression of GFP.

Yeşil Floresan Protein ifade Rev-bağımlı lentiviral Vector kullanarak HIV-1 Olumlu Hücreler Özgül İşareti

Most of HIV-responsive expression vectors are based on the HIV promoter, the long terminal repeat (LTR). While responsive to an early HIV protein, Tat, ...

Genotypic Inference of HIV-1 Tropism Using Population-based Sequencing of V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her viral population uses the CCR5 coreceptor for cellular entry, and not an alternative coreceptor. One approach to tropism testing is to examine the sequence of the V3 region of the HIV envelope, which interacts with the coreceptor.
Methods: Viral RNA is extracted from blood plasma. The V3 region is amplified in triplicate with nested reverse transcriptase-PCR. The amplifications are then sequenced and analyzed using the software, RE_Call. Sequences are then submitted to a bioinformatic algorithm such as geno2pheno to infer viral tropism from the V3 region. Sequences are inferred to be non-R5 if their geno2pheno false positive rate falls below 5.75%. If any one of the three sequences from a sample is inferred to be non-R5, the patient is unlikely to respond to a CCR5-antagonist.

HIV tropism can be inferred from the V3 region of the viral envelope. V3 is PCR amplified in triplicate using nested RT-PCR, sequenced, and interpreted using bioinformatic software. Samples with with 1 or more sequence(s) with low g2P scores are classified as non-R5 virus.

HIV-1 tropizm genotipik Çıkarım kullanarak Nüfus tabanlı Sıralama V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her ...

Structure of HIV-1 Capsid Assemblies by Cryo-electron Microscopy and Iterative Helical Real-space Reconstruction

Cryo-electron microscopy (cryo-EM), combined with image processing, is an increasingly powerful tool for structure determination of macromolecular protein complexes and assemblies. In fact, single particle electron microscopy1 and two-dimensional (2D) electron crystallography2 have become relatively routine methodologies and a large number of structures have been solved using these methods. At the same time, image processing and three-dimensional (3D) reconstruction of helical objects has rapidly developed, especially, the iterative helical real-space reconstruction (IHRSR) method3, which uses single particle analysis tools in conjunction with helical symmetry. Many biological entities function in filamentous or helical forms, including actin filaments4, microtubules5, amyloid fibers6, tobacco mosaic viruses7, and bacteria flagella8, and, because a 3D density map of a helical entity can be attained from a single projection image, compared to the many images required for 3D reconstruction of a non-helical object, with the IHRSR method, structural analysis of such flexible and disordered helical assemblies is now attainable.
In this video article, we provide detailed protocols for obtaining a 3D density map of a helical protein assembly (HIV-1 capsid9 is our example), including protocols for cryo-EM specimen preparation, low dose data collection by cryo-EM, indexing of helical diffraction patterns, and image processing and 3D reconstruction using IHRSR. Compared to other techniques, cryo-EM offers optimal specimen preservation under near native conditions. Samples are embedded in a thin layer of vitreous ice, by rapid freezing, and imaged in electron microscopes at liquid nitrogen temperature, under low dose conditions to minimize the radiation damage. Sample images are obtained under near native conditions at the expense of low signal and low contrast in the recorded micrographs. Fortunately, the process of helical reconstruction has largely been automated, with the exception of indexing the helical diffraction pattern. Here, we describe an approach to index helical structure and determine helical symmetries (helical parameters) from digitized micrographs, an essential step for 3D helical reconstruction. Briefly, we obtain an initial 3D density map by applying the IHRSR method. This initial map is then iteratively refined by introducing constraints for the alignment parameters of each segment, thus controlling their degrees of freedom. Further improvement is achieved by correcting for the contrast transfer function (CTF) of the electron microscope (amplitude and phase correction) and by optimizing the helical symmetry of the assembly.

This article describes a method to obtain a three-dimensional (3D) structure of helically assembled molecules using cryo-electron microscopy. In this protocol, we use HIV-1 capsid assemblies to illustrate the detailed 3D reconstruction procedure for achieving a density map by the iterative helical real-space reconstruction method.

Cryo-Elektron Mikroskopi tarafından HIV-1 kapsid Meclisleri Yapısı ve iteratif Helisel Gerçek uzay İmar

Cryo-electron microscopy (cryo-EM), combined with image processing, is an increasingly powerful tool for structure determination of macromolecular protein ...

