Biz, anti-PD-L1 bloke antikorun sağlanması ve kullanılması için Gordon Freeman ederiz. Biz Massachusetts General Hospital ve bu projede onların değerli rolü için tüm katılımcıların de klinik ve laboratuar çalışanlarına teşekkür ederiz. , Ulusal Kalp Akciğer ve Sağlık Ulusal Enstitüleri Kan Enstitüsü (RO1 HL-092.565, DEK); Bu çalışma Ulusal Alerji Enstitüsü ve Sağlık Ulusal Enstitüsü (DEK PO1 AI-080192) Enfeksiyon Hastalıkları tarafından desteklenmiştir. DEK Quebec Sağlığı Araştırma Fonu Araştırmacı Kariyer Ödülü (FRQS) tarafından desteklenmektedir. FP Araştırma ve Harvard Küresel Sağlık Enstitüsü (HGHI) üzerine Massachusetts General Hospital İcra Komitesi burs hibe ile desteklenmektedir.

1.. Ficoll ayırma yoluyla tükenmesi ve PBMC&#39;lerin izolasyonu <ol><li> Tam kan, 50 ul / ml &#39;de insan CD8 + tükenmesi kokteyli eklenerek CD8 + T hücrelerinin tüketilmesi. </li><li> İyice karıştırın ve oda sıcaklığında (18-25 ° C) &#39;de 20 dakika boyunca inkübe edin. </li><li> İnkübasyondan sonra, (Ca2 + veya Mg2 + olmaksızın Hank Dengeli Tuz Çözeltisi) HBSS ile tam kan karıştırın ve Histopaque fazla tabaka. 30 dakika (hiçbir fren, yavaş hızlanma) için 340 RCF Spin. </li><li> PBMC&#39;Ierde toplamak ve yeni bir 50ml konik transfer. 340 RCF 10 dakika boyunca iplik 50 IU Penisilin, 50 | ig / ml streptomisin, 2 mM L-glutamin ve% 1 HEPES ile takviye edilmiş 45 ml RPMI 1640 ile yıkayın 2x. </li></ol> 2. Antikor Blockade ve Hücreler antijen-spesifik uyarım <ol><li> 50 IU Penisilin, 50 | ig / ml streptomisin, 2 mM L-glutamin ve% 1 HEPES ile takviye edilmiş,% 10 insan serumu ihtiva eden RPMI 1640 içinde durum başına 2x10-6 yeniden süspanse hücre,durum başına 500 ul için muhasebe. </li><li> FACS tüp başına hücre süspansiyonu kısım 500 ul. </li><li> Incelenen yolu bağlı olarak, PD-L1, 10 ug / ml &#39;de antikorlar ve / veya izotip kontrolleri IL-bloke 10Rα ekleyin ve 37 ° C,% 5 CO2 de 15 dakika boyunca inkübe edin. </li><li> 1 ug / ml / peptid nihai konsantrasyonda, bir HIV-1 Gag peptidi havuzlu hücreleri uyarır. Ayrıca, her bir durum için bir bloke &quot;no uyarım&quot; kontrolü içerir. 37 ° C, 48 saat boyunca% 5 CO2 ile inkübe edin. </li></ol> 3. Toplama ve süpernatanı üzerinde yapılan analiz <ol><li> 48 saat sonra, 340 rcf 7 dakika FACS tüpler aşağı spin. </li><li> Dikkatle pelet bozmadan Luminex boncuk dizileri için Eppendorf tüpleri 2 x 225 ul süpernatant toplamak. </li><li> % 0.05 PBS-Tween bir son konsantrasyon vermek üzere 25 ul% 0.5 &#39;lik PBS-Tween ile toplanan süpernatan içinde virüs etkisiz hale getirirler. </li><li> Immed değildir Mağazası toplanan süpernatanlanVakit kaybetmeden bir -80 ° C derin dondurucuda kullanılabilir. </li><li> Üreticinin protokolüne göre Millipore Luminex kiti kullanılarak istenen sitokin konsantrasyonları ölçün. </li></ol> 4. Sitometrisi yoluyla Toplama ve Hücre Fenotipik Analizi <ol><li> Süpernatant topladıktan sonra, 3 ml PBS içinde hücreleri yıkayın. 340 rcf 7 dakika hücreleri Spin ve aşırı yıkama süzün. </li><li> Üreticinin protokolüne göre bir DEAD tamir edilebilir / CANLI Ölü Hücre Leke Kit kullanarak canlılığı için leke. </li><li> 340 RCF ve 4 ° C &#39;de, 7 dakika boyunca PBS içinde hücreler yıkayın 100 ul PBS% 1 FBS içinde süspanse edin. </li><li> FcR reaktifi ve karıştırmak için girdap bloke 1.4 ul ekleyerek, monositler veya başka antijen sunan hücreler, blok Fc reseptörleri için boyama durumunda. </li><li> 4 ° C&#39;de 10 dakika boyunca inkübe </li><li> Yüzey antikorlar, vorteks ekleyin ve karanlıkta 4 ° C&#39;de 20 dakika boyunca inkübe edin. </li><li> , PBS,% 1 FBS hücreleri yıkayın fazla yıkama süzün ve 200 ul% 4 paraformaldehid ekleyin. Kuluçkaya