Bu araştırma, Ulusal Bilim Vakfı Hibe IOS-1025642 (GBM) tarafından desteklenmiştir. Biz ARqua1 gerginlik sağlamak için Maria Harrison teşekkür ederiz.

1. Kılavuzu RNA Tasarım ve Vektör İnşaat <ol><li> ilgi genleri hedef sekansları tanımlamak. Bu adımda 13,14 için uygun çevrimiçi CRISPR hedef bulma çeşitli programlar vardır. NOT: Burada GN 20 GG hedef motifi kullanmak, ancak diğer tasarımlar kullanılan uygulama veya vektör sistemine bağlı olarak uygun olabilir. </li><li> Tasarım 60-mer gRNA oligo DNA montaj için gerekli olan 5 ile çevrili hedef motifleri &#39;ve 3&#39; 20 nt dizileri GN 19 bölümünü kapsayacak şekilde. Son 60-mer motifi: 5&#39;-TCAAGCGAACCAGTAGGCTT-GN 19 -GTTTTAGAGCTAGAAATAGC-3 &#39;. NOT: Standart desalted primerler iyi çalışır. </li><li> Montaj için, dört DNA (Şekil 1) hazırlayın. DNA dizileri için ek dosyasına bakın. <ol><li> 2 saat boyunca 37 ° C&#39;de 1x Tampon 4 kısıtlama enzimi Spe I ile Cas9 10 plazmid: p201N 5 ug - 1 Digest. Bir özet Sütun arındırmaküreticinin talimatlarına şeklinizi ona göre. ~ 10 mM Tris-HCI 15 ul içinde süspanse ve UV spektrofotometre ile miktarı belirlenir. </li><li> İkinci 2 saat boyunca 25 ° C&#39;de 1x Tampon 3.1 kısıtlama enzimi Swa I ile sindirmek, bir gerçekleştirin. tam sindirim onaylamak için% 0.8 agaroz jel üzerinde ng 200 - 100 kontrol edin. NOT: Bir doğru sindirilmiş plazmid 14313 bp tek bir grup var olacaktır. Not: enzim ve defosforilasyon ısı inaktivasyonu gerekli değildir. Sindirilen plazmid, -20 ° C&#39;de saklanabilir. </li><li> PCR primerleri Swa I_MtU6F / MtU6R sırasıyla ScaffoldF / Spe I_ScaffoldR kullanılarak pUC gRNA Shuttle 10 plazmidden Medicago truncatula (M +), U6 promoteri ve iskele DNA&#39;lar yükseltmek. PCR, aşağıdaki koşullar ile yüksek aslına polimeraz kullanarak: 3 dakika için 95 ° C; 31 döngü (20 saniye 98 ° C, 15 sn için 60 ° C, 30 saniye için 72 ° C); ve 5 dakika için 72 ° C. <ol><li> PCR pr ~ 3 ul alikotları görselleştirmekbir% 1 agaroz jeli üzerinde oducts amplifikasyon teyit etmek için. MtU6 amplikon 377 bp ve iskele amplikon 106 bp. Üreticinin talimatlarına uygun olarak, kalan PCR ürünleri Kolon saflaştırmak -20 ° C&#39;de UV spektrofotometrisi ve mağaza tarafından tayin edin. </li></ol></li><li> laboratuvar dereceli su içinde 100 uM gRNA oligos tüm tüp tekrar süspansiyon. 1x Tampon 2.1 500 ul 100 uM oligo 1 ul ekle. İyice karıştırın. Birden fazla oligos havuzu varsa, 1x Tampon 2.1 tüpüne her 100 uM oligo 1 ul ekleyin. Seyreltilmiş oligo -20 ° C&#39;de saklanabilir. </li></ol></li><li> ısıtılmış kapak ile, 50 ° C de tutmak için bir termal döngü Program. bir hacme lineer vektör seyreltilmiş gRNA oligo (ler) ve su MtU6 promoteri skafoldun, 12 ng (0.2 pmol), 1 ul (0.2 umol) bir 50 ng (0.2 umol) 100 ng (0.011 umol) birleştirin 5 ul. 2x yüksek sadakat DNA montaj ustası karışımı 5 ul ekleyin iyice karıştırın ve aşağı doğru döndürün. 60 dakika boyunca reaksiyon inkübe50 ° C termal döngü. Daha sonra buz üzerinde reaksiyon yerleştirin. Not: Reaksiyon hacimleri düşük DNA verimi karşılamak için artırılabilir. </li><li> Yeterli E. halinde reaksiyon 2 ul Transform 50 mg L -1 kanamisin (Kan 50) ile takviye LB standart teknikler ve plaka kullanılarak coli hücreleri. gece boyunca 37 ° C&#39;de kaplanmıştır hücreleri büyütün. -20 ° C&#39;de, kalan DNA düzeneği reaksiyonu kaydedin. </li><li> primerler StUbi3P218R ve ISceIR kullanılarak PCR ile koloni ekranı. su ile 1 Kalan DNA düzeneği reaksiyonunun bir kısım seyreltilir: 5&#39;tir. no-insert kontrol olarak Cas9 plazmid: pozitif koloni ekranı için kontrol ve dairesel p201N 1 ng olarak 1 ul kullanın. <ol><li> PCR, aşağıdaki koşullar ile amplifiye; 3 dakika boyunca 95 ° C; 31 döngü (30 saniye için 95 ° C, 30 sn için 58 ° C, 30 saniye için 72 ° C); ve 5 dakika için 72 ° C &#39;de. bir% 1 agaroz jeli üzerinde PCR ürünleri görselleştirme. Doğru girmeler 725 bp ve vektörler zekâ bir grup olduğundan emin olun(örneğin, kesilmemiş vektör) hout ekler bir 310-bp şeridini sahip olacaktır. </li></ol></li><li> 37 ° C&#39;de 50 sıvı kültürler, gece boyunca LB Kan pozitif koloniler büyümek ve üreticinin talimatlarına uygun olarak plazmidler saflaştırılması. Sanger sekansı StUbi3P218R astar ile plazmidler ve hata klonlama esnasında katılan emin olmak için MtU6 promotörü, hedef, ve iskele dizilerine kromatogramlar hizalayın. </li><li> Bir teşhis Eco RV ve Sty I ile plazmid ~ 1 mikrogram sindirerek sindirmek gerçekleştirin % 0.8 agaroz jeli üzerinde görselleştirme. (Bp olarak) parçalarıdır: 4192, 2001, 1743, 1544, 1381, 995, 831, 702, 460, 423, 318, ve 174. </li><li> Birden fazla gRNAs ile vektörleri oluşturmak için DNA donanımını kullanın. <ol><li> İki gRNA kasetler ile bir vektör yapılandırmak için, PCR, ilgili her birinden 1 ng primer UNS1_MtU6F / Spe I_ScaffoldR olan primerler Swa I_MtU6F / UNS1_ScaffoldR ve ikinci pozisyonlar gRNA ile birinci pozisyon gRNA amplifiye1.8 - plazmidler adımlarla 1.1 inşa edilmiştir. Aşama 1.3.3 PCR koşulları kullanarak. amplifikasyon teyit etmek için bir% 1 agaroz jeli üzerinde PCR ürünlerinin ~ 3 ul alikotları görselleştirmek. Amplıkonlar ~ 500 bp. </li><li> Birleştirin ve 200 ul bir tüp içinde un saflaştırılmış PCR ürünleri, yaklaşık olarak eşit miktarda karışımı (tipik olarak 3 - her 4 ul). Montaj için, PCR ürünleri kombine 1 ul, Swa I 50 ng ekleyebilir ve Spe I p201N linearize: Cas9, laboratuvar dereceli su 2.5 ul ve 2x yüksek kalitede DNA montaj ustası karışımı 2.5 ul. 15 dakika boyunca 50 ° C termal döngüleyici içinde inkübe edin. Not: DNA montaj kılavuzları 2 için 15 dakika inkübasyon önerir - 3 fragmanları. </li><li> Yeterli E. içine 2 ul 1 - Dönüşümü LB Kan 50 koli hücreleri ve plaka. gece boyunca 37 ° C &#39;de, tabakalanmış hücrelere büyütün. -20 ° C&#39;de, kalan reaksiyon kaydedin. </li><li> Aşama 1.6 ile aynı koşullarda primerler StUbi3P218R ve ISceIR PCR ile koloni ekranı. doğru cLones 1200 bp amplikon sahip olacaktır. LB Kan olumlu koloniler 50 sıvı kültürleri bir gecede büyümek ve plazmidler arındırmak. </li><li> primerler StUbi3P218R ile Sanger dizisi plazmidler (ilk pozisyon gRNA kapsar) ve p201R (ikinci pozisyon gRNA kapsar). MtU6 promotörü, hedef, ve iskele dizilerine kromatogramlar hizalayın. Teşhis Eco RV ile sindirmek ve Sty I (bp olarak) aşağıdaki parçaları neden olur: 4192, 2476, 1743, 1544, 1381, 995, 831, 702, 460, 423, 318, 174. Koyu renk fragman ikinci gRNA içerir. </li></ol></li><li> Agrobacterium suşu ARqua1 15 rhizogenes içine tüm kalite kontrol beklentilerinin karşılanması sonrasında, plazmid dönüşümü. ayarları ile 1 mm küvet içinde elektro uyumlu hücre ile elektroporasyona 50 ul plazma preparatı 1 ul ekleyin: 2.4 kV, 25 | iF ve 200 w. SOC ~ 500 ul hücre yeniden elde etmek ve 2 saat boyunca 28 ° C&#39;de çalkalanır. LB Kan 50 ve g Plaka2 gün boyunca 28 ° C &#39;de sıra. 1.3.3 ile aynı primerler ve PCR koşulları kullanılarak koloni ekranını gerçekleştirin. Pozitif klonlardan gliserol stokları sağlayın. </li></ol> 2. Tüylü Kök Dönüşüm <ol><li> sabit karıştırma ile 15 dakika boyunca% 20 ev tipi ağartıcı içinde domates tohumu sterilize edin. bir laminar akış başlığı içinde, çamaşır suyu kaldırmak ve steril laboratuar dereceli suda 3 kez yıkayın. </li><li> ½ MS ortamı (2.22 g L-1, MS tuzları + Gamborg vitaminleri, 10 g L-1 sukroz, 3 g L-1 gellan zamkı, pH 5.8) ihtiva eden bir GA-7 kutu içinde levha 30 tohumları. Karanlıkta 2 ~ için gün çimlenme, daha sonra ışığa GA-7 kutularını taşıyın. ışığında ~ 4 gün daha fidan büyür. </li><li> Dönüşüm gün önce, çizgi dışarı A. Katı LB Kan 50 kültürleri rhizogenes ve gece boyunca 28 ° C&#39;de büyür. </li><li> dönüşümün Günü, laminer akış kaputu steril malzemeler monte: 12 ml kültür tüpleri, 50 ml konik tüp, ½ MS sıvı (yok gellan gum), 200 uM asetosiringon, filtre kağıdı, petri, forseps ve neşter, pipetler ve pipet uçları. ½ MS 50 ml asetosiringon 25 ul ilave edin ve her kültür tüpü içine ~ 6 mL dökün. </li><li> A. kazımak için bir bükülmüş 200 ul ucu kullanın ½ MS sıvının 6 ml plaka ve tekrar süspansiyon ile ilgili rhizogenes hücreleri. Vortex tüpü tamamen hücreleri tekrar süspansiyon. Her bir vektör hücrelerin tekrar asılı tutulmasından sonra, 600 nM&#39;lik bir sabit dalga uzunluğunda hücre 1 ml optik yoğunluk (OD) ölçün. OD 0.2 ve 0.4 arasında olmasını sağlayın; sulandırmak veya gerektiği gibi daha fazla hücre ekleyin. Her bir yapı için tekrarlayın. </li><li> steril bir filtre kağıdı ile bir Petri kabı ½ MS sıvı ~ 2 ml ekleyin. nemlendirilmiş filtre kağıdı üzerinde fide ve yerden tüketim kotiledon. Bir kez tüm kotiledon toplanmıştır, iki kesim uçları ile kotiledon parçaları sonuçlanan kotiledon kapalı distal ~ 1 cm kesti. A. eksplantlar ekle rhizogenes çözeltiler, karıştırın ve 20 dakika boyunca inkübeara sıra invertli. Not: yapı için yaklaşık 12 eksplant rutin kullanılan, çok sayıda 80 eksplantlar A. 6 ml aşılanmış olsa rhizogenes çözüm. </li><li> A. sırasında rhizogenes inkübasyon, Petri için filtre kağıdı eklemek, bir başına yapı dönüştürdü. Ayrıca kuru laminer akış kaputu, ½ MS katı ortam, hiçbir antibiyotik ayarlayın. </li><li> A. dışarı kotiledon Scoop Kuru filtre kağıdı üzerinde steril forseps ve yer ile rhizogenes çözüm. Bir sonraki dönüşüm ilerlerken kurumasına yok dokuları sağlamak için Petri kapakla kapatın. Filtre kağıdı ve transferi, alt yüzey tarafında yukarı, üzerinde Blot kotiledon MS ortamı ½. ameliyat bandı ile plakaları sarın 2 gün oda sıcaklığında karanlıkta CO-geliştirin. </li><li> Kadar ko-kültivasyonu, transfer kotiledonlar, alt yüzey tarafında sonra, MS ortamı (300 mg L-1 tikarsilin / klavulanik asit Tim 300 takviye ½ artık kısmından gelişmesini önlemek içinual A. rhizogenes) ve bitki seçimi için Kan 50 () ve cerrahi bant ile sarın. 16 saat fotoperiyodun oda sıcaklığında floresan ışıkları altında kültürleri korumak. </li><li> Uzunluğu 2 hafta kökleri en az 2 cm, steril forseps ve bir neşter kullanarak kotiledonlar kesilmiş ve MS Kan 50 Tim 300 ortamı ½ aktarılır - ~ 1.5 sonra. Tek bir plaka 10 ila 15 kökleri aktarın. Bir işaretleyici ile kök uçları konumunu işaretlemek cerrahi bant ile sarın ve kültür odasında korumak. </li><li> Bir hafta sonra, dönüştürülmüş kök seçici ortam üzerinde büyüme görülür. Tercih DNA ekstraksiyon yöntemi kullanılarak DNA ekstraksiyonu için dönüştürülmüş köklerinin altörneğini hasat. Not: kotiledon ile Tabaklar 2 saklanabilir - kökleri karışık karmaşa içine büyümeye işaret ve izole etmek zordur, bundan sonra 3 haftalık hasat. Sigara hasat kök dokuları süresiz muhafaza edilebilir. birçok analiz izole edilmiş bir DNA örneği üzerinde gerçekleştirilebilirs DNA mutasyon sıklığı ve türünü belirlemek için. Birkaç tür deneylerde elde edilen sonuçlar aşağıda tarif edilmiştir. </li></ol>