In vitro Uncoating of HIV-1 Cores

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is composed of CA protein arranged as a lattice of hexagon. The capsid is closed by 7 pentamers at the broad end and 5 at the narrow end of the cone1, 2. Encased in this capsid shell is the viral ribonucleoprotein complex, and together they comprise the core.
Following fusion of the viral membrane with the target cell membrane, the HIV-1 is released into the cytoplasm. The capsid then disassembles releasing free CA in the soluble form3 in a process referred to as uncoating. The intracellular location and timing of HIV-1 uncoating are poorly understood. Single amino-acid substitutions in CA that alter the stability of the capsid also impair the ability of HIV-1 to infect cells4. This indicates that the stability of the capsid is critical for HIV-1 infection.
HIV-1 uncoating has been difficult to study due to lack of availability of sensitive and reliable assays for this process. Here we describe a quantitative method for studying uncoating in vitro using cores isolated from infectious HIV-1 particles. The approach involves isolation of cores by sedimentation of concentrated virions through a layer of detergent and into a linear sucrose gradient, in the cold. To quantify uncoating, the isolated cores are incubated at 37&deg;C for various timed intervals and subsequently pelleted by ultracentrifugation. The extent of uncoating is analyzed by quantifying the fraction of CA in the supernatant. This approach has been employed to analyze effects of viral mutations on HIV-1 capsid stability4, 5, 6. It should also be useful for studying the role of cellular factors in HIV-1 uncoating.

In vitro Uncoating of HIV-1 Cores

Uncoating is an essential step in the early phase of the HIV-1 life cycle and is defined as the disassembly of the capsid shell and the release of the viral ribonucleoprotein complex (vRNP). Here, we demonstrate techniques for isolating intact cores from HIV-1 virions and for quantifying their uncoating in vitro.

HIV-1 Çekirdek in vitro Uncoating

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is ...

New Tools to Expand Regulatory T Cells from HIV-1-infected Individuals

CD4+ Regulatory T cells (Tregs) are potent immune modulators and serve an important function in human immune homeostasis. Depletion of Tregs has led to measurable increases in antigen-specific T cell responses in vaccine settings for cancer and infectious pathogens. However, their role in HIV-1 immuno-pathogenesis remains controversial, as they could either serve to suppress deleterious HIV-1-associated immune activation and thus slow HIV-1 disease progression or alternatively suppress HIV-1-specific immunity and thereby promote virus spread. Understanding and modulating Treg function in the context of HIV-1 could lead to potential new strategies for immunotherapy or HIV vaccines. However, important open questions remain on their role in the context of HIV-1 infection, which needs to be carefully studied.
Representing roughly 5% of human CD4+ T cells in the peripheral blood, studying the Treg population has proven to be difficult, especially in HIV-1 infected individuals where HIV-1-associated CD4 T cell and with that Treg depletion occurs. The characterization of regulatory T cells in individuals with advanced HIV-1 disease or tissue samples, for which only very small biological samples can be obtained, is therefore extremely challenging. We propose a technical solution to overcome these limitations using isolation and expansion of Tregs from HIV-1-positive individuals.
Here we describe an easy and robust method to successfully expand Tregs isolated from HIV-1-infected individuals in vitro. Flow-sorted CD3+CD4+CD25+CD127low Tregs were stimulated with anti-CD3/anti-CD28 coated beads and cultured in the presence of IL-2. The expanded Tregs expressed high levels of FOXP3, CTLA4 and HELIOS compared to conventional T cells and were shown to be highly suppressive. Easier access to large numbers of Tregs will allow researchers to address important questions concerning their role in HIV-1 immunopathogenesis. We believe answering these questions may provide useful insight for the development of an effective HIV-1 vaccine.

CD4+ Regulatory T cells are potent immune-modulators and serve important functions in immune homeostasis. The paucity of these cells in peripheral blood makes functional studies challenging, specifically in the context of HIV-1-infection. We here describe a method to isolate and expand functional CD4+ Tregs from peripheral blood from HIV-1-infected individuals.