yatmakKaranlıkta 20 dakika boyunca oda sıcaklığında karıştırıldı. </li><li> 250 ul PBS,% 1 FBS içinde PBS,% 1 FBS, tekrar süspansiyon hücreleri yıkayın ve bir akış sitometresi üzerinde elde MULTILASER (örneğin BD LSRII veya Fortessa). </li></ol> 5. QRT-PCR ile analiz Hücrelerinin <ol><li> Hücreleri için akış sitometri ile analiz değil: yüzer toplama sonra,% 1 beta-merkaptotanol içeren 300 ul Oiagen Tampon RLT içinde lyse hücreler. Protokolü ile devam değilse, hücreler bu noktadan sonra -80 ° C &#39;de dondurulabilir. </li><li> Üreticinin protokolü takip edilerek, bir RNA izolasyon kiti kullanarak, RNA izole edilir. </li><li> Üreticinin protokolü takip edilerek, bir cDNA sentez kiti kullanılarak RNA&#39;dan cDNA sentez. </li><li> SYBR Green teknolojisi kullanılarak kantitatif PCR gerçekleştirin. </li><li> 10 uM&#39;lik nihai bir konsantrasyon vermek üzere su içermeyen nükleaz primerlerin eklenmesiyle hazırlık geninin (örneğin, IL-13, IL-10, IFN-γ, GAPDH) dahil olmak üzere, kullanılan her bir primer için bir primer karışımını oluşturmakuM. Buz üzerinde tutmak. </li><li> 10,5 ul nükleazsız su, 12.5 ul SYBR yeşil ve plaka başına 1 ul primer karışımı ekleyerek her primer için bir ana karışımı oluşturun. Buz üzerinde tutmak. </li><li> Kullanılacak, plakanın her oyuğuna pipetle 24 ul ana karışımı. </li><li> Şablona göre her kuyuya 1 ul cDNA ekleyin. </li><li> 800 rcf 3 dakika boyunca kuyu ve santrifüj plaka Cap. </li><li> Bir Mah-PCR makinesi, örneğin bir Stratagene MX3005P enstrüman üzerinde plakayı. </li></ol> 6. 48 saat sonra hücre içi sitokin boyama için İntibak Brefeldin ve Monensin önce hücre içi sitokin boyama 6 saat ekleyin. Monensin, üreticinin talimatlarına uygun olarak ilave edilirken Brefeldin 10 ug / ml &#39;lik bir konsantrasyonda ilave edilir. Kolaylık sağlamak için, Brefeldin 5 ug / ml &#39;lik bir konsantrasyonda leke önce 12 saat eklenebilir. <ol><li> Yüzey leke sonra, en çok PBS% 1 FBS ve leke ile yıkama hücreleriIL-12, IFN-γ, ve bir tespit / Permeabilization Solution kiti ve protokol kullanılarak TNF-α gibi ekstrasellüler sitokinler. </li><li> 250 ul PBS,% 1 FBS içinde hücreler tekrar süspansiyon yıkayın ve (örneğin, BD LSR II veya Fortessa) akış sitometresi bir MULTILASER çalışır. </li></ol> 7. Hücreleri Ayırma adaptasyon <ol><li> Canlılığı için stimülasyon, leke sonra 16 saat üreticinin protokolüne göre / CANLI ÖLÜ tamir edilebilir Ölü Hücre Leke Kit kullanarak. Tüm işlem sırasında hücreleri buz üzerinde tutun. </li><li> 340 RCF ve 4 ° C &#39;de, 7 dakika boyunca PBS ile yıkayın hücrelerin 100 ul PBS% 1 FBS içinde süspanse edin. </li><li> Karıştırmak için yüzey antikorlar, vorteks ekleyin ve 20 dakika boyunca karanlıkta buz üzerinde hücrelerin inkübe edilir. </li><li> 340 RCF ve 4 ° C&#39;de PBS,% 1 FBS ile yıkanır ve hücreler tekrar süspansiyon 500 ul% 10 Fetal Bovine Serum ihtiva eden soğuk RPMI 1640 50 IU Penisilin, 50 | ig / ml streptomisin, 2 mM L-glutamin ve% 1 ile desteklenmiş hepes. </li><li> 5 ml polistiro kullanılarak Filtre hücreleriHücre-Süzgeç kapaklı rene Yuvarlak Dipli Tube. </li><li> Fetal Bovine Serum 50 IU Penisilin, 50 | ig / ml streptomisin, 2 mM L-glutamin, ve her bir tüpe,% 1 HEPES ile takviye edilmiş% 10 ihtiva eden 200 | il RPMI 1640 eklenmesi ile bir tür toplama tüpleri hazırlayın. Sıralama sırasında buz üzerinde tüm tüpler tutun. </li><li> Canlı bir enstrüman biyozararli malzeme için donanımlı bir tesiste bulunan (örn. BD FACS Aria II) faiz hücre alt sıralamak. </li><li> Hücreler kriteri edildikten sonra, geriye zaman istenilen miktarda inkübatör ve yüzer toplama / Luminex analizi ve hücre topağı toplama / PCR analizi ile takip yer hücreleri. </li></ol>