<ol>
	<li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Shalem, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-scale+CRISPR-Cas9+knockout+screening+in+human+cells.">Genome-scale CRISPR-Cas9 knockout screening in human cells.</a> Science. 343 (6166), 84-87 (2014).</li><li>Zhou, Y. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+screening+of+a+CRISPR/Cas9+library+for+functional+genomics+in+human+cells.">High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells.</a> Nature. 509 (509), 487-491 (2014).</li><li>Doudna, J. A., Charpentier, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+new+frontier+of+genome+engineering+with+CRISPR-Cas9.">The new frontier of genome engineering with CRISPR-Cas9.</a> Science. 346 (6213), (2014).</li><li>Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Patron, N. J., Nekrasov, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Editing+plant+genomes+with+CRISPR/Cas9.">Editing plant genomes with CRISPR/Cas9.</a> Current Opinion in Biotechnology. 32, 76-84 (2015).</li><li>Bortesi, L., Fischer, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+CRISPR/Cas9+system+for+plant+genome+editing+and+beyond.">The CRISPR/Cas9 system for plant genome editing and beyond.</a> Biotechnology Advances. 33 (1), 41-52 (2015).</li><li>Jia, H. G., Wang, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+editing+of+sweet+orange+using+Cas9/sgRNA.">Targeted genome editing of sweet orange using Cas9/sgRNA.</a> Plos One. 9, (2014).</li><li>Upadhyay, S. K., Kumar, J., Alok, A., Tuli, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-Guided+Genome+Editing+for+Target+Gene+Mutations+in+Wheat.">RNA-Guided Genome Editing for Target Gene Mutations in Wheat.</a> G3-Genes Genomes Genetics. 3 (12), 2233-2238 (2013).</li><li>Ron, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hairy+root+transformation+using+Agrobacterium+rhizogenes.+as+a+tool+for+exploring+cell+type-specific+gene+expression+and+function+using+tomato+as+a+model.">Hairy root transformation using Agrobacterium rhizogenes. as a tool for exploring cell type-specific gene expression and function using tomato as a model.</a> Plant Physiology. 166 (2), 455-U4442 (2014).</li><li>Jacobs, T. B., LaFayette, P. R., Schmitz, R. J., Parrott, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+modifications+in+soybean+with+CRISPR/Cas9.">Targeted genome modifications in soybean with CRISPR/Cas9.</a> BMC Biotechnology. 15, (2015).</li><li>Gibson, D. G., Smith, H. O., Hutchison, C. A., Venter, J. C., Merryman, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+synthesis+of+the+mouse+mitochondrial+genome.">Chemical synthesis of the mouse mitochondrial genome.</a> Nature Methods. 7 (11), 901-903 (2010).</li><li>Zhou, X., Jacobs, T. B., Xue, L. J., Harding, S. A., Tsai, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploiting+SNPs+for+biallelic+CRISPR+mutations+in+the+outcrossing+woody+perennial+Populus+reveals+4-coumarate:CoA+ligase+specificity+and+redundancy.">Exploiting SNPs for biallelic CRISPR mutations in the outcrossing woody perennial Populus reveals 4-coumarate:CoA ligase specificity and redundancy.</a> New Phytologist. , (2015).</li><li>Stemmer, M., Thumberger, T., Keyer, M. D., Wittbrodt, J., Mateo, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CCTop:+An+Intuitive,+Flexible+and+Reliable+CRISPR/Cas9+Target+Prediction+Tool.">CCTop: An Intuitive, Flexible and Reliable CRISPR/Cas9 Target Prediction Tool.</a> Plos One. 10, (2015).</li><li>Lei, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-P:+A+Web+Tool+for+Synthetic+Single-Guide+RNA+Design+of+CRISPR-System+in+Plants.">CRISPR-P: A Web Tool for Synthetic Single-Guide RNA Design of CRISPR-System in Plants.</a> Molecular Plant. 7 (9), 1494-1496 (2014).</li><li>Quandt, H. J., Puhler, A., Broer, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TRANSGENIC+ROOT-NODULES+OF+VICIA-HIRSUTA+-+A+FAST+AND+EFFICIENT+SYSTEM+FOR+THE+STUDY+OF+GENE-EXPRESSION+IN+INDETERMINATE-TYPE+NODULES.">TRANSGENIC ROOT-NODULES OF VICIA-HIRSUTA - A FAST AND EFFICIENT SYSTEM FOR THE STUDY OF GENE-EXPRESSION IN INDETERMINATE-TYPE NODULES.</a> Molecular Plant-Microbe Interactions. 6, 699-706 (1993).</li><li>Zhu, X. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+genotyping+method+for+genome-modified+animals+and+human+cells+generated+with+CRISPR/Cas9+system.">An efficient genotyping method for genome-modified animals and human cells generated with CRISPR/Cas9 system.</a> Scientific Reports. 4 (8), (2014).</li><li>Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Nekrasov, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plant+genome+editing+made+easy:+targeted+mutagenesis+in+model+and+crop+plants+using+the+CRISPR/Cas+system.">Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system.</a> Plant Methods. 9 (1), 39 (2013).</li><li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+using+CRISPR/Cas+systems.">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339 (6121), 819-823 (2013).</li><li>Li, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+and+homologous+recombination-mediated+genome+editing+in+Arabidopsis+and+Nicotiana+benthamiana+using+guide+RNA+and+Cas9.">Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9.</a> Nat Biotech. 31 (8), 688-691 (2013).</li><li>Fu, Y. F., Sander, J. D., Reyon, D., Cascio, V. M., Joung, J. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improving+CRISPR-Cas+nuclease+specificity+using+truncated+guide+RNAs.">Improving CRISPR-Cas nuclease specificity using truncated guide RNAs.</a> Nature Biotechnology. 32 (3), 279-284 (2014).</li><li>Torella, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unique+nucleotide+sequence-guided+assembly+of+repetitive+DNA+parts+for+synthetic+biology+applications.">Unique nucleotide sequence-guided assembly of repetitive DNA parts for synthetic biology applications.</a> Nat Protoc. 9 (9), 2075-2089 (2014).</li><li>Ono, N. N., Tian, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+multiplicity+of+hairy+root+cultures:+Prolific+possibilities.">The multiplicity of hairy root cultures: Prolific possibilities.</a> Plant Science. 180 (3), 439-446 (2011).</li><li>Tepfer, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+several+species+of+higher+plants+by+Agrobacterium+rhizogenes.:+sexual+transmission+of+the+transformed+genotype+and+phenotype.">Transformation of several species of higher plants by Agrobacterium rhizogenes.: sexual transmission of the transformed genotype and phenotype.</a> Cell. 37 (3), 959-967 (1984).</li><li>Li, H., Deng, Y., Wu, T. L., Subramanian, S., Yu, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Misexpression+of+miR482,+miR1512,+and+miR1515+Increases+Soybean+Nodulation.">Misexpression of miR482, miR1512, and miR1515 Increases Soybean Nodulation.</a> Plant Physiology. 153 (4), 1759-1770 (2010).</li><li>Boisson-Dernier, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium+rhizogenes-transformed+roots+of+Medicago+truncatula+for+the+study+of+nitrogen-fixing+and+endomycorrhizal+symbiotic+associations.">Agrobacterium rhizogenes-transformed roots of Medicago truncatula for the study of nitrogen-fixing and endomycorrhizal symbiotic associations.</a> Molecular Plant-Microbe Interactions. 14 (6), 695-700 (2001).</li><li>Collier, R., Fuchs, B., Walter, N., Kevin Lutke, W., Taylor, C. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ex+vitro.+composite+plants:+an+inexpensive,+rapid+method+for+root+biology.">Ex vitro. composite plants: an inexpensive, rapid method for root biology.</a> Plant Journal. 43 (3), 449-457 (2005).</li></ol>

