RSM NSF Yüksek Lisans Araştırma Bursu fon kabul eder. MBG bir Lewis-Sigler Kardeşliği fon ve Peter Lewis donatılmış hediye kabul eder. DB NIH (GM046406) Sayısal Biyoloji (GM071508) Genel Tıp Bilimleri Merkezi Ulusal Enstitüsü fon kabul eder. Biz akım sitometri deneyler ile yardım için Christina DeCoste kabul.

Şekil 2, protokol bölümleri 1-3 bir şemasını içerir. 1.. Atfs Yaratılış <ol><li> PCR ilgi konusu DNA bağlama alanını yükseltmek için primerler oluşturur. ACT1 promoter ve hormon reseptörüne homoloji (Şekiller 3 ve 4 &#39;de tarif edildiği gibi) gerilme yMN15 içine doğru rekombinasyonu kolaylaştırmak için PCR ile ilave edilir. </li><li> PCR, bir yüksek sadakat polimeraz kullanarak ilgi DBD yükseltmek. </li><li> , Lityum asetat metodu kullanılarak 13 mayaya saflaştınlmış PCR ürünü&gt; 1 ug dönüşümü. </li><li> Mikrosantrifüjde 15 saniye boyunca en yüksek hızda dönüşüm, spin hücreleri aşağıdaki ve dönüşüm karışımı kaldırmak. </li><li> YPD&#39;de steril su ve plaka ~ 200 ul yeniden süspanse. </li><li> Ertesi gün, YPD ikinci kopya plaka 5-FOA plakalar üzerine 13, (Cold Spring Harbor Maya Kılavuzunda tarif edildiği gibi 5-FOA plakaları yapılır). </li><li> 2-4 d büyüme izinAYS, ve restreak en az 5-10 koloniler YPD&#39;de üzerine. Dahil doğrulamak için Tablo 1 ve sırayla primerler kullanılarak bir koloni PCR gerçekleştirin. </li></ol> 2. ATF Plazmid Reporter Yaratılış <ol><li> (Literatürden gelmesi en muhtemel) ATF bağlama bölgesini belirler. </li><li> (Gerekirse, ya Ultramers) Sipariş oligolardan gibi bağlayıcı bölgeyi istenen. Tablo 2&#39;de gösterildiği gibi, Notl ve Xbal için doğru çıkıntılar ile üst ve alt iplikler olarak sipariş. </li><li> Eşit molar konsantrasyonlarda (100 uM) için oligolar seyreltin. </li><li> T4 polinükleotid kinaz ile bir PCR sonra tavlama işlemi kullanılarak fosforile. Reaksiyon koşulları Tablo 3&#39;te bulunmaktadır. </li><li> Digest 1-2 ~ 37 ° C (Tablo 4&#39;te reaksiyon koşulları) 1 saat için HF-Notl ve Xbal ile pMN8 ug. </li><li> Jel omurga bant arındırmak. </li><li> 10 ng / ul saflaştırılmış omurga seyreltin. </li><li> Çift sarmallı, fosforil seyreltinul başına omurgasının molar konsantrasyonunu 5x&#39;e bağlanma yeri ated. </li><li> T4 DNA ligazı kullanılarak, 30 dakika boyunca (Tablo 5), oda sıcaklığında sindirildi omurgasına bağlanma siteleri ligate. </li><li> Transformasyon için, bir standart 50 ul, örneğin XL1-Blue ya da DH5-alfa, kimyasal olarak kompetan Escherichia coli için yarım ligasyon reaksiyonu ekleyin. </li><li> Daha sonra, bir ısı şoku 42 ° C su banyosu içinde 45 saniye için hücre ve 2 dakika boyunca buz üzerine yerleştirin. </li><li> Dönüşüm reaksiyonuna SOC ortamı içinde 900 ul ekleyin. </li><li> Bir silindir tambur üzerinde, 1 saat boyunca 37 ° C&#39;de büyür. </li><li> LB + amp (100 ug / ml) plaka başına 100-200 ul hücre yayıldı ve bir gece boyunca inkübe edilir. </li><li> E. büyümek LB + amp içerisinde coli sıvı ve hasat plazmid DNA. Seri primeri 5&#39;-GTACCTTATATTGAATTTTC-3 &#39;kullanılarak ligasyon koloniler yeni raportör plazmid olun. </li><li> ATF-içeren maya str yeni bir raportör plazmid Dönüşümülityum asetat dönüşümünü kullanarak Bölüm 1 ain. </li></ol> 3. GFP Reporter kullanarak Gen İfade ATF İndüksiyonunun etkisini ölçmek Örneklerinin hazırlanması: <ol><li> 25 mM β-estradiol stok (β-estradiyol etanol + 0,0681 g 10 mi) olun. Buzdolabında tutun. </li><li> ATF + 5ml SC-URA gecede gerginlik Reporter içeren büyütün. </li><li> Elde dokuz 250 ml şişeler sallamak ve her 25 ml SC-URA ekleyin. </li><li> 0 nM, 0.1 nM, 1 nM, 10 nM, 100 nM, 1 uM veya 10 uM β-estradiol ekleyin. Bu, en kolay şekilde, 25 mM β-estradiyol stoklar 10-kat seri dilüsyonları yaparak yapılır. 10 uM β-östradiolün bir son konsantrasyon için, SC-URA 25 ml için 25 mM β-estradiyol stoklar 10 ul ekle. </li><li> Şişelere (1:200 seyreltme) ile gece boyunca kültürler 125 ul ekleyin. </li><li> 2 kalan şişelere, bir konstitütif GFP üreten Strai ile inokülen ve GFP yoksun bir gerginlik. Bu akış sitometresi kalibre edilmesi için ihtiyaç vardır. </li><li> 12-18 saat boyunca 30 ° C&#39;de 200 rpm&#39;de çalkalanır. Not: Optimal inkübasyon süresi GFP indüksiyon artık değişiklik β-estradiyol ilave edildikten sonra zaman belirlenmesi ile belirlenir. </li><li> Her kültürün 500 ul alır ve ayrı 1.7 ml mikrosantrifüj tüpler aşağı spin. </li><li> Aspire SC-URA. </li><li> 1 ml PBS +% 0.1 Tween-20 ve aspirasyon kez yıkayın. </li><li> PBS +% 0.1 Tween-20 ve tekrar süspansiyon 1 ml ilave edilir. </li><li> Falcon tüplerine PBS +% 0.1 Tween-20 içinde 1 ml ilave edilir. </li><li> 5 ml tüpler (son hacim = 2 mi) ile yeniden süspansiyon haline getirilmiş hücreler ekleyin (birkaç gün boyunca 4 ° C de muhafaza edilebilir). </li><li> İsteğe bağlı: dağılmasından hafifçe sonicate hücreler, herhangi clumped hücreleri. Akış sitometri analizi: Genel Bakış: 10.000-100.000 hücrelerinin floresan tipik haliyle numune başına analiz edilir. Veri FlowJo veya MATLAB özel komut dosyalarını kullanarak ya da işlenebilirR. GFP pozitif ve negatif kontrolleri kullanarak GFP kanalın voltajı kalibre emin olun. FCS içerik dışa sonra, bu fonksiyon fca_readfcs (birlikte Şekil 6&#39;da tek bir komut <a href="http://www.mathworks.com/matlabcentral/fileexchange/9608-fcs-data-reader">http://www.mathworks.com/matlabcentral/fileexchange/9608-fcs-data-reader</a> ) işlemek için kullanılabilir Veri. </li><li> Akım sitometri gerçekleştirin. <ol><li> Maya hücreleri tanımlamak için kullanın ileri dağılım (FSC) ve yan dağılım (SSC). </li><li> ~ 3,000 hücre / sn akış hızını ayarlayın. </li><li> GFP (FITC kanal) ölçün. </li><li> Veriler toplandığında, ihracat. FCS dosyaları </li></ol></li><li> MATLAB yükleyin. </li><li> . FCS dosyaları fcs_readfcs.m, ve Şekil 6, aynı klasöre edilene benzer bir komut dosyası taşıyın. </li><li> Veri ve komut dosyalarını içeren klasörü mevcut çalışma dizini değiştirin. </li><li> (Not Şekil 6 komut dosyasını çalıştırın:efsane elle) Şekil 7&#39;de görüldüğü neler üretmek için girildi. </li></ol> 4. Hücre Büyüme ATF İndüksiyonunun etkisini ölçmek <ol><li> Dondurulmuş stokları, hem dışarı çizgi (1) ayrı YPD plakalar üzerine bir ATF içeren suşu (örneğin yMN15 olarak) (2) bir ATF-eksik suşu. </li><li> Büyüme 2 gün sonra, her bir suş ile YPD sıvı ihtiva eden ayrı bir 5 ml kültür tüpleri inoküle ve 30 ° C de bir gece boyunca büyümeye </li><li> 10-kat% 100 etanol içinde 10.000 kat (0.025 uM β-estradiyol) bir 0.25 mM β-estradiyol stok çözelti seri seyreltmeleri yapın. </li><li> YPD sıvı (1-250 seyreltme) 10 ml gece boyunca kültürler 40 ul ekle. </li><li> Ve her bir suş için, 96 oyuklu bir plakanın oyuklarına 18 seyreltilmiş 96 ul hücre ilave edin. </li><li> Hücrelere β-estradiyol 4 ul ekleyin. Önemli bir nokta, her kuyu toplam etanol aynı miktarda emin olmaktır. (Alternatif olarak, mo<html> β-estradiyol konsantre stok kullanılmış ve daha sonra noktasına seyreltilebilir yeniden büyümesi üzerindeki etkisi, etanol içinde) ölçülebilir değildir. </li><li> Üç kez yapın. Her bir suş için kuyu üç etanol okunur kontrol olmalıdır. </li><li> Gaz geçirgen bir zarın içinde 96 oyuklu plaka örtün. </li><li> Plaka okuyucu büyüme (OD 600) izleyin. </li><li> Gibi maksimum eğim bulgu olarak standart yöntemlerin herhangi biri kullanılarak büyüme oranlarını ölçmek. Not: R programlama ortamında çalışır açık kaynak yazılım paketi grofit 14 ile iyi bir başarı elde ettik Bu söz değer olduğunu 96-plaka deneyleri hesaplanan büyüme oranları (25 ml kültür)-şişeleri sallamak göre ise. ille (nedeniyle fizyolojisi ve enstrümantasyon hem de farklılıklar), biz (bu her zaman böyle olmayabilir ama) göreceli büyüme oranları benzer olduğunu tespit ettik aynı. </li></ol>tle &quot;&gt; 5. Başlatılabilen Genomik alellerin oluşturun <ol><li> PMN10, (zıt oryantasyonda) KanMX kaynaşmış pMN8 arasındaki ATF-duyarlı promoteri ile bir noncentromeric plazmid elde edilir. </li><li> Kısıtlama, Bölüm 2&#39;deki gibi vektör omurgası ve jel özü sindirimi. </li><li> Tavlama, fosforile ve Bölüm 2&#39;de tarif edildiği gibi uygun bir bağlama siteleri içeren ligate oligolar. </li><li> Dizisi doğrulayın. Bu durumda plazmit, uyarılabilir alel yaratmak için, bir DNA şablonu olarak hizmet edecektir. </li><li> Ilgi konusu karşılık gelen ATF ifade eden maya suşu elde edilir. </li><li> PCR Tablo 6 primerleri kullanılarak KanMX-Promoter kaseti (~ 2 kb) yükseltmek. </li><li> , Lityum asetat metodu kullanılarak ATF-ifade suşu içine PCR ürünü dönüşümü. </li><li> YPD&#39;de + G418 ertesi gün üzerine YPD&#39;de ve çoğaltma plaka üzerinde plaka. </li><li> Inci ileri primeri (5&#39;-CTGCAGCGAGGAGCCGTAAT-3 &#39;) ve ters primer iç kullanılarak promotörün uygun ekleme teyitolan promoter gen e değiştirilmiştir. Ters primer genellikle ilk ATG 15 bp alt akışında 200-300 arasında olacak şekilde tasarlanmıştır. Nihai PCR ürünü, ~ 1.2 kb&#39;dir. </li></ol>