Yeni Araçlar HIV-1 ile enfekte bireyler gelen Düzenleyici T hücreleri büyütmek için

CD4+ Regulatory T cells (Tregs) are potent immune modulators and serve an important function in human immune homeostasis. Depletion of Tregs has led to ...

Assessing the Innate Sensing of HIV-1 Infected CD4+ T Cells by Plasmacytoid Dendritic Cells Using an Ex vivo Co-culture System.

HIV-1 innate sensing requires direct contact of infected CD4+ T cells with plasmacytoid dendritic cells (pDCs). In order to study this process, the protocols described here use freshly isolated human peripheral blood mononuclear cells (PBMCs) or plasmacytoid dendritic cells (pDCs) to sense infections in either T cell line (MT4) or heterologous primary CD4+ T cells. In order to ensure proper sensing, it is essential that PBMC are isolated immediately after blood collection and that optimal percentage of infected T cells are used. Furthermore, multi-parametric flow cytometric staining can be used to confirm that PBMC samples contain the different cell lineages at physiological ratios. A number of controls can also be included to evaluate viability and functionality of pDCs. These include, the presence of specific surface markers, assessing cellular responses to known agonist of Toll-Like Receptors (TLR) pathways, and confirming a lack of spontaneous type-I interferon (IFN) production. In this system, freshly isolated PBMCs or pDCs are co-cultured with HIV-1 infected cells in 96 well plates for 18-22 hr. Supernatants from these co-cultures are then used to determine the levels of bioactive type-I IFNs by monitoring the activation of the ISGF3 pathway in HEK-Blue IFN-&#945;/&#946; cells. Prior and during co-culture conditions, target cells can be subjected to flow cytometric analysis to determine a number of parameters, including the percentage of infected cells, levels of specific surface markers, and differential killing of infected cells. Although, these protocols were initially developed to follow type-I IFN production, they could potentially be used to study other imuno-modulatory molecules released from pDCs and to gain further insight into the molecular mechanisms governing HIV-1 innate sensing.

Assessing the Innate Sensing of HIV-1 Infected CD4+ T Cells by Plasmacytoid Dendritic Cells Using an Ex vivo Co-culture System.

Unlike cell-free HIV-1 particles, infected CD4+ T cells are effectively sensed by plasmacytoid dendritic cells (pDCs). This manuscript describes a method where peripheral blood mononuclear cells (PBMCs) or isolated pDCs are co-cultured with HIV-1 infected T cells to evaluate innate sensing by pDCs as assessed by release of type-I IFN.

HIV-1 Enfekte CD4 Doğuştan Algılama Değerlendirilmesi<sup&gt; +</sup&gt; Bir kullanılması plazmositoid dendritik hücreler tarafından T Hücreleri<em&gt; Ex vivo</em&gt; Co-kültür sistemi.

HIV-1 innate sensing requires direct contact of infected CD4+ T cells with plasmacytoid dendritic cells (pDCs). In order to study this process, the ...

Conformational Evaluation of HIV-1 Trimeric Envelope Glycoproteins Using a Cell-based ELISA Assay

HIV-1 envelope glycoproteins (Env) mediate viral entry into target cells and are essential to the infectious cycle. Understanding how those glycoproteins are able to fuel the fusion process through their conformational changes could lead to the design of better, more effective immunogens for vaccine strategies. Here we describe a cell-based ELISA assay that allows studying the recognition of trimeric HIV-1 Env by monoclonal antibodies. Following expression of HIV-1 trimeric Env at the surface of transfected cells, conformation specific anti-Env antibodies are incubated with the cells. A horseradish peroxidase-conjugated secondary antibody and a simple chemiluminescence reaction are then used to detect bound antibodies. This system is highly flexible and can detect Env conformational changes induced by soluble CD4 or cellular proteins. It requires minimal amount of material and no highly-specialized equipment or know-how. Thus, this technique can be established for medium to high throughput screening of antigens and antibodies, such as newly-isolated antibodies.

Understanding viral surface antigens conformations is required to evaluate antibody neutralization and guide the design of effective vaccine immunogens. Here we describe a cell-based ELISA assay that allows the study of the recognition of trimeric HIV-1 Env expressed at the surface of transfected cells by specific anti-Env antibodies.