Yazarlar ifşa hiçbir şey yok.

Since DNA assembly is used to recombine any overlapping DNA sequences, this cloning method can be applied to any CRISPR vector construction. Most CRISPR cloning schemes use either gene synthesis of the gRNA, type IIS restriction enzymes17,18, or overlap-extension PCR19. Each of these techniques has inherent advantages and disadvantages, but they typically require multiple hands-on cloning steps. The primary advantage of the cloning method presented here is that the entire process occurs in a single,...

CRISPR ile hedeflenen DNA değişiklikleri oluşturmak için yeteneği / Cas9 işlevsel genomik çalışmalar için büyük bir potansiyele sahiptir. CRISPR / Cas9 sisteminin iki bileşeni vardır; Staphylococcus pyogenes ve hedefli DNA ekibi (s, 1) Cas9 yönlendiren bir yaklaşık 100 nt kılavuz RNA (gRNA) molekülünden türetilen Cas9 nükleaz. Hedef tanıma, ilk olarak haiz ~ hedefleme vektörleri 2,3 yüksek kapasiteli bir üretim sağlayan gRNA, 20-nt. Tasarlanmış olabilir Çoğu organizmalar, zaten CRISPR / Cas9 teknolojisi 4,5 ile olmuştur. Bitkiler, CaMV 35S promotörü gibi yapısal promotörler, in, genel olarak Cas9 nükleaz 6 ekspresyonunu tahrik etmek için kullanılır. gRNAs gRNA ilk taban kısıtlayan RNA polimeraz III U6 ya da U3 promoterler kullanılarak ifade edilir ya G, verimli bir transkripsiyon için U3 U6 veya A için. Ancak RNA polimeraz II baloBu kısıtlamaların ücretsiz oters, aynı zamanda 7,8 kullanılmıştır. Farklı gRNAs farklı verimlilik ile DNA mutasyonlarının neden, ve bu yüzden ilk olarak tüm fabrika dönüşümleri yatırım veya kapsamlı fenotipik ekranlar kurmadan önce CRISPR vektörleri doğrulamak için önemli olabilir. CRISPR geçici ifadesi zordur mutasyonlar ve bu yaklaşımlar ile pratik fenotipik deneylerinin algılama hale stabil bitkilerde 6 ile karşılaştırıldığında, genel olarak, DNA modifikasyon daha düşük bir frekans ile sonuçlanır örneğin agroinfiltration kullanarak, bitkilerde oluşturur. Sözde saçak kökler stabil bitkiler için ay karşı bağımsız kararlı bir şekilde transforme edilmiş bir malzeme çok sayıda hafta içinde oluşturulabilir çünkü uygun, alternatif sistem vardır. CRISPR vektörleri saçak kök 9,10 DNA mutasyonlarının uyaran çok etkilidir. DNA montaj yöntemleri etkin bir şekilde overl içeren DNA parçalarını birbirine bağlamakapping 11 sona erer. Bazı DNA düzeneği yöntemlerinin önemli bir avantajı birleştirilmiş ürünler haline ssDNA (yani, oligolar) dahil yeteneğidir. gRNAs yalnızca ~ 20 nt uzunluğunda ve yeni hedefler sentezlenen oligo yapılabilir için, bu DNA montaj yöntemleri CRISPR klonlama için de uygundur. Burada anlatılan protokollerin başarılı soya 10, kavak 12 kullanılan ve şu anda domates edilmiş CRISPR vektörlerinin P201 serisi dayanmaktadır. Sunulan klonlama işlemi geçerli klonlama yöntemiyle 10 üzerinde çeşitli avantajlar sunuyor. Yani, tam fonksiyonel vektörler tek bir gün içinde tek bir klonlama reaksiyonda oluşturulabilir. Vektör yapımı daha da eller üzerinde zaman ve malzeme maliyetleri azaltarak, paralel olarak birden fazla CRISPR vektörleri oluşturmak için toplanmış olabilir. Ayrıca hedef gen delesyonlu transjenik malzemeler üretmek için etkili bir yöntem olarak, domates saçak kök oluşumu için bir protokol mevcut. Saçak kök geçerlidir için kullanılırCRISPR vektörleri yedik ve daha sonraki deneyler için malzeme sağlamak.