<ol>
	<li>McIsaac, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+gene+expression+perturbation+systems+with+rapid,+tunable,+single-gene+specificity+in+yeast.">Synthetic gene expression perturbation systems with rapid, tunable, single-gene specificity in yeast.</a> Nucleic acids res. 41, e57 (2013).</li><li>McIsaac, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast-acting+and+nearly+gratuitous+induction+of+gene+expression+and+protein+depletion+in+Saccharomyces+cerevisiae.">Fast-acting and nearly gratuitous induction of gene expression and protein depletion in Saccharomyces cerevisiae.</a> Mol. Biol. cell. 22, 4447-4459 (2011).</li><li>Louvion, J. F., Havaux-Copf, B., Picard, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fusion+of+GAL4-VP16+to+a+steroid-binding+domain+provides+a+tool+for+gratuitous+induction+of+galactose-responsive+genes+in+yeast.">Fusion of GAL4-VP16 to a steroid-binding domain provides a tool for gratuitous induction of galactose-responsive genes in yeast.</a> Gene. 131, 129-134 (1993).</li><li>Littlewood, T. D., Hancock, D. C., Danielian, P. S., Parker, M. G., Evan, G. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+modified+oestrogen+receptor+ligand-binding+domain+as+an+improved+switch+for+the+regulation+of+heterologous+proteins.">A modified oestrogen receptor ligand-binding domain as an improved switch for the regulation of heterologous proteins.</a> Nucleic acids res. 23, 1686-1690 (1995).</li><li>McIsaac, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+and+Analysis+of+mRNA+Molecules+Using+Fluorescence+In+Situ+Hybridization+in+Saccharomyces+cerevisiae.">Visualization and Analysis of mRNA Molecules Using Fluorescence In Situ Hybridization in Saccharomyces cerevisiae.</a> J. Vis. Exp. (76), e50382 (2013).</li><li>McIsaac, R. S., Petti, A. A., Bussemaker, H. J., Botstein, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Perturbation-based+analysis+and+modeling+of+combinatorial+regulation+in+the+yeast+sulfur+assimilation+pathway.">Perturbation-based analysis and modeling of combinatorial regulation in the yeast sulfur assimilation pathway.</a> Mol. Biol. cell. 23, 2993-3007 (2012).</li><li>Belli, G., Gari, E., Piedrafita, L., Aldea, M., Herrero, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+activator/repressor+dual+system+allows+tight+tetracycline-regulated+gene+expression+in+budding+yeast.">An activator/repressor dual system allows tight tetracycline-regulated gene expression in budding yeast.</a> Nucleic acids res. 26, 942-947 (1998).</li><li>Baron, U., Bujard, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tet+repressor-based+system+for+regulated+gene+expression+in+eukaryotic+cells:+principles+and+advances.">Tet repressor-based system for regulated gene expression in eukaryotic cells: principles and advances.</a> Meth. Enzymol. 327, 401-421 (2000).</li><li>Kodama, S., Okada, K., Akimoto, K., Inui, H., Ohkawa, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recombinant+aryl+hydrocarbon+receptors+for+bioassay+of+aryl+hydrocarbon+receptor+ligands+in+transgenic+tobacco+plants.">Recombinant aryl hydrocarbon receptors for bioassay of aryl hydrocarbon receptor ligands in transgenic tobacco plants.</a> Plant Biotechnol. J. 7, 119-128 (2009).</li><li>Hickman, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coordinated+regulation+of+sulfur+and+phospholipid+metabolism+reflects+the+importance+of+methylation+in+the+growth+of+yeast.">Coordinated regulation of sulfur and phospholipid metabolism reflects the importance of methylation in the growth of yeast.</a> Mol. Biol. cell. 22, 4192-4204 (2011).</li><li>Taxis, C., Stier, G., Spadaccini, R., Knop, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+protein+depletion+by+genetically+controlled+deprotection+of+a+dormant+N-degron.">Efficient protein depletion by genetically controlled deprotection of a dormant N-degron.</a> Mol. Syst. Biol. 5, 267 (2009).</li><li>Nishimura, K., Fukagawa, T., Takisawa, H., Kakimoto, T., Kanemaki, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+auxin-based+degron+system+for+the+rapid+depletion+of+proteins+in+nonplant+cells.">An auxin-based degron system for the rapid depletion of proteins in nonplant cells.</a> Nat. methods. 6, 917-922 (2009).</li><li>Burke, D. J., Amberg, D. C., Strathern, J. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual. , (2005).</li><li>Kahm, M., Hasenbrink, G., Lichtenberg-Frate, H., Ludwig, J., Kschischo, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=grofit:+Fitting+Biological+Growth+Curves+with+R.">grofit: Fitting Biological Growth Curves with R.</a> J. Stat. Softw. 33, 1-21 (2010).</li><li>Rozen, S., Skaletsky, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primer3+on+the+WWW+for+general+users+and+for+biologist+programmers.">Primer3 on the WWW for general users and for biologist programmers.</a> Methods Mol. Biol. 132, 365-386 (2000).</li><li>Khalil, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+synthetic+biology+framework+for+programming+eukaryotic+transcription+functions.">A synthetic biology framework for programming eukaryotic transcription functions.</a> Cell. 150, 647-658 (2012).</li><li>Chockalingam, K., Chen, Z., Katzenellenbogen, J. A., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+specific+receptor-ligand+pairs+for+use+in+the+creation+of+gene+switches.">Directed evolution of specific receptor-ligand pairs for use in the creation of gene switches.</a> Proceedings of the National Academy of Sciences of the United States of America. 102, 5691-5696 (2005).</li><li>McLachlan, M. J., Chockalingam, K., Lai, K. C., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+orthogonal+ligand+specificity+in+a+single+scaffold.">Directed evolution of orthogonal ligand specificity in a single scaffold.</a> Angewandte Chemie. 48, 7783-7786 (2009).</li><li>Jorgensen, P., Nishikawa, J. L., Breitkreutz, B. J., Tyers, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+identification+of+pathways+that+couple+cell+growth+and+division+in+yeast.">Systematic identification of pathways that couple cell growth and division in yeast.</a> Science. 297, 395-400 (2002).</li><li>Sopko, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+pathways+and+phenotypes+by+systematic+gene+overexpression.">Mapping pathways and phenotypes by systematic gene overexpression.</a> Mol. cell. 21, 319-330 (2006).</li><li>Shimizu-Sato, S., Huq, E., Tepperman, J. M., Quail, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+light-switchable+gene+promoter+system.">A light-switchable gene promoter system.</a> Nat. biotechnol. 20, 1041-1044 (2002).</li><li>Polstein, L. R., Gersbach, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Light-inducible+spatiotemporal+control+of+gene+activation+by+customizable+zinc+finger+transcription+factors.">Light-inducible spatiotemporal control of gene activation by customizable zinc finger transcription factors.</a> J. Am. Chem. Soc. 134, 16480-16483 (2012).</li><li>Losi, A., Gartner, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Old+chromophores,+new+photoactivation+paradigms,+trendy+applications:+flavins+in+blue+light-sensing+photoreceptors.">Old chromophores, new photoactivation paradigms, trendy applications: flavins in blue light-sensing photoreceptors.</a> Photochem. Photobiol. 87, 491-510 (2011).</li><li>Boyden, E. S., Zhang, F., Bamberg, E., Nagel, G., Deisseroth, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Millisecond-timescale,+genetically+targeted+optical+control+of+neural+activity.">Millisecond-timescale, genetically targeted optical control of neural activity.</a> Nat. Neurosci. 8, 1263-1268 (2005).</li><li>Gradinaru, V., Mogri, M., Thompson, K. R., Henderson, J. M., Deisseroth, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optical+deconstruction+of+parkinsonian+neural+circuitry.">Optical deconstruction of parkinsonian neural circuitry.</a> Science. 324, 354-359 (2009).</li><li>Milias-Argeitis, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+silico+feedback+for+in+vivo+regulation+of+a+gene+expression+circuit.">In silico feedback for in vivo regulation of a gene expression circuit.</a> Nat. biotechnol. 29, 1114-1116 (2011).</li></ol>