<ol>
	<li>Zajac, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+immune+evasion+due+to+persistence+of+activated+T+cells+without+effector+function.">Viral immune evasion due to persistence of activated T cells without effector function.</a> J. Exp. Med. 188, 2205-2213 (1998).</li><li>Wherry, E. J., Blattman, J. N., Murali-Krishna, K., vander Most, R., Ahmed, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+persistence+alters+CD8+T-cell+immunodominance+and+tissue+distribution+and+results+in+distinct+stages+of+functional+impairment.">Viral persistence alters CD8 T-cell immunodominance and tissue distribution and results in distinct stages of functional impairment.</a> J. Virol. 77, 4911-4927 (2003).</li><li>Kwon, D. S., Kaufmann, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protective+and+detrimental+roles+of+IL-10+in+HIV+pathogenesis.">Protective and detrimental roles of IL-10 in HIV pathogenesis.</a> Eur. Cytokine Netw. 21, 208-214 (2010).</li><li>Porichis, F., Kaufmann, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+PD-1+in+HIV+pathogenesis+and+as+target+for+therapy.">Role of PD-1 in HIV pathogenesis and as target for therapy.</a> Curr. HIV/AIDS Rep. 9, 81-90 (2012).</li><li>Wherry, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T+cell+exhaustion.">T cell exhaustion.</a> Nat. 12, 492-499 (2011).</li><li>Trautmann, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Upregulation+of+PD-1+expression+on+HIV-specific+CD8++T+cells+leads+to+reversible+immune+dysfunction.">Upregulation of PD-1 expression on HIV-specific CD8+ T cells leads to reversible immune dysfunction.</a> Nat. Med. 12, 1198-1202 (2006).</li><li>Day, C. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PD-1+expression+on+HIV-specific+T+cells+is+associated+with+T-cell+exhaustion+and+disease+progression.">PD-1 expression on HIV-specific T cells is associated with T-cell exhaustion and disease progression.</a> Nature. 443, 350-354 (2006).</li><li>Brockman, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IL-10+is+up-regulated+in+multiple+cell+types+during+viremic+HIV+infection+and+reversibly+inhibits+virus-specific+T+cells.">IL-10 is up-regulated in multiple cell types during viremic HIV infection and reversibly inhibits virus-specific T cells.</a> Blood. 114, 346-356 (2009).</li><li>Barber, D. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Restoring+function+in+exhausted+CD8+T+cells+during+chronic+viral+infection.">Restoring function in exhausted CD8 T cells during chronic viral infection.</a> Nature. 439, 682-687 (2006).</li><li>Zhang, J. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PD-1+up-regulation+is+correlated+with+HIV-specific+memory+CD8++T-cell+exhaustion+in+typical+progressors+but+not+in+long-term+nonprogressors.">PD-1 up-regulation is correlated with HIV-specific memory CD8+ T-cell exhaustion in typical progressors but not in long-term nonprogressors.</a> Blood. 109, 4671-4678 (2007).</li><li>Ndhlovu, Z. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-dimensional+immunomonitoring+models+of+HIV-1-specific+CD8+T-cell+responses+accurately+identify+subjects+achieving+spontaneous+viral+control.">High-dimensional immunomonitoring models of HIV-1-specific CD8 T-cell responses accurately identify subjects achieving spontaneous viral control.</a> Blood. 121, 801-811 (2013).</li><li>Porichis, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Responsiveness+of+HIV-specific+CD4+T+cells+to+PD-1+blockade.">Responsiveness of HIV-specific CD4 T cells to PD-1 blockade.</a> Blood. 118, 965-974 (2011).</li><li>Kwon, D. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD4++CD25++regulatory+T+cells+impair+HIV-1-specific+CD4+T+cell+responses+by+upregulating+interleukin-10+production+in+monocytes.">CD4+ CD25+ regulatory T cells impair HIV-1-specific CD4 T cell responses by upregulating interleukin-10 production in monocytes.</a> 86, 6586-6594 (2012).</li></ol>