<table border="0" cellpadding="0" cellspacing="0" width="761">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:219px;">NEBuilder&#174; (HiFi DNA assembly mix)</td>
			<td style="width:139px;">New England Biolabs</td>
			<td style="width:247px;">E5520</td>
			<td style="width:157px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">p201N:Cas9</td>
			<td>Addgene</td>
			<td>59175</td>
			<td>The p201H:Cas9 plasmid (59176) is also compatible with the reported overlaps and enzymes.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">pUC gRNA Shuttle</td>
			<td>Addgene</td>
			<td>47024</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SwaI</td>
			<td>New England Biolabs</td>
			<td>R0604S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SpeI</td>
			<td>New England Biolabs</td>
			<td>R0133S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Zymo clean and concentrator-5 column purification</td>
			<td>Zymo Research</td>
			<td>D4003</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NEB Buffer 2.1</td>
			<td>New England Biolabs</td>
			<td>B7202S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NEB CutSmart (Buffer 4)</td>
			<td>New England Biolabs</td>
			<td>B7204S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NEB Buffer 3.1</td>
			<td>New England Biolabs</td>
			<td>B7203S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">EconoSpin Mini Spin Column (plasmid prep)</td>
			<td>Epoch Life Sciences</td>
			<td>1910-050/250</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">EcoRV-HF&#174;</td>
			<td>New England Biolabs</td>
			<td>R3195S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">StyI-HF&#174;</td>
			<td>New England Biolabs</td>
			<td>R3500S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">MS Salts + Gamborg Vitamins</td>
			<td>Phytotechnology Laboratories</td>
			<td>M404</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Phytagel&#8482; (gellan gum)</td>
			<td>Sigma Aldrich</td>
			<td>P8169</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">GA-7 Boxes</td>
			<td>Sigma Aldrich</td>
			<td>V8505</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Micropore&#8482; surgical tape</td>
			<td>3M</td>
			<td>1535-0</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Timentin&#174; (Ticarcillin/Clavulanic acid)</td>
			<td>Various</td>
			<td>0029-6571-26</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Primers 5&#39; -&#62; 3&#39;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SwaI_MtU6F&#160;</td>
			<td colspan="3">GATATTAATCTCTTCGATGAAATTTATGCCTATCTTATATGATCAATGAGG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MtU6R&#160;&#160;</td>
			<td colspan="2">AAGCCTACTGGTTCGCTTGAAG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ScaffoldF&#160;</td>
			<td colspan="2">GTTTTAGAGCTAGAAATAGCAAGTT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SpeI_Scaffold R</td>
			<td colspan="3">GTCATGAATTGTAATACGACTCAAAAAAAAGCACCGACTCGGTG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">StUbi3P218R&#160;</td>
			<td colspan="2">ACATGCACCTAATTTCACTAGATGT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ISceIR</td>
			<td colspan="2">GTGATCGATTACCCTGTTATCCCTAG</td>
			<td>Cannot be used for Sanger sequencing since there is a second binding site on the plasmid</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">UNS1_Scaffold R&#160;</td>
			<td colspan="2">GAGAATGGATGCGAGTAATGAAAAAAAGCACCGACTCGGTG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">UNS1_MtU6 F&#160;&#160;</td>
			<td colspan="3">CATTACTCGCATCCATTCTCATGCCTATCTTATATGATCAATGAGG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">p201R&#160;</td>
			<td colspan="2">CGCGCCGAATTCTAGTGATCG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="3" height="21" style="height:21px;">Bolded sequences denote 20-nt overlaps with linearized p201N:Cas9.</td>
			<td></td>
		</tr>
	</tbody>
</table>

high-throughput crispr vector construction and characterization of dna modifications by generation of tomato hairy roots

Targeted DNA mutations generated by vectors with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology have proven useful for functional genomics studies. While most cloning strategies are simple to perform, they generally use multiple steps and can require several days to generate the ultimate constructs. The method presented here is based on DNA assembly and can produce fully functional CRISPR vectors in a single cloning reaction. Vector construction can also be pooled, further increasing the efficiency and utility of the process. A modification of the method is used to create CRISPR vectors with multiple gene targets. CRISPR vectors are then transformed into tomato hairy roots to generate transgenic materials with targeted DNA modifications. Hairy roots are a useful system for testing vector functionality as they are technically simple to generate and amenable to large-scale production. The methods presented here will have wide application as they can be used to generate a variety of CRISPR vectors and be used in a wide range of plant species.

DNA, montaj ile CRISPR vektör oluşturulması, tipik olarak, bağımsız klondan On ila yüzlerce oluşturur. PCR ile koloni taraması kolayca doğru klonlar tanımlar ve ve sorun giderme için kullanışlıdır ekler (Şekil 2A) olmadan plazmidler ayırt edebilirsiniz. Tipik olarak, klonların hepsi bir ek içeren ve bir kullanıcı tamamen koloni tarama adımlarını atlamak için tercih edebilir. Teşhis dijestleri (Şekil 2B) ve Sanger dizileme kali...

Watch this Scientific Journal Video about High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots at JoVE.com

High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots

Domates Tüylü Roots Üretimi ile yüksek verim CRISPR Vektör İnşaat ve DNA Değişiklikler Karakterizasyonu

DNA, düzeneğini kullanarak çok CRISPR vektörleri CRISPR çok sayıda yapı yapım tek klonlama reaksiyonda paralel yapılabilir basit bir işlem vektörleri. Domates kıllı kökleri CRISPR vektörleri doğrulamak ve mutant malzemeleri üretmek için mükemmel bir model sistem.

Targeted DNA mutations generated by vectors with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology have proven useful for ...

high-throughput-crispr-vector-construction-characterization-dna

Research

JoVE Journal

Biology

17.8K Görüntüleme.  Boyce Thompson Institute for Plant Research.  DNA, düzeneğini kullanarak çok CRISPR vektörleri CRISPR çok sayıda yapı yapım tek klonlama reaksiyonda paralel yapılabilir basit bir işlem vektörleri. Domates kıllı kökleri CRISPR vektörleri doğrulamak ve mutant malzemeleri üretmek için mükemmel bir model sistem. 