McIsaac, Noyes ve Botstein (diğerleri ile) bir patent Açıklanmasına olarak bu sistemin bir parçası gönderdiniz.

Burada tarif edilen hormon bazlı anahtarları, in vivo olarak bir DNA sekansı hedef ilgi konusu bir DNA bağlama alanı yeteneğini test etmek için yerel hücre biyolojisi inceleyerek, sayısız uygulamalar vardır. Sistem indüserinin, hızlı aksiyon ve sıkı düzenlemeye kademeli bir yanıt dahil birçok arzu özelliklere sahiptir (yani. Ölçülebilir sızmaları, bkz. Şekil 7). Ancak, iyileştirme ve genişleme için oda hala var. Sentetik biyolojinin son iş çoklayıcı sentetik sistemleri vurguladı ve iyi karakterize, programlanabilir DNA parçalarının 16 repertuarını genişletiyor. Ayrı hedef genlerin bağımsız olarak, birden çok koşullu ifade uyarıcıları ve üst üste spesifısitesi olmayan DNA bağlanma alanlarını gerektirir. Projelendirilmiş ve doğal olarak oluşan reseptörlerin durumu yeni yapay transkripsiyon faktörlerini geliştirmek için hangi parçaları geniş bir dizi sağlar. Genişleyenkarşılıklı ortogonal anahtarları repertuarı büyük ölçüde 17,18 yaklaşımlar yönlendirilmiş evrim tarafından yardım görmüştür. Bizim yapay transkripsiyon faktörlerinin ligand-bağlanma özgüllüğünü yeniden programlamak için gösterilen çabalar, gelecekte sunulacaktır. Daha önce, gen silinmesi / aşırı ifadesinin fenotipik sonuçlarının Mayada 19,20 yaygın olarak incelenmiştir. Ancak, bu ekspresyon seviyeleri, bir dizi farklı fenotipe ifadesinin etkisini incelemek için kolay olmamıştır. Bu buluşta sunulan sistemin bir birinci özelliği, kademeli doğası (Şekil 8) &#39;dir. Genellikle kabul ederken, gen ifadesi ve ilgi fenotipler arasındaki ilişki mutlaka monotonik olmayabilir. Böyle Z 3 EV ve Z 4 EV gibi yapay transkripsiyon faktörleri basit gen ifadesinde değişikliklere fenotipik yanıtları tahlil etme görevi yapacaktır. Son olarak, protokolleri tartışmakbu yazının ed mühendislik ve-estraidol β yanıt yapay transkripsiyon faktörlerini tanımlamak için olmakla birlikte, önemli bir alternatif kimyasal duyarlı alanları (örneğin PhyB/Pif3, lov ve BLUF gibi) ışık duyarlı alanların kullanımı, Kendilerinin faaliyetleri kültür büyüme ortamı 21-23 perturb kalmadan geri dönüşümlüdür. Işık bazlı sistemler uzaysal gen ekspresyonunun kontrolü, protein-protein etkileşimleri, iyon taşıma, ve daha önce 21-26 güçlü olduğu kanıtlanmıştır enzimatik aktivite, kolaylaştırır. Sonuç olarak, maya, indüklenebilir, yapay transkripsiyon faktörlerinin hızlı yapımı için yöntemler sunulmuştur. Bu protokol, aynı kökten gelen GFP muhabir yapı ile birlikte, hem de akış sitometrisi kullanılarak, raportör verilerin analiz edilmesi ve büyüme ATF aktivasyon etkisini test etmek için yöntemler için bir model sunmaktadır.