Yazarlar, hiçbir rakip mali çıkarlarını olmadığını beyan ederim.

Supernatant koleksiyonu bu deneysel tasarım bir zorunluluk parçasıdır. Luminex deneyi için süpernatantlar hasat zaman, tam bölünen miktarları yapılan ve donma-erime döngüleri nedeniyle protein bozulmasını önlemek için -80 ° C&#39;de tutuldu. Dondurma ve eritme proteinler için ve dondurularak çözülür en aza indirerek sert işlemler olabilir, sinyal deneylerde maksimize edilir. Bu nedenle, bu kez aynı sayıda dondurularak çözülmüş edilmiş alikotlarından çalışırken, tekrarlanabilir ve daha...

Kalıcı viral enfeksiyonlar esnasında, virüs spesifik T-hücreleri, T hücresi bitkinlik olarak bilinen bir işlem fonksiyonel kusurlar kazanır. Erken kronik viral enfeksiyonun LCMV murin modelinde in vivo çalışmalarda tükenmiş virüs spesifik T hücreleri, viral yönden enfekte edilmiş hücrelere karşı sitolitik fonksiyon düşük çoğalma yeteneğini kaybeder ve bu IL-2, TNF-a gibi sitokinler üretmek için kapasitesi düşük olduğunu göstermiştir α ve 1,2 IFN-γ. Örneğin PD-1 ve IL-10 gibi bağışıklık yolların, karmaşık bir ağ, kronik enfeksiyonlar sırasında yukarı düzenlenen ve (3,4 gözden) T hücre fonksiyon bozukluğuna katkıda bulunur. Olarak, LCMV fare Bu engelleyici yolların karşı bloke edici antikor vivo tatbikat model T hücresi tükenme (5 gözden), kısmen geri fenomen olduğunu gösteren, tükenmiş virüs spesifik T hücrelerinin fonksiyonunu ve gelişmiş viral açıklık geri. Th BulgularE LCMV modeli hızlı bir şekilde HBV, HCV ve HIV 5 gibi insan kronik viral enfeksiyonların uzatıldı. Kronik HIV-1 enfeksiyonunda, PD-1 ve IL-10 yollar enfekte olmuş kişilerde yukarı regüle edilir ve CD4 ile ters viral yük ve doğrudan, hastalığın ilerlemesi parametreleri ile ilişkili 6-8 sayılır. LCMV fare modeline benzer, insanlardaki T hücresi tükenme, kısmen geri olgudur belirten HIV spesifik CD4 ve CD8 T hücrelerinin in vitro çoğalması geri PD-1 ya da IL-10 yollarının antikor blokajı. Bununla birlikte, hassas insan örnekleri üzerinde deneyler doğa hem de in vitro deneyleri, bu girişimlerin elde fonksiyonel restorasyon profillerin ayrıntılı soruşturma duyarlılığında sınırlamalar nedeniyle çarpıcı yoktur. Çoğalma deneyleri, bugüne kadar, çoğu çalışmalarda test tek güvenilir in vitro deney olmuştur, ancak bu Inter etkisi üzerine kanıt dikkate değer bir eksikliği varon VENTIONS: sitotoksik T hücrelerinin 1) öldürme kapasitesi, 2) viral replikasyonu üzerindeki T hücrelerinin antiviral etkisi, 3) sitokin sekresyon profili ve diğer hücre alt-gruplarla ilgili CD4 T hücresi yardımıyla 4) etkisi. Hücre içi sitokin boyama (ICS) bir çok yararlı ve yaygın olarak kullanılan bir akım farelerde ve insanlarda hem de çeşitli hücre tiplerinde sitokinlerin üretimini tespit etmek için kullanılır sitometrisi göre deneyidir. Ayrıca inhibitör yollarının antikor ablukasının etkisini araştırmak için kullanılır olmuştur. ICS deneylerinde, sitokin salgılama Brefeldin ve / veya Monensin ilavesiyle engellenir. Hücrelerin içinde sıkışıp sitokinler sonra çok renkli akış sitometrisi kullanılarak floresan antikorlar ile tespit edilir. Tipik olarak antijen ilave 2 saat içinde ilave edilir ve Brefeldin Monensin, hem de hücreler için toksik olmasından dolayı, tahlilin süresi genellikle antijen stimülasyonu sonrası 6 veya 12 saat ile sınırlıdır. ICS deney yararlı i olmuştur güçlü bir tekniktirn hücreleri, antikor maruz 9 sonra belli bir süre sonra ekstre edildi farelerde antikor müdahale bloke in vivo etkisinin araştırılması. Bununla birlikte, insan örneklerinde inhibitör reseptörlerin blokajı etkisini değerlendirmek için bu deneysel yaklaşımın uygulanması için çeşitli sınırlamalar vardır. In vitro olarak, bir 6 ya da 12 saat stimülasyonu (insan örnekleri tipik durum) &#39;de önleyici bir yollarının antikor müdahaleler gerçekleştirirken, standart ICS deneyleri ile ölçüldüğü haliyle, çoğu durumda önleyici reseptörlerinin blokajı antijen-spesifik T hücrelerinin yanıt sıklığını değiştirmez 6, 7. Ortalama yoğunluğu ya da ortalama floresan ile ölçülen hücre başına sitokin üretiminin ölçümü tutarsız sonuçlar 6, 7, 10, verdik. Öte yandan, ICS sonra geç bir zaman noktasında gerçekleştirildiğinde stimülasyonu (yani altı gün), sitokin salgılayan c sayısındaki değişimlerarşın gözlenebilir. Farklılıklar değiştirilmiş çoğalma, hayatta kalma ve zaman 6&#39;daki belirtilen süre boyunca birikir efektör fonksiyonu değişiklikleri, bir kombine etkisi vardır. Kısmen, bu sınırlılıkların üstesinden gelmek için bir yolu yayılması ortaya beklemeden sitokin salgı engelleyicinin ilave edilmeden önce antijen ile daha uzun bir süre (örneğin, 36 saat, 60 saat vs.) Boyunca inkübe etmektir. Başarıyla HIV spesifik CD4 ve CD8 T hücreleri tarafından 11,12 sitokin salgılanmasının kinetiklerini belirlemek için bu yöntemi kullandık, ancak bu yaklaşım küçük tepkiler tespit etmek mümkün değildir ve toplam sitokin salgı meydana gelen entegre bir sonucu vermeyecektir stimülasyon beri. Bu nedenle, ICS supernatan sitokin mRNA miktarının ya da sitokin salgılanması ölçümleri ile karşılaştırıldığında aktive T hücreleri tarafından üretilen sitokin inhibe edici miktarına yollarının blokajı etkisini tespit etmek için yeterince hassas bir yöntem değildirAynı zaman noktalarında t. Ayrıca, aktive edilmiş T hücreleri tarafından üretilen sitokinlerden çok pozitif ya da negatif geri besleme katkıda otokrin bir şekilde hareket antijen sunan hücreler ile etkileşim aracılığıyla döner. Bu nedenle, tahlil sırasında ICS Brefeldin veya Monensin ilavesi sitokin salgılanmasını önler ve böylece T hücrelerinin uyarılması optimal değildir. Son olarak, ICS ile birden fazla sitokin tespiti akış sitometrisi ile sitokinlerin belirlenmesi yanı sıra, herhangi bir panelde aynı anda kullanılabilir fluorochromes sayısında kısıtlamalar tarafından kullanılabilirliği ve antikorlar duyarlılığı ile sınırlıdır. Biz hücreler (APC) ve doğal öldürücü hücreler (NK hücreleri) sunulması antijen HIV-spesifik CD4 T hücreleri tarafından sitokin salınımını düzenleyen ve daha sonra CD4 yardım içinde immünregulatuar yolların etkisini değerlendirmek için son derece hassas bir in vitro deneysel bir yaklaşım geliştirdi. Bu yöntem, aynı zamanda Çarpışma değerlendirmek için kullanılabilirPBMC&#39;lerden CD4 T hücreleri tüketen veya sadece CD8 T hücreleri tarafından tanınan uygun peptitler ile uyarılmasıyla CD8 T hücre işlevi üzerindeki inhibitör moleküllerinin blokajının ct. , 2), daha geniş bir paneli araştırmak 1) üretilmiş sitokin düzeylerinin daha doğru bir ölçümü gerçekleştirmek: hücre içi sitokin boyama deneyleri aksine olarak, edebilmek amacıyla, HIV-özgü CD4 T-hücreleri tarafından sitokin salgılanması ile müdahale karar sitokinler veya efektör moleküller, ve 3) diğer hücre alt-gruplarla ilgili HIV-özgü CD4 T-hücreleri tarafından üretilen sitokin etkisini değerlendirmek. Biz, ilgi konusu bağışıklık yolu için bloke edici antikorların mevcudiyetinde bir HIV-1 Gag peptidi havuzlu CD8 tükenmiş PBMC uyarır. Inkübasyon, genellikle 48 saat içinde arzu edilen süre sonra, boncuk dizileri ile sitokin salgılanmasını ölçmek ve farklı hücre alt fenotipik analizi için ya da transkripsiyonel analizi için ya da hücre pelletleri toplamak için süpernatantlar toplamak. Of t dikkat,Onun 48 saat zaman noktası, biz T hücreleri 12 çoğalan önemli bir nüfus tespit yok. Bu esnek bir yaklaşım ve bu tasarımın bazı uyarlamaların farklı hipotezler gidermek için uygulanabilir. Örneğin, (örneğin, vb HIV spesifik CD4 T hücreleri veya PD-1 yüksek CD4 T hücreleri gibi). Tek hücre alt yüzer ve hücre topakları toplanması ve ardından 36 saat süre ile inkübasyondan önce, daha kuluçkalamadan 12 saat sonra sıralanabilir daha spesifik PBMC&#39;lerin tanımlanmış alt popülasyonlar tarafından sitokin salgılanması üzerindeki abluka müdahalelerin etkisini araştırmak için.