Video: High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots

Generation of RNA/DNA Hybrids in Genomic DNA by Transformation using RNA-containing Oligonucleotides

Synthetic short nucleic acid polymers, oligonucleotides (oligos), are the most functional and widespread tools of molecular biology. Oligos can be produced to contain any desired DNA or RNA sequence and can be prepared to include a wide variety of base and sugar modifications. Moreover, oligos can be designed to mimic specific nucleic acid alterations and thus, can serve as important tools to investigate effects of DNA damage and mechanisms of repair. We found that Thermo Scientific Dharmacon RNA-containing oligos with a length between 50 and 80 nucleotides can be particularly suitable to study, in vivo, functions and consequences of chromosomal RNA/DNA hybrids and of ribonucleotides embedded into DNA. RNA/DNA hybrids can readily form during DNA replication, repair and transcription, however, very little is known about the stability of RNA/DNA hybrids in cells and to which extent these hybrids can affect the genetic integrity of cells. RNA-containing oligos, therefore, represent a perfect vector to introduce ribonucleotides into chromosomal DNA and generate RNA/DNA hybrids of chosen length and base composition. Here we present the protocol for the incorporation of ribonucleotides into the genome of the eukaryotic model system yeast /Saccharomyces cerevisiae/. Yet, our lab has utilized Thermo Scientific Dharmacon RNA-containing oligos to generate RNA/DNA hybrids at the chromosomal level in different cell systems, from bacteria to human cells.

This work shows how to form an RNA/DNA hybrid at the chromosomal level and reveal transfer of genetic information from RNA to genomic DNA in yeast cells.

RNA içeren Oligonükleotidler kullanarak Dönüşüm Genomik DNA, RNA / DNA Hibritlerin Üretimi

Synthetic short nucleic acid polymers, oligonucleotides (oligos), are the most functional and widespread tools of molecular biology. Oligos can be ...

Biyoloji

Ice-Cap: A Method for Growing Arabidopsis and Tomato Plants in 96-well Plates for High-Throughput Genotyping

It is becoming common for plant scientists to develop projects that require the genotyping of large numbers of plants. The first step in any genotyping project is to collect a tissue sample from each individual plant. The traditional approach to this task is to sample plants one-at-a-time. If one wishes to genotype hundreds or thousands of individuals, however, using this strategy results in a significant bottleneck in the genotyping pipeline. The Ice-Cap method that we describe here provides a high-throughput solution to this challenge by allowing one scientist to collect tissue from several thousand seedlings in a single day 1,2. This level of throughput is made possible by the fact that tissue is harvested from plants 96-at-a-time, rather than one-at-a-time.
The Ice-Cap method provides an integrated platform for performing seedling growth, tissue harvest, and DNA extraction. The basis for Ice-Cap is the growth of seedlings in a stacked pair of 96-well plates. The wells of the upper plate contain plugs of agar growth media on which individual seedlings germinate. The roots grow down through the agar media, exit the upper plate through a hole, and pass into a lower plate containing water. To harvest tissue for DNA extraction, the water in the lower plate containing root tissue is rapidly frozen while the seedlings in the upper plate remain at room temperature. The upper plate is then peeled away from the lower plate, yielding one plate with 96 root tissue samples frozen in ice and one plate with 96 viable seedlings. The technique is named "Ice-Cap" because it uses ice to capture the root tissue. The 96-well plate containing the seedlings can then wrapped in foil and transferred to low temperature. This process suspends further growth of the seedlings, but does not affect their viability. Once genotype analysis has been completed, seedlings with the desired genotype can be transferred from the 96-well plate to soil for further propagation. We have demonstrated the utility of the Ice-Cap method using Arabidopsis thaliana, tomato, and rice seedlings. We expect that the method should also be applicable to other species of plants with seeds small enough to fit into the wells of 96-well plates.

Ice-Cap: A Method for Growing Arabidopsis and Tomato Plants in 96-well Plates for High-Throughput Genotyping

The Ice-Cap method allows one to grow plants in 96-well plates and non-destructively harvest root tissue from each seedling. DNA extracted from this root tissue can be used for genotyping reactions. We have found that Ice-Cap works well for Arabidopsis thaliana, tomato, and rice seedlings.

Ice-Cap: Büyüyen Bir Yöntem Arabidopsis</emYüksek Verim Genotiplendirme için 96-iyi Tabaklar ve Domates Tesisleri>

It is becoming common for plant scientists to develop projects that require the genotyping of large numbers of plants. The first step in any genotyping ...

Substrate Generation for Endonucleases of CRISPR/Cas Systems

The interaction of viruses and their prokaryotic hosts shaped the evolution of bacterial and archaeal life. Prokaryotes developed several strategies to evade viral attacks that include restriction modification, abortive infection and CRISPR/Cas systems. These adaptive immune systems found in many Bacteria and most Archaea consist of clustered regularly interspaced short palindromic repeat (CRISPR) sequences and a number of CRISPR associated (Cas) genes (Fig. 1) 1-3. Different sets of Cas proteins and repeats define at least three major divergent types of CRISPR/Cas systems 4. The universal proteins Cas1 and Cas2 are proposed to be involved in the uptake of viral DNA that will generate a new spacer element between two repeats at the 5' terminus of an extending CRISPR cluster 5. The entire cluster is transcribed into a precursor-crRNA containing all spacer and repeat sequences and is subsequently processed by an enzyme of the diverse Cas6 family into smaller crRNAs 6-8. These crRNAs consist of the spacer sequence flanked by a 5' terminal (8 nucleotides) and a 3' terminal tag derived from the repeat sequence 9. A repeated infection of the virus can now be blocked as the new crRNA will be directed by a Cas protein complex (Cascade) to the viral DNA and identify it as such via base complementarity10. Finally, for CRISPR/Cas type 1 systems, the nuclease Cas3 will destroy the detected invader DNA 11,12 .
These processes define CRISPR/Cas as an adaptive immune system of prokaryotes and opened a fascinating research field for the study of the involved Cas proteins. The function of many Cas proteins is still elusive and the causes for the apparent diversity of the CRISPR/Cas systems remain to be illuminated. Potential activities of most Cas proteins were predicted via detailed computational analyses. A major fraction of Cas proteins are either shown or proposed to function as endonucleases 4.
Here, we present methods to generate crRNAs and precursor-cRNAs for the study of Cas endoribonucleases. Different endonuclease assays require either short repeat sequences that can directly be synthesized as RNA oligonucleotides or longer crRNA and pre-crRNA sequences that are generated via in vitro T7 RNA polymerase run-off transcription. This methodology allows the incorporation of radioactive nucleotides for the generation of internally labeled endonuclease substrates and the creation of synthetic or mutant crRNAs. Cas6 endonuclease activity is utilized to mature pre-crRNAs into crRNAs with 5'-hydroxyl and a 2',3'-cyclic phosphate termini.