Maya genetik anahtarları geliştirilmesi akademik hem de endüstriyel araştırma büyük ilgi olduğunu. İdeal durumda, genetik anahtarları deneyi tarafından arzu sadece belirli bir gen (ya da gen kümesi) aktif hale getirmek için kullanılabilir. Alt sentetik bir promotörün yerleştirilen bir genin kodlayıcı sekansı, bir uyaran molekül olmadan ifade edilmez: inducer ilave edildikten sonra hızlı bir şekilde gen ifade edilmelidir. Sadece son zamanlarda bu tür bir anahtar indükleyici yokluğunda, soy bir silme fenotipi gösterir, ancak uyarıcının mevcudiyetinde ekspresyon bütün hücrelerde indüktör düzeyi ile orantılı olarak aktif maya içinde tasarlanmış olabilir gösterilmiştir 1,2. Tarihsel olarak, mayada koşullu ifade sistemleri MET, PHO ve GAL promoterler (aktiviteler metionin, fosfat dışı düzeyde duyarlı olan, ve de dahil olmak üzere besleyici duyarlı DNA dizileri, üzerine ağır yararlanmıştırgalaktoz, sırasıyla). Koşullu ifade elde edilebilir olsa da, önemli pleitropik etkilerin pahasına geliyor. Örneğin, insan östrojen reseptörleri olarak hormon reseptörleri ökaryotlarda 3,4 etkili anahtarları olduğu kanıtlanmıştır. Hormonu yokluğunda, bir hormon reseptörüne bağlanmak için bir kaynaşık protein, Hsp90 şaperon kompleksi ile etkileşim sitoplazma içinde tecrit edilebilir. Uygun ligand bağlayıcı üzerine, alıcı bu Hsp90 şaperon kompleksten serbest kalmasına neden olur ve bir nükleer lokalizasyon sinyali açığa, yapısal bir değişiklik olur. Belirli bir hormon reseptörü içeren proteinin lokalizasyonu dinamikleri gözlemlemek için, Gal4dbd.ER.VP16 (GEV&#39;in, Gal4p DNA bağlama alanı, insan östrojen reseptörünün ligand bağlanma alanı içeren sentetik bir transkripsiyon faktörü, bir C-terminal füzyon oluşturulan ve VP16) GFP 2. Nükleer lokalizasyon eklenmesinden sonra 8 dakika içinde gözlenmiştirhangi yabani tip maya tamamen etkisiz olan, indükleyici, beta-estradiol miktarda doyurarak. Bu zamana kadar, hücrelerin çoğunluğu (floresan in situ hibridizasyon yoluyla tahlil) GEV hedef genleri için açıkça görünür aktif transkripsiyon siteleri yanı sıra, tam olgun mRNA&#39;ları 2,5 var. GEV hedef genler bu çekirdeğe transloke DNA bağlama ve transkripsiyonu aktif hale getirmek için &lt;kimerik aktifleştirici için 2.5 dakika sürer gösteren, 2.5 dakika, 2,6 (mikrodizileri kullanılarak ölçülmüştür) olan sentezleme&gt; 2-kat artmıştır. Birkaç on-anahtarları diğer hiçbiri hızı elde ettik (Escherichia coli gelen klasik doksisiklin bazlı anahtarları 7,8 ve Arabidopsis thaliana&#39;dan bir indigo tabanlı anahtar 9 da dahil olmak üzere), çeşitli küçük moleküller ya da uyuşturucu kullanan maya içinde uygulanmış olsa da, özgüllük, ya da hormon bazlı anahtarları tarafından sergilenen düzenleme gerginlik. Bu t kayda değer olduğunuhat hızlı anahtarlar kapalı da maya içinde geliştirilmiştir, ve tipik olarak sekans 2,10,11,12 hedefleyen bir proteaz veya ubikitin ligazı için bir gen füzyon çalışır. Hızlı bir hücreden bir hedef proteinin ayrılması için yeteneği elzem genlerin çalışma hem de 10 silindiğinde genetik baskı yatkındır genleri kolaylaştırır. Bu protokol açıklanan yöntemler bina ve on-anahtarları mayada sentetik karakterize içindir. İlk olarak, hızlı bir şekilde ilgi konusu bir DNA bağlanma alanından oluşan genomik entegre füzyon proteinlerini oluşturmak için nasıl gösterir, ligand, insan östrojen reseptörü bağlama alanı, ve VP16 (DBD-en EV). Protokolde sonra, füzyon proteini bir ACT1 promotöründen eksprese edilir. Biz o ATF için bir soydaş muhabiri plazmid yaratmak ve akış sitometri kullanarak işlevselliğini sınamak için nasıl gösterir. Bu muhabir plazmidler yeni atfs (Şekil 1) ile kullanılan öngörülüyor rağmen, onlar be de bir yerli transkripsiyon aktivatörü için gazetecilere olarak kullanılır. Son olarak, 96 oyuklu plakalar içerisinde, hücre büyümesi üzerindeki ATF aktivasyon etkisini test etmek için ve uyarılabilir genomik alelleri mühendislik Ayrıntılar için verilmiştir.

<table border="0" cellpadding="0" cellspacing="0" width="352">
	<colgroup>
		<col span="4" />
	</colgroup>
	<tbody>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Name of the Reagent</td>
			<td style="width:88px;">Company</td>
			<td style="width:88px;">Catalogue Number</td>
			<td style="width:88px;">Comments&#160;</td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:88px;">Expand High Fidelity PCR System</td>
			<td style="width:88px;">Roche</td>
			<td style="width:88px;">11 732 650 001</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">T4 DNA Ligase</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">M0202S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Competent E. coli</td>
			<td style="width:88px;">Life Technologies</td>
			<td style="width:88px;">18258-012</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Estradiol</td>
			<td style="width:88px;">Tocris Biosciences</td>
			<td style="width:88px;">2824</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Ampicillin</td>
			<td style="width:88px;">Fisher Scientific</td>
			<td style="width:88px;">BP1760-5</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:88px;">T4 Polynucleotide Kinase</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">M0201</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">PBS</td>
			<td style="width:88px;">Life Technologies</td>
			<td style="width:88px;">10010-23</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">Tween-20</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">9005-64-5</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">clonNAT</td>
			<td style="width:88px;">Jena Bioscience</td>
			<td style="width:88px;">AB-102L</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">XbaI</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">R0145S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">NotI-HF</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">R3189S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">CutSmart Buffer</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">B7204S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Glucose</td>
			<td style="width:88px;">Fisher Scientific</td>
			<td style="width:88px;">D15-500</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Bacto-Peptone</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">211677</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Yeast Extract</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">210929</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Agarose</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">214010</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">100% Ethanol</td>
			<td style="width:88px;">Decon Laboratories</td>
			<td style="width:88px;">04-355-222</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">G418</td>
			<td style="width:88px;">Life Technologies</td>
			<td style="width:88px;">11811-031</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">QIAprep Spin Miniprep Kit</td>
			<td style="width:88px;">QIAGEN</td>
			<td style="width:88px;">27104</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:88px;">Lithium acetate dihydrate</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">L-6883</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Salmon sperm DNA</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">93283</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">PEG 3350</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">P-3640</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="69">
			<td height="69" style="height:69px;width:88px;">Plasmids pMN8 and pMN10; yeast strain yMN15</td>
			<td style="width:88px;">Noyes or Botstein labs</td>
			<td style="width:88px;"></td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">Luria Broth</td>
			<td>Sigma-Aldrich</td>
			<td>L3397</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EQUIPMENT:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Material Name</td>
			<td style="width:88px;">Company</td>
			<td style="width:88px;">Catalogue Number</td>
			<td style="width:88px;">Comments (optional)</td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">LSRII Flow Cyometer&#160;</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">Various Models</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="103">
			<td height="103" style="height:103px;width:88px;">MATLAB or FlowJo</td>
			<td style="width:88px;">MATLAB or FlowJo</td>
			<td style="width:88px;"></td>
			<td style="width:88px;">Software for analyzing .FCS files from flow cytometry experiments</td>
		</tr>
		<tr height="69">
			<td height="69" style="height:69px;width:88px;">R</td>
			<td style="width:88px;">Open Source</td>
			<td style="width:88px;"></td>
			<td style="width:88px;">For analyzing growth-rate data from plate reader.&#160;</td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Falcon Tubes</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">352052</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="52">
			<td height="52" style="height:52px;width:88px;">1.7 ml Eppendorf&#160; Tubes</td>
			<td style="width:88px;">GeneMate</td>
			<td style="width:88px;">C3262-1</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">250 ml Shake Flasks</td>
			<td style="width:88px;">Corning</td>
			<td style="width:88px;">4446-250</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">96-well, flat-bottom plates</td>
			<td style="width:88px;">Costar</td>
			<td style="width:88px;">3635</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="69">
			<td height="69" style="height:69px;width:88px;">Plate Reader (Synergy H1 Multi-Mode Plate Reader)</td>
			<td style="width:88px;">BioTek</td>
			<td style="width:88px;">H1MG</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Breathe-Easy Membranes</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">Z380059-1PAK</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Thermocycler</td>
			<td style="width:88px;">various companies</td>
			<td style="width:88px;">Various models</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">SC-Ura powder</td>
			<td style="width:88px;">MP Biomedicals</td>
			<td style="width:88px;">114410622</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">5-FOA</td>
			<td style="width:88px;">Zymo Research</td>
			<td style="width:88px;">F9001-1</td>
			<td style="width:88px;"></td>
		</tr>
	</tbody>
</table>

rapid synthesis and screening of chemically activated transcription factors with gfp-based reporters

Sentetik biyoloji rasyonel tasarım ve istenen niceliksel özelliklere sahip sentetik devreleri kurmak, yanı sıra yerli kumanda devrelerinin yapısını sorgulamak için araçları sağlamayı amaçlamaktadır. Her iki durumda da, herhangi bir hedef dışı etkileri olan, hızlı bir şekilde ayarlanabilir ve gen ifadesini program yeteneği yararlı olabilir. Biz, insan östrojen reseptörü ve VP16 ligand bağlayıcı etki alanı, ardından bir URA3 kasetinin ACT1 promoter üst akışında içeren maya suşları inşa ettiler. URA3 varlığı karşısında bir DNA bağlama alanı ve seçilmesini ihtiva eden bir doğrusal bir PCR ürünü ile bu türünün dönüştürülmesi ile, bir kurucu olarak ifade yapay transkripsiyon faktörü (ATF) homolog rekombinasyon ile üretilebilir. Bu şekilde tasarlanmış atfs bu şekilde hedef dışı aktivasyonu ve yaygın olarak kullanılan Conditi ile bulunan fizyolojik olmayan büyüme koşulları hem de ortadan kaldırılması, indükleyici mevcudiyetinde benzersiz bir hedef geni aktive edebilironal gen ekspresyon sistemleri. Ilgi konusu bir doğal ya da yapay bir transkripsiyon faktörüne yanıt, özellikle GFP raportör plazmidin hızlı yapımı için basit bir yöntem de sağlanmaktadır.