<table border="1">
		<tbody>
		 <tr>
			<td>Name of Reagent/Material</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		 </tr>
		 <tr>
			<td>Hanks Balanced Salt Solution without Ca2+ or Mg2+</td>
			<td>Sigma</td>
			<td>H9394</td>
			<td></td>
		 </tr>
		 <tr>
			<td>RPMI 1640</td>
			<td>Sigma</td>
			<td>R0883</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Histopaque-1077</td>
			<td>Sigma</td>
			<td>10771</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Human Serum AB</td>
			<td>Gemini BioProducts</td>
			<td>100-512</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Penicillin/Streptomycin</td>
			<td>Mediatech</td>
			<td>30 001 CI</td>
			<td></td>
		 </tr>
		 <tr>
			<td>L-glutamine</td>
			<td>Mediatech</td>
			<td>25 005 CI</td>
			<td></td>
		 </tr>
		 <tr>
			<td>HEPES buffer</td>
			<td>Mediatech</td>
			<td>25060CI</td>
			<td></td>
		 </tr>
		 <tr>
			<td>FcR blocking reagent, human</td>
			<td>Miltenyi</td>
			<td>130-059-901</td>
			<td></td>
		 </tr>
		 <tr>
			<td>RosetteSep Human CD8+ Depletion Cocktail </td>
			<td>Stem Cell </td>
			<td>15663</td>
			<td></td>
		 </tr>
		 <tr>
			<td>LIVE/DEAD Fixable Dead Cell Stain Kit, for UV excitation</td>
			<td>Invitrogen</td>
			<td>L23105</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Rneasy Mini Kit</td>
			<td>Qiagen</td>
			<td>74104</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Improm-II Reverse Transcription System</td>
			<td>Promega</td>
			<td>A3800</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Brilliant II SYBR qPCR Low Rox Master Mix</td>
			<td>Agilent</td>
			<td>600830</td>
			<td></td>
		 </tr>
		 <tr>
			<td>BD Cytofix/Cytoperm Fixation/Permeabilization Solution Kit</td>
			<td>BD</td>
			<td>554714</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Tween-20</td>
			<td>Fisher</td>
			<td>BP337100</td>
			<td></td>
		 </tr>
		 <tr>
			<td>IFN-&gamma; primer</td>
			<td>Invitrogen</td>
			<td></td>
			<td>FOR: CGAGATGACTTCGAAAAGCTGA REV: TCTTCGACCTCGAAACAGCA</td>
		 </tr>
		 <tr>
			<td>GAPDH primer</td>
			<td>Invitrogen</td>
			<td></td>
			<td>FOR: TCATCATCTCTGCCCCCTCT REV: AGTGATGGCATGGACTGTGG</td>
		 </tr>
		</tbody>
 </table>

in vitro assay to evaluate the impact of immunoregulatory pathways on hiv-specific cd4 t cell effector function

T hücre bitkinlik kronik viral enfeksiyonlar sırasında başarısız patojen klirensinde önemli bir faktördür. Örneğin PD-1 ve IL-10 gibi bağışıklık düzenleyici yolları, bu devam eden antijen maruz kalma üzerine yukarı regüle ve proliferasyonu kaybı, düşük sitolitik işlevine katkı ve CD4 ve CD8 T hücreleri tarafından sitokin üretimi bozulmaktadır. LCMV enfeksiyonunun murin modelinde, T hücresi tepkilerini artmış olarak bu iki yolun karşı bloke edici antikorların uygulanması. Bununla birlikte, insan örneklerinden hücrelerinde sitokin salgılanması üzerindeki bu blokajı etkisini ölçmek için bir in vitro deney, şu anda mevcuttur. Bizim protokolü ve deneysel yaklaşım doğru ve verimli bir şekilde HIV bulaşmış bireylerden HIV-özgü CD4 T-hücreleri tarafından sitokin üretiminin restorasyon ölçmek için olanak sağlar. Burada, HIV-özgü CD4 T hücreleri ve diğer cel üzerindeki etkisi ile sitokin salgılanmasının ölçümü sağlayan bir in vitro deney tasarımı tasvirl kümeler. CD8 T hücreleri, bütün kandan tükenmiş ve kalan PBMC Ficoll ayırma yöntemi ile izole edildi. CD8-tükenmiş PBMC daha sonra, bir HIV-1 Gag peptidi havuzu ile uyarıldıktan sonra, hücreler, 37 ° C,% 5 CO2 inkübe edildi, PD-L1 ve / veya IL-10Rα karşı bloke edici antikor ile inkübe edilmiştir. 48 saat sonra, yüzer boncuk diziler ve hücre topakları tarafından sitokin analizi için toplandı, sonra, qRT-PCR kullanılarak sitometri veya transkripsiyonel analizi kullanılarak akış fenotipik analizi ya da toplandı. Daha ayrıntılı analiz için, farklı hücre popülasyonları PBMC&#39;lerden selektif alt azalması ile ya da aynı deneylerde değerlendirilen önce akış sitometrisi kullanılarak sıralama ile elde edilmiştir. Bu yöntemler, antijene özgü T-yardımcı hücreleri tarafından sitokin üretiminin modülasyonu tespit etmek ve bağışıklık hücrelerinin farklı popülasyonlar arasında fonksiyonel etkileşimi belirlemek için son derece hassas ve özel bir yaklaşım sağlar.

Bu in vitro bir sistem kullanılarak sitokin ölçümleri gerçekleştirirken, bu uyarım kontrol ile karşılaştırıldığında herhangi bir antijene özgü yanıtları ayırt edebilmek için gereklidir. Genel olarak, bu kontrol ve uyarım tahlilin lineer aralığı içindeydi no göre sitokin seviyelerinde en azından üç kat bir artış elde antijenik uyarımı herhangi bir değeri pozitif tepkiler olarak. Zayıf bir antijene özgü CD4 T hücresi tepkilerini gözlemlemek kılar, 0.16 pg / ml gibi düşü...

Watch this Scientific Journal Video about In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function at JoVE.com

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

Biz HIV-spesifik CD4 T hücreleri tarafından sitokin salgılanmasının düzenlenmesinde immünregulatuar yolların rolünü araştırmak için bir in vitro testi geliştirdi.

Vitro Testi HIV-spesifik CD4 T hücre efektör işlevi üzerinde immünoregülatör yolları etkisini değerlendirmek için

T cell exhaustion is a major factor in failed pathogen clearance during chronic viral infections. Immunoregulatory pathways, such as PD-1 and IL-10, are ...

in-vitro-assay-to-evaluate-impact-immunoregulatory-pathways-on-hiv

Research

JoVE Journal

Immunology and Infection

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

14.0K Görüntüleme.  The Ragon Institute of MGH, MIT and Harvard.  Biz HIV-spesifik CD4 T hücreleri tarafından sitokin salgılanmasının düzenlenmesinde immünregulatuar yolların rolünü araştırmak için bir in vitro testi geliştirdi. 

Video: In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

Isolation and Th17 Differentiation of Na&iuml;ve CD4 T Lymphocytes

Th17 cells are a distinct subset of T cells that have been found to produce interleukin 17 (IL-17), and differ in function from the other T cell subsets including Th1, Th2, and regulatory T cells. Th17 cells have emerged as a central culprit in overzealous inflammatory immune responses associated with many autoimmune disorders. In this method we purify T lymphocytes from the spleen and lymph nodes of C57BL/6 mice, and stimulate purified CD4+ T cells under control and Th17-inducing environments. The Th17-inducing environment includes stimulation in the presence of anti-CD3 and anti-CD28 antibodies, IL-6, and TGF-&#946;. After incubation for at least 72 hours and for up to five days at 37 &#176;C, cells are subsequently analyzed for the capability to produce IL-17 through flow cytometry, qPCR, and ELISAs. Th17 differentiated CD4+CD25- T cells can be utilized to further elucidate the role that Th17 cells play in the onset and progression of autoimmunity and host defense. Moreover, Th17 differentiation of CD4+CD25- lymphocytes from distinct murine knockout/disease models can contribute to our understanding of cell fate plasticity.