Bir Hücre temelli bir ELISA testi kullanarak, HIV-1 zarf trimerik Glikoproteinler konformasyonel Değerlendirilmesi

HIV-1 envelope glycoproteins (Env) mediate viral entry into target cells and are essential to the infectious cycle. Understanding how those glycoproteins ...

Isolation of Exosomes from the Plasma of HIV-1 Positive Individuals

Exosomes are small vesicles ranging in size from 30 nm to 100 nm that are released both constitutively and upon stimulation from a variety of cell types. They are found in a number of biological fluids and are known to carry a variety of proteins, lipids, and nucleic acid molecules. Originally thought to be little more than reservoirs for cellular debris, the roles of exosomes regulating biological processes and in diseases are increasingly appreciated.
Several methods have been described for isolating exosomes from cellular culture media and biological fluids. Due to their small size and low density, differential ultracentrifugation and/or ultrafiltration are the most commonly used techniques for exosome isolation. However, plasma of HIV-1 infected individuals contains both exosomes and HIV viral particles, which are similar in size and density. Thus, efficient separation of exosomes from HIV viral particles in human plasma has been a challenge.
To address this limitation, we developed a procedure modified from Cantin et. al., 2008 for purification of exosomes from HIV particles in human plasma. Iodixanol velocity gradients were used to separate exosomes from HIV-1 particles in the plasma of HIV-1 positive individuals. Virus particles were identified by p24 ELISA. Exosomes were identified on the basis of exosome markers acetylcholinesterase (AChE), and the CD9, CD63, and CD45 antigens. Our gradient procedure yielded exosome preparations free of virus particles. The efficient purification of exosomes from human plasma enabled us to examine the content of plasma-derived exosomes and to investigate their immune modulatory potential and other biological functions.

Techniques describing a gradient procedure to separate exosomes from human immunodeficiency virus (HIV) particles are described. This procedure was used to isolate exosomes away from HIV particles in human plasma from HIV-infected individuals. The isolated exosomes were analyzed for cytokine/chemokine content.

HIV-1 pozitif Bireylerin Plazma eksozomlann izolasyonu

Exosomes are small vesicles ranging in size from 30 nm to 100 nm that are released both constitutively and upon stimulation from a variety of cell types. ...

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

HIV-1 envelope proteins engage cognate receptors on the target cell surface, which leads to viral-cell membrane fusion followed by the release of the viral capsid (CA) core into the cytoplasm. Subsequently, the viral Reverse Transcriptase (RT), as part of a namesake nucleoprotein complex termed the Reverse Transcription Complex (RTC), converts the viral single-stranded RNA genome into a double-stranded DNA copy (vDNA). This leads to the biogenesis of another nucleoprotein complex, termed the pre-integration complex (PIC), composed of the vDNA and associated virus proteins and host factors. The PIC-associated viral integrase (IN) orchestrates the integration of the vDNA into the host chromosomal DNA in a temporally and spatially regulated two-step process. First, the IN processes the 3&#39; ends of the vDNA in the cytoplasm and, second, after the PIC traffics to the nucleus, it mediates integration of the processed vDNA into the chromosomal DNA. The PICs isolated from target cells acutely infected with HIV-1 are functional in vitro, as they are competent to integrate the associated vDNA into an exogenously added heterologous target DNA. Such PIC-based in vitro integration assays have significantly contributed to delineating the mechanistic details of retroviral integration and to discovering IN inhibitors. In this report, we elaborate upon an updated HIV-1 PIC assay that employs a nested real-time quantitative Polymerase Chain Reaction (qPCR)-based strategy for measuring the in vitro integration activity of isolated native PICs.

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

This report describes an in vitro assay for measuring the human immunodeficiency virus type 1 (HIV-1) preintegration complex (PIC)-associated integration activity in the cytoplasmic extracts of acutely infected cells. The integration of PIC-associated HIV-1 DNA into heterologous target DNA is quantified by using a nested real-time polymerase chain reaction strategy.

Ölçümü<em&gt; İn Vitro</em&gt; HIV-1 Preintegration Kompleksleri Entegrasyon Etkinliği

HIV-1 envelope proteins engage cognate receptors on the target cell surface, which leads to viral-cell membrane fusion followed by the release of the ...