<html> Şekil 5, zaman içinde Z 3 EV, Z 4 EV ya GEV&#39;in GFP endüklenmesini gösterir. Bağlayıcı alanlar nonyeast DNA içeren atfs tepki olarak GFP üretimindeki artışı not edin. Biz son zamanlarda bu maya genomu 1 tek-gen özelliğin sağlanması bu faktörlerden kaynaklanan iddia. Z 3 EV ve Z&#39;nin 4 EV sadece alt uygun bağlama bölgesine (5&#39;-GCGTGGGCG-3 &#39;ve 5&#39;-ihtiva eden sentetik bir promotörün yerleştirilmiş bir hedef genin ifadesini aktive ise tek başına GEV indüksiyonu, yüzlerce genin aktivasyonu / bastırılmasına yol açar GCGGCGGAGGAG-3 &#39;, sırasıyla) 1. Şekil 7, sisteme (saptanabilir GFP hiçbir indükleyici results) ve tüm hücreler bir dizi boyunca GFP indükleme Z 3 EV becerisi indüktöre tepki olarak bağlı olsun sıkı bir düzenleme gösteriyor β-estradiol konsantrasyonları, Şekil 8 &#39;de gösterilmiştir. <html> ent &quot;fo: keep-together.within-page =&quot; always &quot;&gt; <img alt="Şekil 1" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig1highres.jpg" src="/files/ftp_upload/51153/51153fig1.jpg" /> Şekil 1,. Β-estradiyol ATF bağlandığı zaman yapay transkripsiyon faktörleri β-estradiyol. Yokluğunda Hsp90 ile etkileşim, Hsp90 ATF çekirdeğe girmek ve plazmid raportör ekspresyonu aktive etmek için izin ayrışmaktadır. <img alt="Şekil 2," fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig2highres.jpg" src="/files/ftp_upload/51153/51153fig2.jpg" /> Şekil 2.. Yapay transkripsiyon faktörlerini ve bina / soydaş GFP gazetecilere test içeren mühendislik suşları için protokol şematik. load/51153/51153fig3highres.jpg &quot;src =&quot; / files/ftp_upload/51153/51153fig3.jpg &quot;/&gt; Şekil 3,. LEU2 lokusundaki suşu yMN15 in ACT1pr-URA3-EV dizisi. <img alt="Şekil 4," fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig4highres.jpg" src="/files/ftp_upload/51153/51153fig4.jpg" /> Başarılı bir şekilde yMN15 dönüştürüldüğü zaman, yeni bir füzyon proteini oluşturmak için ek sekans homolojisi ile ilgi konusu bir DNA bağlanma alanı amplifiye etmek için PCR primerleri Şekil 4.. Tasarımı. <img alt="Şekil 5," fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig5highres.jpg" src="/files/ftp_upload/51153/51153fig5.jpg" /> Şekil 5,. GFP indüksiyon 1 uM β-estradiyol tepki olarak üç farklı ATF-promoter çifti. &#39;/ P&gt; <img alt="Şekil 6," fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig6highres.jpg" src="/files/ftp_upload/51153/51153fig6.jpg" /> Şekil 6.. Veri sitometri işlem akışı için bir MATLAB komut dosyası. Bu script uyarlanmıştır <a href="http://openwetware.org/wiki/McClean:_Matlab_Code_for_Analyzing_FACS_Data">http://openwetware.org/wiki/McClean:_Matlab_Code_for_Analyzing_FACS_Data</a> . <img alt="Şekil 7" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig7highres.jpg" src="/files/ftp_upload/51153/51153fig7.jpg" /> 0 μ M β-estradiol ve indüksiyon 18 saat sonra 1 uM β-estradiyol tepki olarak Z 3 EV GFP Şekil 7.. Indüksiyonu. Floresans ölçümleri de olduğuZ 3 EV sistemi sıkı bir düzenleme göstermek için GFP içermeyen hücrelerden ölçüldü. Bu şekil, Şekil 6&#39;da kodu kullanılarak oluşturulmuştur. <img alt="Şekil 8," fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig8highres.jpg" src="/files/ftp_upload/51153/51153fig8.jpg" /> Şekil 8,. Indükleyici konsantrasyonu ve sentezleme çıkışı arasındaki ilişki, 1 ve a Hill katsayısı ile değerlendirilir. (A) β-estradiyol konsantrasyonunun bir fonksiyonu olarak, GFP ifade dağılımı. (B) (A) &#39;dan dağılımlarının ortalama floresan. Veriler D β-estradiyol dozdur = G dakika + (G-G max min) D n / (n + K D n), G ve G min maksimum minimum olan fonksiyonu G (D) için uygun olan ve maksimum GFP değerler, respectively, n Hill katsayısı ve K ½ (G maksimum + G dakika) elde edildi β-estradiyol dozdur. <table border="0" cellpadding="0" cellspacing="0" fo:keep-together.within-page="always" width="176"><tbody><tr><td> Oligonükleotid Dizi </td><td> Isim </td></tr><tr><td> 5&#39;-TTGAAACCA AACTCGCCTCT-3 &#39; </td><td> DBD İleri edin </td></tr><tr><td> 5&#39;-tccagagac ttcagggtgct-3 &#39; </td><td> DBD Tersine </td></tr></tbody></table> Tablo 1. Östrojen reseptörünün ilgilendiren DBD&#39;nin doğru füzyon doğrulanması için primerler. Ileri primer olarak homolog olan ACT1 promoter ve ters primer östrojen reseptörü ile homologdur. Tipik DBDleri (~ 300 bp) için PCR ürünü &lt;1.5 kb&#39;dir. <table border="0" cellpadding="0" cellspacing="0" width="176"><tbody><tr><td> Oligonükleotid Dizi </td><td> Isim </td></tr><tr><td> 5&#39;-ggccgc ... DBD binging sitesi ... t-3 &#39; </td><td> En oligo </td></tr><tr><td> 5&#39;-ctaga ... DNA bağlama sahası ters ... gc-3 &#39; </td><td> Alt oligo </td></tr><tr><td> 5&#39;-gcc gcGTGGGCG T GCGTGGGCG G G CGTGGGCG T GCGTGGGCG G GCGTG GGCG T GCGTGGGCG t-3 &#39; </td><td> En oligo + 6x Zif268 Bağlayıcı Yer </td></tr><tr><td> 5&#39;-ctagaCGCCCACGCACGCCCACGCC CGCCCACGCACGCCCACGCCCGCC CACGCACGCCCACgc-3 &#39; </td><td> Taban oligo + 6x Zif268 Bağlayıcı Yer </td></tr></tbody></table> Ilgi çekici bağlama siteleri içeren dsDNA oluşturmak için primerler Tablo 2. S tructure. Z 3 EV-duyarlı promotör oluşturmak için, oligonükleotidler en oligo + 6x Zif268 Bağlama Alanı ve alt oligo + 6x Zif268 Cilt kullanılmıştır.Doğru DNA çıkıntıları oluşturmak için küçük harflerle diziler bulunmaktadır. Zif268 konsensüs bağlanma sitesi, GCGTGGGCG, üst oligo altı çizilir. <table border="0" cellpadding="0" cellspacing="0" width="176"><tbody><tr><td> Reaktif </td><td> Miktar </td></tr><tr><td> T4 polinükleotid Kinaz Tamponu </td><td> 5 ul </td></tr><tr><td> T4 polinükleotid kinaz (10.000 ünite / ml) </td><td> 1 ul </td></tr><tr><td> Top oligo (100 mikron) </td><td> 1.5 ul </td></tr><tr><td> Alt oligo (100 uM) </td><td> 1.5 ul </td></tr><tr><td> Su </td><td> 41 ul </td></tr></tbody></table> Tablo 3. Fosforile ve yukarıda tarif edilen reaksiyon 50 ul kullanılarak bir PCR primer tavlama. Iki PCR adım vardır. Adım 1: 37 ° C 30 dakika (fosforile) ve aşama 2: 95 ° C 30 saniye (Tavlama); 4 ° C kadar 1 ° C aşağı her 30 sn adım. <table border="0" cellpadding="0" cellspacing="0" width="176"><tbody><tr><td> Reaktif </td><td> Miktar </td></tr><tr><td> Xbal </td><td> 1 ul </td></tr><tr><td> NotI-HF </td><td> 1 ul </td></tr><tr><td> Plazmid DNA, </td><td> 5 ul (1-2 ug) </td></tr><tr><td> 10x Cut Akıllı Tampon </td><td> 5 ul </td></tr><tr><td> Su </td><td> 38 ul </td></tr></tbody></table> Tablo 4. Xbal ve Notl ile plazmid pMN8 Kısıtlama özet. <table border="0" cellpadding="0" cellspacing="0" width="176"><tbody><tr height="22" style="height:16.5pt"><td class="xl65" height="22" style="height:16.5pt;width:66pt" width="88"> Reaktif </td><td class="xl66" style="width:66pt" width="88"> Miktar </td></tr><tr height="43" style="height:32.25pt"><td> T4 ligaz Buffer </td><td> 2 ul </td></tr><tr height="22" style="height:16.5pt"><td> T4 ligaz </td><td> 0.2 ul </td></tr><tr height="43" style="height:32.25pt"><td> 10 ng / ul @ omurga </td><td> 1 ul </td></tr><tr height="106" style="height:79.5pt"><td> 5x molar konsantrasyon / ul @ bağlama sekanslar </td><td> 1 ul </td></tr><tr height="22" style="height:16.5pt"><td> Su </td><td> 15.8 ul </td></tr></tbody></table> Tablo 5. Plasmid DNA&#39;ya bağlanma yerleri Arter. <table border="0" cellpadding="0" cellspacing="0" width="176"><tbody><tr><td> Astar boya </td><td> Tanım </td></tr><tr><td> ~ 40 bp üst baş arasında ATG + CGCACTTAACTTCGCATCTG-3 &#39; </td><td> KanMX-Promoter yükseltilmesi için ileri primer </td></tr><tr><td> 5&#39;-ters tamamlayıcı (ATG + ~ 37 bp) + TATAGTTTTTTCTCCTTGACG-3 &#39; </td><td> PRI tersKanMX-Promoter yükseltmek için mer </td></tr><tr><td> 5&#39;-caatttgtctgctcaagaaaataaa ttaaatacaaataaaCGCAC TTAACTTCGCATCTG-3 &#39; </td><td> GCN4 organizatörü takas yapmak için ileri primer. </td></tr><tr><td> 5&#39;-tggatttaaagcaaataaacttgg ctgatattcggacatTATAGTT TTTTCTCCTTGACG-3 &#39; </td><td> GCN4 organizatörü takas yapmak için astar ters. </td></tr></tbody></table> Tablo 6. PCR titratible alel yapmak için KanMX-Promoter yükseltmek.