Isolation and Th17 Differentiation of Na&amp;#239;ve CD4 T Lymphocytes

With effector functions distinct from other T cell subsets, Th17 cells have been centrally implicated in inflammatory autoimmunity. This in vitro Th17 differentiation protocol provides a means to determine whether na&#239;ve CD4+ T lymphocytes can differentiate into Th17 cells, and to further examine their role in autoimmunity and host response.

İzolasyon ve naif CD4 T Lenfositler Th17 Farklılaşma

Th17 cells are a distinct subset of T cells that have been found to produce interleukin 17 (IL-17), and differ in function from the other T cell subsets ...

İmmünoloji ve Enfeksiyon

Transplantation of Tail Skin to Study Allogeneic CD4 T Cell Responses in Mice

The study of T cell responses and their consequences during allo-antigen recognition requires a model that enables one to distinguish between donor and host T cells, to easily monitor the graft, and to adapt the system in order to answer different immunological questions. Medawar and colleagues established allogeneic tail-skin transplantation in mice in 1955. Since then, the skin transplantation model has been continuously modified and adapted to answer specific questions. The use of tail-skin renders this model easy to score for graft rejection, requires neither extensive preparation nor deep anesthesia, is applicable to animals of all genetic background, discourages ischemic necrosis, and permits chemical and biological intervention. 
In general, both CD4+ and CD8+ allogeneic T cells are responsible for the rejection of allografts since they recognize mismatched major histocompatibility antigens from different mouse strains. Several models have been described for activating allogeneic T cells in skin-transplanted mice. The identification of major histocompatibility complex (MHC) class I and II molecules in different mouse strains including C57BL/6 mice was an important step toward understanding and studying T cell-mediated alloresponses. In the tail-skin transplantation model described here, a three-point mutation (I-Abm12) in the antigen-presenting groove of the MHC-class II (I-Ab) molecule is sufficient to induce strong allogeneic CD4+ T cell activation in C57BL/6 mice. Skin grafts from I-Abm12 mice on C57BL/6 mice are rejected within 12-15 days, while syngeneic grafts are accepted for up to 100 days. The absence of T cells (CD3-/- and Rag2-/- mice) allows skin graft acceptance up to 100 days, which can be overcome by transferring 2 x 104 wild type or transgenic T cells. Adoptively transferred T cells proliferate and produce IFN-&#947; in I-Abm12-transplanted Rag2-/- mice.

Tail-skin transplantation is a powerful model for studying T cell-dependent rejection and tolerance induction during allogeneic immune responses in mice. The advantages of this protocol are minor invasive surgery, and ease of monitoring with no need to sacrifice the recipient mouse.

Farelerde allojenik CD4 + T hücre Cevapları Eğitim için Kuyruk Cilt Nakli

The study of T cell responses and their consequences during allo-antigen recognition requires a model that enables one to distinguish between donor and ...

Image-based Flow Cytometry Technique to Evaluate Changes in Granulocyte Function In Vitro

Granulocytes play a key role in the body&#8217;s innate immune response to bacterial and viral infections. While methods exist to measure granulocyte function, in general these are limited in terms of the information they can provide. For example, most existing assays merely provide a percentage of how many granulocytes are activated following a single, fixed length incubation. Complicating matters, most assays focus on only one aspect of function due to limitations in detection technology. This report demonstrates a technique for simultaneous measurement of granulocyte phagocytosis of bacteria and oxidative burst. By measuring both of these functions at the same time, three unique phenotypes of activated granulocytes were identified: 1) Low Activation (minimal phagocytosis, no oxidative burst), 2) Moderate Activation (moderate phagocytosis, some oxidative burst, but no co-localization of the two functional events), and 3) High Activation (high phagocytosis, high oxidative burst, co-localization of phagocytosis and oxidative burst). A fourth population that consisted of inactivated granulocytes was also identified. Using assay incubations of 10, 20, and 40-min the effect of assay incubation duration on the redistribution of activated granulocyte phenotypes was assessed. A fourth incubation was completed on ice as a control. By using serial time incubations, the assay may be able to able to detect how a treatment spatially affects granulocyte function. All samples were measured using an image-based flow cytometer equipped with a quantitative imaging (QI) option, autosampler, and multiple lasers (488, 642, and 785 nm).

Image-based Flow Cytometry Technique to Evaluate Changes in Granulocyte Function In Vitro

This method demonstrates a technique for assessing granulocyte function by simultaneously measuring phagocytosis of bacteria and oxidative burst. Image-based flow cytometry allowed for the identification of three distinct subsets of activated granulocytes that all differed in their relative functional capacity.

Görüntü tabanlı Sitometrisi Tekniği Granülosit Fonksiyonu Değişiklikleri değerlendirin<em&gt; İn Vitro</em

Granulocytes play a key role in the body&#8217;s innate immune response to bacterial and viral infections. While methods exist to measure granulocyte ...

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

There are many different animal models available for studying the pathogenesis of human inflammatory bowel diseases (IBD), each with its own advantages and disadvantages. We describe here an experimental colitis model that is initiated by adoptive transfer of syngeneic splenic CD4+CD45RBhigh T cells into T and B cell deficient recipient mice. The CD4+CD45RBhigh T cell population that largely consists of na&#239;ve effector cells is capable of inducing chronic intestinal inflammation, closely resembling key aspects of human IBD. This method can be manipulated to study aspects of disease onset and progression. Additionally it can be used to study the function of innate, adaptive, and regulatory immune cell populations, and the role of environmental exposures, i.e., the microbiota, in intestinal inflammation. In this article we illustrate the methodology for inducing colitis with a step-by-step protocol. This includes a video demonstration of key technical aspects required to successfully develop this murine model of experimental colitis for research purposes.

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

Here, we present a protocol to induce colonic inflammation in mice by adoptive transfer of syngeneic CD4+CD45RBhigh T cells into T and B cell deficient recipients. Clinical and histopathological features mimic human inflammatory bowel diseases. This method allows the study of the initiation of colonic inflammation and progression of disease.