CRISPR/Cas systems mediate adaptive immunity in Bacteria and Archaea. Many Cas proteins are proposed to act as endoribonucleases acting on crRNA precursors of varying length. Here we illustrate three different approaches to generate pre-crRNA substrates for the biochemical analysis of Cas endonuclease activity.

CRISPR / Cas Sistemleri Endonükleazlar için Substrat Üretimi

The  interaction of viruses and their prokaryotic hosts shaped the evolution of  bacterial and archaeal life. Prokaryotes developed several strategies to ...

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing (ChIP-seq)

ChIP-sequencing (ChIP-seq) methods directly offer whole-genome coverage, where combining chromatin immunoprecipitation (ChIP) and massively parallel sequencing can be utilized to identify the repertoire of mammalian DNA sequences bound by transcription factors in vivo. "Next-generation" genome sequencing technologies provide 1-2 orders of magnitude increase in the amount of sequence that can be cost-effectively generated over older technologies thus allowing for ChIP-seq methods to directly provide whole-genome coverage for effective profiling of mammalian protein-DNA interactions.
For successful ChIP-seq approaches, one must generate high quality ChIP DNA template to obtain the best sequencing outcomes. The description is based around experience with the protein product of the gene most strongly implicated in the pathogenesis of type 2 diabetes, namely the transcription factor transcription factor 7-like 2 (TCF7L2). This factor has also been implicated in various cancers.
Outlined is how to generate high quality ChIP DNA template derived from the colorectal carcinoma cell line, HCT116, in order to build a high-resolution map through sequencing to determine the genes bound by TCF7L2, giving further insight in to its key role in the pathogenesis of complex traits.

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing ChIP-seq

The combination of chromatin immunoprecipitation and ultra-high-throughput sequencing (ChIP-seq) can identify and map protein-DNA interactions in a given tissue or cell line. Outlined is how to generate a high quality ChIP template for subsequent sequencing, using experience with the transcription factor TCF7L2 as an example.

Yüksek verim Sıralama için Yüksek Kalite Kromatin Immunoprecipitation DNA Şablon üretimi (ChIP-seq)

ChIP-sequencing (ChIP-seq) methods directly  offer whole-genome coverage, where combining chromatin immunoprecipitation  (ChIP) and massively parallel ...

Targeted DNA Methylation Analysis by Next-generation Sequencing

The role of epigenetic processes in the control of gene expression has been known for a number of years. DNA methylation at cytosine residues is of particular interest for epigenetic studies as it has been demonstrated to be both a long lasting and a dynamic regulator of gene expression. Efforts to examine epigenetic changes in health and disease have been hindered by the lack of high-throughput, quantitatively accurate methods. With the advent and popularization of next-generation sequencing (NGS) technologies, these tools are now being applied to epigenomics in addition to existing genomic and transcriptomic methodologies. For epigenetic investigations of cytosine methylation where regions of interest, such as specific gene promoters or CpG islands, have been identified and there is a need to examine significant numbers of samples with high quantitative accuracy, we have developed a method called Bisulfite Amplicon Sequencing (BSAS). This method combines bisulfite conversion with targeted amplification of regions of interest, transposome-mediated library construction and benchtop NGS. BSAS offers a rapid and efficient method for analysis of up to 10 kb of targeted regions in up to 96 samples at a time that can be performed by most research groups with basic molecular biology skills. The results provide absolute quantitation of cytosine methylation with base specificity. BSAS can be applied to any genomic region from any DNA source. This method is useful for hypothesis testing studies of target regions of interest as well as confirmation of regions identified in genome-wide methylation analyses such as whole genome bisulfite sequencing, reduced representation bisulfite sequencing, and methylated DNA immunoprecipitation sequencing.

Bisulfite amplicon sequencing (BSAS) is a method for quantifying cytosine methylation in targeted genomic regions of interest. This method uses bisulfite conversion paired with PCR amplification of target regions prior to next-generation sequencing to produce absolute quantitation of DNA methylation at a base-specific level.

DNA Metilasyon Analizi nesil Dizilimine tarafından hedef

The role of epigenetic processes in the control of gene expression has been known for a number of years. DNA methylation at cytosine residues is of ...

High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays focus on transcriptional regulation, being essentially aimed at the identification of promoter-targeting molecules. As a result, post-transcriptional mechanisms are largely uncovered by gene expression targeted drug development. Here we describe a cell-based assay aimed at investigating the role of the 3&#39; untranslated region (3&#8217; UTR) in the modulation of the fate of its mRNA, and at identifying compounds able to modify it. The assay is based on the use of a luciferase reporter construct containing the 3&#8217; UTR of a gene of interest stably integrated into a disease-relevant cell line. The protocol is divided into two parts, with the initial focus on the primary screening aimed at the identification of molecules affecting luciferase activity after 24 hr of treatment. The second part of the protocol describes the counter-screening necessary to discriminate compounds modulating luciferase activity specifically through the 3&#8217; UTR. In addition to the detailed protocol and representative results, we provide important considerations about the assay development and the validation of the hit(s) on the endogenous target. The described cell-based reporter gene assay will allow scientists to identify molecules modulating protein levels via post-transcriptional mechanisms dependent on a 3&#8217; UTR.

Here we describe a cell-based reporter gene assay as a valuable tool to screen chemical libraries for compounds modulating post-transcriptional control mechanisms exerted through 3&#8217; UTR.

Post-transkripsiyonel ayarlı genlerin kimyasal Modülatörler için yüksek verimli tarama

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays ...

DamID-seq: Genome-wide Mapping of Protein-DNA Interactions by High Throughput Sequencing of Adenine-methylated DNA Fragments

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is an alternative approach to chromatin immunoprecipitation (ChIP). An expressed fusion protein consisting of the protein of interest and the E. coli DNA adenine methyltransferase can methylate the adenine base in GATC motifs near the sites of protein-DNA interactions. Adenine-methylated DNA fragments can then be specifically amplified and detected. The original DamID assay detects the genomic locations of methylated DNA fragments by hybridization to DNA microarrays, which is limited by the availability of microarrays and the density of predetermined probes. In this paper, we report the detailed protocol of integrating high throughput DNA sequencing into DamID (DamID-seq). The large number of short reads generated from DamID-seq enables detecting and localizing protein-DNA interactions genome-wide with high precision and sensitivity. We have used the DamID-seq assay to study genome-nuclear lamina (NL) interactions in mammalian cells, and have noticed that DamID-seq provides a high resolution and a wide dynamic range in detecting genome-NL interactions. The DamID-seq approach enables probing NL associations within gene structures and allows comparing genome-NL interaction maps with other functional genomic data, such as ChIP-seq and RNA-seq.