Watch this Scientific Journal Video about Rapid Synthesis and Screening of Chemically Activated Transcription Factors with GFP-based Reporters at JoVE.com

Rapid Synthesis and Screening of Chemically Activated Transcription Factors with GFP-based Reporters

Bu protokol soydaş GFP gazetecilere ve flow sitometri aracılığı GFP ifade uyarmak için atfs yeteneği ölçümü ile yapay transkripsiyon faktörleri (atfs) hızlı inşası için deneysel bir prosedür açıklanmaktadır.

Hızlı Sentezi ve GFP-tabanlı Muhabirleri ile Kimyasal Aktif Transkripsiyon Faktörleri Taraması

Synthetic biology aims to rationally design and build synthetic circuits with desired quantitative properties, as well as provide tools to interrogate the ...

rapid-synthesis-screening-chemically-activated-transcription-factors

Research

Education

JoVE Journal

JoVE Core

Molecular Biology

Biology

Unit 1

Transcription: DNA to RNA

SCIENTISTS IN ACTION

14.4K Görüntüleme.  Princeton University.  Bu protokol soydaş GFP gazetecilere ve flow sitometri aracılığı GFP ifade uyarmak için atfs yeteneği ölçümü ile yapay transkripsiyon faktörleri (atfs) hızlı inşası için deneysel bir prosedür açıklanmaktadır. 

Video: Rapid Synthesis and Screening of Chemically Activated Transcription Factors with GFP-based Reporters

Generation of Human CD40-activated B cells

CD40-activated B cells (CD40-B cells) have been identified as an alternative source of immuno-stimulatory antigen-presenting cells (APC) for cancer immunotherapy 1-3. Compared to Dendritic cells (DCs), the best characterized APC, CD40-B cells have several distinct biological and technical properties. Similar to DCs, B cells show an increased expression of MHC and co-stimulatory molecules (Fig.1b), exhibit a strong migratory capacity and present antigen presentation efficiently to T cells, after stimulation with interleukin-4 and CD40 ligand (CD40L). However, in contrast to immature or mature DCs, CD40-B cells express the full lymph node homing triad consisting of CD62L, CCR7/CXCR4, and leukocyte function antigen-1 (LFA1, CD11a/CD18), necessary for homing to secondary lymphoid organs (Fig.1a) 3. CD40-B cells can be generated without difficulties from very small amounts of peripheral blood which can be further expanded in vitro to very large amounts of highly-pure CD40-B cells (&gt;109 cells per patient) from healthy donors as well as cancer patients (Fig.1c,d) 1,4. 
In this protocol we demonstrate how to obtain fully activated CD40-B cells from human PBMC. Key molecules for the cell culture are CD40 ligand, interleukin-4 (IL-4) and cyclosporin A (CsA), which are replenished in a 3-4 day culture cycle. For laboratory purposes CD40-stimulation is provided by NIH/3T3 cells expressing recombinant human CD40 ligand (tCD40L NIH/3T3) 5. To avoid contamination with non-transfected cells, expression of the human CD40 ligand on the transfectants has to be checked regularly (Fig.2). 
After 14 days CD40-B cell cultures consist of more than 95% pure B cells and an expansion of CD40-B cells over 65 days is frequently possible without any loss of function 1, 4. CD40-B cells efficiently take up, process and present antigens to T cells 6. They do not only prime na&#970;ve, but also expand memory T cells 7,8. CD40-activated B cells can be used to study B-cell activation, differentiation and function. Moreover, they represent a promising tool for therapeutic or preventive vaccination against tumors 9.

In this video we present the ex vivo generation and expansion of human CD40-activated B cells (CD40-B) from peripheral blood mononuclear cells (PBMC) by stimulation with CD40 ligand and interleukin-4.

İnsan CD40 aktive B hücreleri üretilmesi

CD40-activated B cells (CD40-B cells) have been identified as an alternative source of immuno-stimulatory antigen-presenting cells (APC) for cancer ...

Biyoloji

Fluorescence Activated Cell Sorting of Plant Protoplasts

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental stimuli in any multicellular organism. In situ hybridization and reporter gene visualization can to a limited extent be used to this end but for high resolution quantitative RT-PCR or high-throughput transcriptome-wide analysis the isolation of RNA from particular cell types is requisite. Cellular dissociation of tissue expressing a fluorescent protein marker in a specific cell type and subsequent Fluorescence Activated Cell Sorting (FACS) makes it possible to collect sufficient amounts of material for RNA extraction, cDNA synthesis/amplification and microarray analysis.
An extensive set of cell type-specific fluorescent reporter lines is available to the plant research community. In this case, two marker lines of the Arabidopsis thaliana root are used: PSCR::GFP (endodermis and quiescent center) and PWOX5::GFP (quiescent center). Large numbers (thousands) of seedlings are grown hydroponically or on agar plates and harvested to obtain enough root material for further analysis. Cellular dissociation of plant material is achieved by enzymatic digestion of the cell wall. This procedure makes use of high osmolarity-induced plasmolysis and commercially available cellulases, pectinases and hemicellulases to release protoplasts into solution.
FACS of GFP-positive cells makes use of the visualization of the green versus the red emission spectra of protoplasts excited by a 488 nm laser. GFP-positive protoplasts can be distinguished by their increased ratio of green to red emission. Protoplasts are typically sorted directly into RNA extraction buffer and stored for further processing at a later time.
This technique is revealed to be straightforward and practicable. Furthermore, it is shown that it can be used without difficulty to isolate sufficient numbers of cells for transcriptome analysis, even for very scarce cell types (e.g. quiescent center cells). Lastly, a growth setup for Arabidopsis seedlings is demonstrated that enables uncomplicated treatment of the plants prior to cell sorting (e.g. for the cell type-specific analysis of biotic or abiotic stress responses). Potential supplementary uses for FACS of plant protoplasts are discussed.