Efektör CD4 Evlatlık transferi ile Kemirgen Bağırsak Enflamasyon indüksiyonu<sup&gt; +</sup&gt; CD45RB<sup&gt; Yüksek</sup&gt; Bağışık yetmezliği olan farelere içine T Hücreleri

There are many different animal models available for studying the pathogenesis of human inflammatory bowel diseases (IBD), each with its own advantages ...

Mouse Na&#239;ve CD4+ T Cell Isolation and In vitro Differentiation into T Cell Subsets

Antigen inexperienced (na&#239;ve) CD4+ T cells undergo expansion and differentiation to effector subsets at the time of T cell receptor (TCR) recognition of cognate antigen presented on MHC class II. The cytokine signals present in the environment at the time of TCR activation are a major factor in determining the effector fate of a na&#239;ve CD4+ T cell. Although the cytokine environment during na&#239;ve T cell activation may be complex and involve both redundant and opposing signals in vivo, the addition of various cytokine combinations during naive CD4+ T cell activation in vitro can readily promote the establishment of effector T helper lineages with hallmark cytokine and transcription factor expression. Such differentiation experiments are commonly used as a first step for the evaluation of targets believed to promote or inhibit the development of certain CD4+ T helper subsets. The addition of mediators, such as signaling agonists, antagonists, or other cytokines, during the differentiation process can also be used to study the influence of a particular target on T cell differentiation. Here, we describe a basic protocol for the isolation of na&#239;ve T cells from mouse and the subsequent steps necessary for polarizing na&#239;ve cells to various T helper effector lineages in vitro.

Mouse Na&amp;#239;ve CD4+ T Cell Isolation and In vitro Differentiation into T Cell Subsets

Na&#239;ve CD4+ T cells polarize to various subsets depending on the environment at the time of activation. The differentiation of na&#239;ve CD4+ T cells to various effector subsets can be achieved in vitro through the addition of T cell receptor stimuli and specific cytokine signals.

Fare Naif CD4<sup&gt; +</sup&gt; T Hücre İzolasyonu ve<em&gt; In vitro</em&gt; T hücre alt içine Farklılaşma

Antigen inexperienced (na&#239;ve) CD4+ T cells undergo expansion and differentiation to effector subsets at the time of T cell receptor (TCR) recognition ...

Application of Long-term cultured Interferon-&#947; Enzyme-linked Immunospot Assay for Assessing Effector and Memory T Cell Responses in Cattle

Effector and memory T cells are generated through developmental programing of na&#239;ve cells following antigen recognition. If the infection is controlled up to 95 % of the T cells generated during the expansion phase are eliminated (i.e., contraction phase) and memory T cells remain, sometimes for a lifetime. In humans, two functionally distinct subsets of memory T cells have been described based on the expression of lymph node homing receptors. Central memory T cells express C-C chemokine receptor 7 and CD45RO and are mainly located in T-cell areas of secondary lymphoid organs. Effector memory T cells express CD45RO, lack CCR7 and display receptors associated with lymphocyte homing to peripheral or inflamed tissues. Effector T cells do not express either CCR7 or CD45RO but upon encounter with antigen produce effector cytokines, such as interferon-&#947;. Interferon-&#947; release assays are used for the diagnosis of bovine and human tuberculosis and detect primarily effector and effector memory T cell responses. Central memory T cell responses by CD4+ T cells to vaccination, on the other hand, may be used to predict vaccine efficacy, as demonstrated with simian immunodeficiency virus infection of non-human primates, tuberculosis in mice, and malaria in humans. Several studies with mice and humans as well as unpublished data on cattle, have demonstrated that interferon-&#947; ELISPOT assays measure central memory T cell responses. With this assay, peripheral blood mononuclear cells are cultured in decreasing concentration of antigen for 10 to 14 days (long-term culture), allowing effector responses to peak and wane; facilitating central memory T cells to differentiate and expand within the culture.

Application of Long-term cultured Interferon-&amp;#947; Enzyme-linked Immunospot Assay for Assessing Effector and Memory T Cell Responses in Cattle

Long-term cultured interferon-&#947; enzyme-linked immunospot assay is used as a measure of central memory responses and correlates with protective anti-mycobacterial vaccine responses. With this assay, peripheral blood mononuclear cells are stimulated with mycobacterial antigens and interleukin-2 for 14 days, enabling differentiation and expansion of central memory T cells.

Sığırlarda Efektör ve hafıza T Hücre Yanıtları değerlendirilmesi için uzun vadeli kültürlü İnterferon-γ Enzim-linked immünospot Testi Uygulaması

Effector and memory T cells are generated through developmental programing of na&#239;ve cells following antigen recognition. If the infection is ...

Imaging CD4 T Cell Interstitial Migration in the Inflamed Dermis

The ability of CD4 T cells to carry out effector functions is dependent upon the rapid and efficient migration of these cells in inflamed peripheral tissues through an as-yet undefined mechanism. The application of multiphoton microscopy to the study of the immune system provides a tool to measure the dynamics of immune responses within intact tissues. Here we present a protocol for non-invasive intravital multiphoton imaging of CD4 T cells in the inflamed mouse ear dermis. Use of a custom imaging platform and a venous catheter allows for the visualization of CD4 T cell dynamics in the dermal interstitium, with the ability to interrogate these cells in real-time via the addition of blocking antibodies to key molecular components involved in motility. This system provides advantages over both in vitro models and surgically invasive imaging procedures. Understanding the pathways used by CD4 T cells for motility may ultimately provide insight into the basic function of CD4 T cells as well as the pathogenesis of both autoimmune diseases and pathology from chronic infections.

The mechanisms that govern the interstitial motility of CD4 effector T cells at sites of inflammation are relatively unknown. We present a non-invasive approach to visualize and manipulate in vitro-primed CD4 T cells in the inflamed ear dermis, allowing for study of the dynamic behavior of these cells in situ.

Iltihaplı Dermisinde içinde görüntüleme CD4 + T hücre Geçiş Göç

The ability of CD4 T cells to carry out effector functions is dependent upon the rapid and efficient migration of these cells in inflamed peripheral ...

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction

Breakdown of the blood-brain barrier (BBB) is a critical step in the development of autoimmune diseases such as multiple sclerosis (MS) and its animal model experimental autoimmune encephalomyelitis (EAE). This process is characterized by the transmigration of activated T cells across brain endothelial cells (ECs), the main constituents of the BBB. However, the consequences on brain EC function upon interaction with such T cells are largely unknown. Here we describe an assay that allows for the evaluation of primary mouse brain microvascular EC (MBMEC) function and barrier integrity during the interaction with T cells over time. The assay makes use of impedance cell spectroscopy, a powerful tool for studying EC monolayer integrity and permeability, by measuring changes in transendothelial electrical resistance (TEER) and cell layer capacitance (Ccl). In direct contact with ECs, stimulated but not na&#239;ve T cells are capable of inducing EC monolayer dysfunction, as visualized by a decrease in TEER and an increase in Ccl. The assay records changes in EC monolayer integrity in a continuous and automated fashion. It is sensitive enough to distinguish between different strengths of stimuli and levels of T cell activation and it enables the investigation of the consequences of a targeted modulation of T cell-EC interaction using a wide range of substances such as antibodies, pharmacological reagents and cytokines. The technique can also be used as a quality control for EC integrity in in vitro T-cell transmigration assays. These applications make it a versatile tool for studying BBB properties under physiological and pathophysiological conditions.

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction

Here, we describe an in vitro murine model of the blood-brain barrier that makes use of impedance cell spectroscopy, with a focus on the consequences on endothelial cell integrity and permeability upon interaction with activated T cells.

bir<em&gt; İn Vitro</em&gt; Empedans Spektroskopisi kullanarak kan-beyin bariyerinin Model: T Hücre-endotelyal hücre Etkileşim Üzerine Bir Odak

Breakdown of the blood-brain barrier (BBB) is a critical step in the development of autoimmune diseases such as multiple sclerosis (MS) and its animal ...

Assessing Retinal Microglial Phagocytic Function In Vivo Using a Flow Cytometry-based Assay

Microglia are the tissue resident macrophages of the central nervous system (CNS) and they perform a variety of functions that support CNS homeostasis, including phagocytosis of damaged synapses or cells, debris, and/or invading pathogens. Impaired phagocytic function has been implicated in the pathogenesis of diseases such as Alzheimer's and age-related macular degeneration, where amyloid-&#946; plaque and drusen accumulate, respectively. Despite its importance, microglial phagocytosis has been challenging to assess in vivo. Here, we describe a simple, yet robust, technique for precisely monitoring and quantifying the in vivo phagocytic potential of retinal microglia. Previous methods have relied on immunohistochemical staining and imaging techniques. Our method uses flow cytometry to measure microglial uptake of fluorescently labeled particles after intravitreal delivery to the eye in live rodents. This method replaces conventional practices that involve laborious tissue sectioning, immunostaining, and imaging, allowing for more precise quantification of microglia phagocytic function in just under six hours. This procedure can also be adapted to test how various compounds alter microglial phagocytosis in physiological settings. While this technique was developed in the eye, its use is not limited to vision research.

Assessing Retinal Microglial Phagocytic Function In Vivo Using a Flow Cytometry-based Assay

Microglial phagocytosis is critical for the maintenance of tissue homeostasis and inadequate phagocytic function has been implicated in pathology. However, assessing microglia function in vivo is technically challenging. We have developed a simple but robust technique for precisely monitoring and quantifying the phagocytic potential of microglia in a physiological setting.

Retina Mikroglial Fagositik Fonksiyonu değerlendirilmesi<em&gt; İn Vivo</em&gt; A Akış Sitometri bazlı analiz kullamlarak

Microglia are the tissue resident macrophages of the central nervous system (CNS) and they perform a variety of functions that support CNS homeostasis, ...

In Vitro Differentiation of Human CD4+FOXP3+ Induced Regulatory T Cells (iTregs) from Na&#239;ve CD4+ T Cells Using a TGF-&#946;-containing Protocol

Regulatory T cells (Tregs) are an integral part of peripheral tolerance, suppressing immune reactions against self-structures and thus preventing autoimmune diseases. Clinical approaches to adoptively transfer Tregs, or to deplete Tregs in cancer, are underway with promising first outcomes. 
Because the number of naturally occurring Tregs (nTregs) is very limited, studying certain Treg features using in vitro induced Tregs (iTregs) can be advantageous. To date, the best although not absolutely specific protein marker to delineate Tregs is the transcription factor FOXP3. Despite the importance of Tregs including non-redundant roles of peripherally induced Tregs, the protocols to generate iTregs are currently controversial, particularly for human cells. This protocol therefore describes the in vitro differentiation of human CD4+FOXP3+ iTregs from human na&#239;ve T cells using a range of Treg-inducing factors (TGF-&#946; plus IL-2 only, or their combination with retinoic acid, rapamycin or butyrate) in parallel. It also describes the phenotyping of these cells by flow cytometry and qRT-PCR. 
These protocols result in reproducible expression of FOXP3 and other Treg signature genes and enable the study of general FOXP3-regulatory mechanisms as well as protocol-specific effects to delineate the impact of certain factors. iTregs can be utilized to study various phenotypic aspects as well as molecular mechanisms of Treg induction. Detailed molecular studies are facilitated by relatively large cell numbers that can be obtained. 
A limitation for the application of iTregs is the relative instability of FOXP3 expression in these cells compared to nTregs. iTregs generated by these protocols can also be used for functional assays such as studying their suppressive function, in which iTregs induced by TGF-&#946; plus retinoic acid and rapamycin display superior suppressive activity. However, the suppressive capacity of iTregs can differ from nTregs and the use of appropriate controls is crucial.

&lt;em&gt;In Vitro&lt;/em&gt; Differentiation of Human CD4&lt;sup&gt;+&lt;/sup&gt;FOXP3&lt;sup&gt;+&lt;/sup&gt; Induced Regulatory T Cells (iTregs) from Na&amp;#239;ve CD4&lt;sup&gt;+&lt;/sup&gt; T Cells Using a TGF-&amp;#946;-containing Protocol

This protocol describes the reproducible generation and phenotyping of human induced regulatory T cells (iTregs) from na&#239;ve CD4+ T cells in vitro. Different protocols for FOXP3 induction allow for the study of specific iTreg phenotypes obtained with respective protocols.

Bir TGF-β-içeren Protokolü kullanılarak naif CD4 + T hücrelerinden insan CD4 + FoxP3 + Bağlı regülatör T hücreleri (iTregs) in vitro ayrımında