A method for isolating specific cell types from plant material is demonstrated. This technique employs transgenic marker lines expressing fluorescent proteins in particular cell types, cellular dissociation and Fluorescence Activated Cell Sorting. Additionally, a growth setup is established here that facilitates treatment of Arabidopsis thaliana seedlings prior to cell sorting.

Bitki protoplast Floresan Aktif Hücre Ayırma

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental ...

High-throughput Screening and Biosensing with Fluorescent C. elegans Strains

High-throughput screening (HTS) is a powerful approach for identifying chemical modulators of biological processes. However, many compounds identified in screens using cell culture models are often found to be toxic or pharmacologically inactive in vivo1-2. Screening in whole animal models can help avoid these pitfalls and streamline the path to drug development.
C. elegans is a multicellular model organism well suited for HTS. It is small (&lt;1 mm) and can be economically cultured and dispensed in liquids. C. elegans is also one of the most experimentally tractable animal models permitting rapid and detailed identification of drug mode-of-action3.
We describe a protocol for culturing and dispensing fluorescent strains of C. elegans for high-throughput screening of chemical libraries or detection of environmental contaminants that alter the expression of a specific gene. Large numbers of developmentally synchronized worms are grown in liquid culture, harvested, washed, and suspended at a defined density. Worms are then added to black, flat-bottomed 384-well plates using a peristaltic liquid dispenser. Small molecules from a chemical library or test samples (e.g., water, food, or soil) can be added to wells with worms. In vivo, real-time fluorescence intensity is measured with a fluorescence microplate reader. This method can be adapted to any inducible gene in C. elegans for which a suitable reporter is available. Many inducible stress and developmental transcriptional pathways are well defined in C. elegans and GFP transgenic reporter strains already exist for many of them4. When combined with the appropriate transgenic reporters, our method can be used to screen for pathway modulators or to develop robust biosensor assays for environmental contaminants. 
We demonstrate our C. elegans culture and dispensing protocol with an HTS assay we developed to monitor the C. elegans cap &#x2018;n&#x2019; collar transcription factor SKN-1. SKN-1 and its mammalian homologue Nrf2 activate cytoprotective genes during oxidative and xenobiotic stress5-10. Nrf2 protects mammals from numerous age-related disorders such as cancer, neurodegeneration, and chronic inflammation and has become a major chemotherapeutic target11-13.Our assay is based on a GFP transgenic reporter for the SKN-1 target gene gst-414, which encodes a glutathione-s transferase6. The gst-4 reporter is also a biosensor for xenobiotic and oxidative chemicals that activate SKN-1 and can be used to detect low levels of contaminants such as acrylamide and methyl-mercury15-16.

High-throughput Screening and Biosensing with Fluorescent C. elegans Strains

A procedure for liquid-based culturing and dispensing of C. elegans strains expressing fluorescent reporter proteins is described that does not require expensive sorting equipment. This approach can be applied to numerous inducible C. elegans genes for drug discovery or biosensing of contaminants.

Floresan ile yüksek verim Tarama ve Biyoalgılayıcı C. elegans Suşlarının

High-throughput screening (HTS) is a powerful approach for identifying chemical modulators of biological processes.  However, many compounds identified in ...

Monitoring of Ubiquitin-proteasome Activity in Living Cells Using a Degron (dgn)-destabilized Green Fluorescent Protein (GFP)-based Reporter Protein

Proteasome is the main intracellular organelle involved in the proteolytic degradation of abnormal, misfolded, damaged or oxidized proteins 1, 2. Maintenance of proteasome activity was implicated in many key cellular processes, like cell's stress response 3, cell cycle regulation and cellular differentiation 4 or in immune system response 5. The dysfunction of the ubiquitin-proteasome system has been related to the development of tumors and neurodegenerative diseases 4, 6. Additionally, a decrease in proteasome activity was found as a feature of cellular senescence and organismal aging 7, 8, 9, 10. Here, we present a method to measure ubiquitin-proteasome activity in living cells using a GFP-dgn fusion protein. To be able to monitor ubiquitin-proteasome activity in living primary cells, complementary DNA constructs coding for a green fluorescent protein (GFP)&#x2013;dgn fusion protein (GFP&#x2013;dgn, unstable) and a variant carrying a frameshift mutation (GFP&#x2013;dgnFS, stable 11) are inserted in lentiviral expression vectors. We prefer this technique over traditional transfection techniques because it guarantees a very high transfection efficiency independent of the cell type or the age of the donor. The difference between fluorescence displayed by the GFP&#x2013;dgnFS (stable) protein and the destabilized protein (GFP-dgn) in the absence or presence of proteasome inhibitor can be used to estimate ubiquitin-proteasome activity in each particular cell strain. These differences can be monitored by epifluorescence microscopy or can be measured by flow cytometry.

Monitoring of Ubiquitin-proteasome Activity in Living Cells Using a Degron dgn-destabilized Green Fluorescent Protein GFP-based Reporter Protein

A method to monitor ubiquitin-proteasome activity in living cells is described. A degron-destabilized GFP- (GFP-dgn) and a stable GFP-dgnFS fusion protein are generated and transduced into the cell using a lentiviral expression vector. This technique allows to generate a stable GFP-dgn/GFP-dgnFS expressing cell line in which ubiquitin-proteasome activity can be easily assessed using epifluorescence or flow cytometry.

Yaşayan Hücreler ubikitin-proteozom Faaliyet Monitoring Degron (DGN)-destabilize Yeşil floresan proteini (GFP) tabanlı Muhabir Protein Kullanımı

Proteasome is the main intracellular organelle involved in the proteolytic degradation of abnormal, misfolded, damaged or oxidized proteins 1, 2. ...

Synthesis of Nine-atom Deltahedral Zintl Ions of Germanium and their Functionalization with Organic Groups

Although the first studies of Zintl ions date between the late 1890's and early 1930's they were not structurally characterized until many years later.1,2 Their redox chemistry is even younger, just about ten years old, but despite this short history these deltahedral clusters ions E9n- (E = Si, Ge, Sn, Pb; n = 2, 3, 4) have already shown interesting and diverse reactivity and have been at the forefront of rapidly developing and exciting new chemistry.3-6 Notable milestones are the oxidative coupling of Ge94- clusters to oligomers and infinite chains,7-19 their metallation,14-16,20-25 capping by transition-metal organometallic fragments,26-34 insertion of a transition-metal atom at the center of the cluster which is sometimes combined with capping and oligomerization,35-47 addition of main-group organometallic fragments as exo-bonded substituents,48-50 and functionalization with various organic residues by reactions with organic halides and alkynes.51-58 
This latter development of attaching organic fragments directly to the clusters has opened up a new field, namely organo-Zintl chemistry, that is potentially fertile for further synthetic explorations, and it is the step-by-step procedure for the synthesis of germanium-divinyl clusters described herein. The initial steps outline the synthesis of an intermetallic precursor of K4Ge9 from which the Ge94- clusters are extracted later in solution. This involves fused-silica glass blowing, arc-welding of niobium containers, and handling of highly air-sensitive materials in a glove box. The air-sensitive K4Ge9 is then dissolved in ethylenediamine in the box and then alkenylated by a reaction with Me3SiC&equiv;CSiMe3. The reaction is followed by electrospray mass spectrometry while the resulting solution is used for obtaining single crystals containing the functionalized clusters [H2C=CH-Ge9-CH=CH2]2-. For this purpose the solution is centrifuged, filtered, and carefully layered with a toluene solution of 18-crown-6. Left undisturbed for a few days, the so-layered solutions produced orange crystalline blocks of [K(18-crown-6)]2[Ge9(HCCH2)2]&bull;en which were characterized by single-crystal X-ray diffraction. 
The process highlights standard reaction techniques, work-up, and analysis towards functionalized deltahedral Zintl clusters. It is hoped that it will help towards further development and understanding of these compounds in the community at large.

We present the high-temperature synthesis of intermetallic precursors K4Ge9, their dissolution in ethylenediamine to form Ge94- deltahedral Zintl ions, and the reaction of the clusters with alkynes to form organo-Zintl ions. The latter are characterized by electrospray mass spectrometry in solutions and by single-crystal X-ray diffraction in the solid state.

Organik Grupları ile Dokuz-atom Deltahedral Zintl Germanyum iyonları ve bunların fonksiyonlandırmalar Sentezi

Although the first studies of Zintl ions date between the late 1890's and early 1930's they were not structurally characterized until many years later.1,2 ...

Chromatin Interaction Analysis with Paired-End Tag Sequencing (ChIA-PET) for Mapping Chromatin Interactions and Understanding Transcription Regulation

Genomes are organized into three-dimensional structures, adopting higher-order conformations inside the micron-sized nuclear spaces 7, 2, 12. Such architectures are not random and involve interactions between gene promoters and regulatory elements 13. The binding of transcription factors to specific regulatory sequences brings about a network of transcription regulation and coordination 1, 14. 
Chromatin Interaction Analysis by Paired-End Tag Sequencing (ChIA-PET) was developed to identify these higher-order chromatin structures 5,6. Cells are fixed and interacting loci are captured by covalent DNA-protein cross-links. To minimize non-specific noise and reduce complexity, as well as to increase the specificity of the chromatin interaction analysis, chromatin immunoprecipitation (ChIP) is used against specific protein factors to enrich chromatin fragments of interest before proximity ligation. Ligation involving half-linkers subsequently forms covalent links between pairs of DNA fragments tethered together within individual chromatin complexes. The flanking MmeI restriction enzyme sites in the half-linkers allow extraction of paired end tag-linker-tag constructs (PETs) upon MmeI digestion. As the half-linkers are biotinylated, these PET constructs are purified using streptavidin-magnetic beads. The purified PETs are ligated with next-generation sequencing adaptors and a catalog of interacting fragments is generated via next-generation sequencers such as the Illumina Genome Analyzer. Mapping and bioinformatics analysis is then performed to identify ChIP-enriched binding sites and ChIP-enriched chromatin interactions 8. 
We have produced a video to demonstrate critical aspects of the ChIA-PET protocol, especially the preparation of ChIP as the quality of ChIP plays a major role in the outcome of a ChIA-PET library. As the protocols are very long, only the critical steps are shown in the video.

Chromatin Interaction Analysis with Paired-End Tag Sequencing ChIA-PET for Mapping Chromatin Interactions and Understanding Transcription Regulation

Chromatin Interaction Analysis by Paired-End Tag Sequencing (ChIA-PET) is a method for de novo detection of chromatin interactions, for better understanding of transcriptional control.

Kromatin Etkileşimler haritalama ve Transkripsiyon Yönetmelik anlamak için paired-end Tag Dizileme (Chia-PET) ile Kromatin Etkileşim Analizi

Genomes are organized into three-dimensional structures, adopting higher-order conformations inside the micron-sized nuclear spaces 7, 2, 12. Such ...

Using Coculture to Detect Chemically Mediated Interspecies Interactions

In nature, bacteria rarely exist in isolation; they are instead surrounded by a diverse array of other microorganisms that alter the local environment by secreting metabolites. These metabolites have the potential to modulate the physiology and differentiation of their microbial neighbors and are likely important factors in the establishment and maintenance of complex microbial communities. We have developed a fluorescence-based coculture screen to identify such chemically mediated microbial interactions. The screen involves combining a fluorescent transcriptional reporter strain with environmental microbes on solid media and allowing the colonies to grow in coculture. The fluorescent transcriptional reporter is designed so that the chosen bacterial strain fluoresces when it is expressing a particular phenotype of interest (i.e. biofilm formation, sporulation, virulence factor production, etc.) Screening is performed under growth conditions where this phenotype is not expressed (and therefore the reporter strain is typically nonfluorescent). When an environmental microbe secretes a metabolite that activates this phenotype, it diffuses through the agar and activates the fluorescent reporter construct. This allows the inducing-metabolite-producing microbe to be detected: they are the nonfluorescent colonies most proximal to the fluorescent colonies. Thus, this screen allows the identification of environmental microbes that produce diffusible metabolites that activate a particular physiological response in a reporter strain. This publication discusses how to: a) select appropriate coculture screening conditions, b) prepare the reporter and environmental microbes for screening, c) perform the coculture screen, d) isolate putative inducing organisms, and e) confirm their activity in a secondary screen. We developed this method to screen for soil organisms that activate biofilm matrix-production in Bacillus subtilis; however, we also discuss considerations for applying this approach to other genetically tractable bacteria.

Bacteria produce secreted compounds that have the potential to affect the physiology of their microbial neighbors. Here we describe a coculture screen that allows detection of such chemically mediated interspecies interactions by mixing soil microbes with fluorescent transcriptional reporter strains of Bacillus subtilis on solid media.

Kimyasal Dolayımlı Türler arası etkileşimleri tespit etmek Coculture kullanma

In nature, bacteria rarely exist in isolation; they are instead surrounded by a diverse array of other microorganisms that alter the local environment by ...

Rapid and Efficient Zebrafish Genotyping Using PCR with High-resolution Melt Analysis

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic tools have been introduced, including multiple strategies for inducing mutations and generating transgenic lines. However, large-scale screening is limited by traditional genotyping methods, which are time-consuming and labor-intensive. Here we describe a technique to analyze zebrafish genotypes by PCR combined with high-resolution melting analysis (HRMA).&#160;This approach is rapid, sensitive, and inexpensive, with lower risk of contamination artifacts.&#160;Genotyping by PCR with HRMA can be used for embryos or adult fish, including in high-throughput screening protocols.

PCR combined with high-resolution melt analysis (HRMA) is demonstrated as a rapid and efficient method to genotype zebrafish.

Yüksek çözünürlüklü Melt Analizi ile PCR kullanarak hızlı ve verimli Zebra Genotiplemesi

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic ...

High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays focus on transcriptional regulation, being essentially aimed at the identification of promoter-targeting molecules. As a result, post-transcriptional mechanisms are largely uncovered by gene expression targeted drug development. Here we describe a cell-based assay aimed at investigating the role of the 3&#39; untranslated region (3&#8217; UTR) in the modulation of the fate of its mRNA, and at identifying compounds able to modify it. The assay is based on the use of a luciferase reporter construct containing the 3&#8217; UTR of a gene of interest stably integrated into a disease-relevant cell line. The protocol is divided into two parts, with the initial focus on the primary screening aimed at the identification of molecules affecting luciferase activity after 24 hr of treatment. The second part of the protocol describes the counter-screening necessary to discriminate compounds modulating luciferase activity specifically through the 3&#8217; UTR. In addition to the detailed protocol and representative results, we provide important considerations about the assay development and the validation of the hit(s) on the endogenous target. The described cell-based reporter gene assay will allow scientists to identify molecules modulating protein levels via post-transcriptional mechanisms dependent on a 3&#8217; UTR.

Here we describe a cell-based reporter gene assay as a valuable tool to screen chemical libraries for compounds modulating post-transcriptional control mechanisms exerted through 3&#8217; UTR.

Post-transkripsiyonel ayarlı genlerin kimyasal Modülatörler için yüksek verimli tarama

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays ...

Flexible Measurement of Bioluminescent Reporters Using an Automated Longitudinal Luciferase Imaging Gas- and Temperature-optimized Recorder (ALLIGATOR)

Luciferase-based reporters of cellular gene expression are in widespread use for both longitudinal and end-point assays of biological activity. In circadian rhythms research, for example, clock gene fusions with firefly luciferase give rise to robust rhythms in cellular bioluminescence that persist over many days. Technical limitations associated with photomultiplier tubes (PMT) or conventional microscopy-based methods for bioluminescence quantification have typically demanded that cells and tissues be maintained under quite non-physiological conditions during recording, with a trade-off between sensitivity and throughput. Here, we report a refinement of prior methods that allows long-term bioluminescence imaging with high sensitivity and throughput which supports a broad range of culture conditions, including variable gas and humidity control, and that accepts many different tissue culture plates and dishes. This automated longitudinal luciferase imaging gas- and temperature-optimized recorder (ALLIGATOR) also allows the observation of spatial variations in luciferase expression across a cell monolayer or tissue, which cannot readily be observed by traditional methods. We highlight how the ALLIGATOR provides vastly increased flexibility for the detection of luciferase activity when compared with existing methods.

Flexible Measurement of Bioluminescent Reporters Using an Automated Longitudinal Luciferase Imaging Gas- and Temperature-optimized Recorder ALLIGATOR

Genetically encoded luciferase is a popular non-invasive reporter of gene expression. Use of an automated longitudinal luciferase imaging gas- and temperature-optimized recorder (ALLIGATOR) enables longitudinal recording from bioluminescent cells under a wide range of conditions. Here we show how ALLIGATOR may be used in the context of circadian rhythms research.