We describe herein an assay by coupling DNA adenine methyltransferase identification (DamID) to high throughput sequencing (DamID-seq). This improved method provides a higher resolution and a wider dynamic range, and allows analyzing DamID-seq data in conjunction with other high throughput sequencing data such as ChIP-seq, RNA-seq, etc.

DamID seq: Adenin-metillenmiş DNA Fragments Yüksek Verimli Dizileme tarafından Protein-DNA Etkileşimleri genom Haritalama

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is ...

Amplification, Next-generation Sequencing, and Genomic DNA Mapping of Retroviral Integration Sites

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of diverse libraries of retroviral integration sites using ligation-mediated PCR (LM-PCR) amplification and next-generation sequencing (NGS), (2) mapping the genomic location of each virus-host junction using BEDTools, and (3) analyzing the data for statistical relevance. Genomic DNA extracted from infected cells is fragmented by digestion with restriction enzymes or by sonication. After suitable DNA end-repair, double-stranded linkers are ligated onto the DNA ends, and semi-nested PCR is conducted using primers complementary to both the long terminal repeat (LTR) end of the virus and the ligated linker DNA. The PCR primers carry sequences required for DNA clustering during NGS, negating the requirement for separate adapter ligation. Quality control (QC) is conducted to assess DNA fragment size distribution and adapter DNA incorporation prior to NGS. Sequence output files are filtered for LTR-containing reads, and the sequences defining the LTR and the linker are cropped away. Trimmed host cell sequences are mapped to a reference genome using BLAT and are filtered for minimally 97% identity to a unique point in the reference genome. Unique integration sites are scrutinized for adjacent nucleotide (nt) sequence and distribution relative to various genomic features. Using this protocol, integration site libraries of high complexity can be constructed from genomic DNA in three days. The entire protocol that encompasses exogenous viral infection of susceptible tissue culture cells to integration site analysis can therefore be conducted in approximately one to two weeks. Recent applications of this technology pertain to longitudinal analysis of integration sites from HIV-infected patients.

We describe a protocol for amplifying retroviral integration sites from the genomic DNA of infected cells, sequencing the amplified virus-host junctions, and then mapping these sequences to a reference genome. We also describe techniques to quantify the distribution of integration sites relative to various genomic annotations using BEDTools.

Retroviral Entegrasyon Siteleri Amplifikasyon, Yeni Nesil Sıralama ve Genomik DNA Haritalama

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of ...

Isolation, Characterization, And High Throughput Extracellular Flux Analysis of Mouse Primary Renal Tubular Epithelial Cells

Mitochondrial dysfunction in the renal tubular epithelial cells (TECs) can lead to renal fibrosis, a major cause of&#160;chronic kidney disease (CKD). Therefore, assessing mitochondrial function in primary TECs may provide valuable insight into the bioenergetic status of the cells, providing insight into the pathophysiology of CKD. While there are a number of complex protocols available for the isolation and purification of proximal tubules in different species, the field lacks a cost-effective method optimized for&#160;tubular cell isolation without the need for purification. Here, we provide an isolation protocol that allows for studies focusing on both primary mouse proximal and distal renal TECs. In addition to cost-effective reagents and minimal animal procedures required in this protocol, the isolated cells maintain high energy levels after isolation and can be sub-cultured up to four&#160;passages, allowing for continuous studies. Furthermore, using a high throughput extracellular flux analyzer, we assess the mitochondrial respiration directly in the isolated TECs in a 96-well plate for which we provide recommendations for the optimization of cell density and compound concentration. These observations suggest that this protocol can be used for renal tubular ex vivo studies with a consistent, well-standardized production of renal TECs. This protocol may have broader future applications to study mitochondrial dysfunction associated with renal disorders for drug discovery or drug characterization purposes.

This protocol provides a cost-effective approach to isolate and characterize mouse primary renal tubular cells that can subsequently be sub-cultured to assess renal biological functions ex vivo, including mitochondrial bioenergetics.

Yalıtım, karakterizasyonu ve yüksek işlem hacmi ekstraselüler akı analiz fare birincil Renal tübüler epitel hücresi

Mitochondrial dysfunction in the renal tubular epithelial cells (TECs) can lead to renal fibrosis, a major cause of&#160;chronic kidney disease (CKD). ...

Tick Microbiome Characterization by Next-Generation 16S rRNA Amplicon Sequencing

In recent decades, vector-borne diseases have re-emerged and expanded at alarming rates, causing considerable morbidity and mortality worldwide. Effective and widely available vaccines are lacking for a majority of these diseases, necessitating the development of novel disease mitigation strategies. To this end, a promising avenue of disease control involves targeting the vector microbiome, the community of microbes inhabiting the vector. The vector microbiome plays a pivotal role in pathogen dynamics, and manipulations of the microbiome have led to reduced vector abundance or pathogen transmission for a handful of vector-borne diseases. However, translating these findings into disease control applications requires a thorough understanding of vector microbial ecology, historically limited by insufficient technology in this field. The advent of next-generation sequencing approaches has enabled rapid, highly parallel sequencing of diverse microbial communities. Targeting the highly-conserved 16S rRNA gene has facilitated characterizations of microbes present within vectors under varying ecological and experimental conditions. This technique involves amplification of the 16S rRNA gene, sample barcoding via PCR, loading samples onto a flow cell for sequencing, and bioinformatics approaches to match sequence data with phylogenetic information. Species or genus-level identification for a high number of replicates can typically be achieved through this approach, thus circumventing challenges of low detection, resolution, and output from traditional culturing, microscopy, or histological staining techniques. Therefore, this method is well-suited for characterizing vector microbes under diverse conditions but cannot currently provide information on microbial function, location within the vector, or response to antibiotic treatment. Overall, 16S next-generation sequencing is a powerful technique for better understanding the identity and role of vector microbes in disease dynamics.

Here we present a next-generation sequencing protocol for 16S rRNA sequencing which enables identification and characterization of microbial communities within vectors. This method involves DNA extraction, amplification and barcoding of samples through PCR, sequencing on a flow-cell, and bioinformatics to match sequence data to phylogenetic information.

Kene Microbiome karakterizasyonu tarafından yeni nesil 16S rRNA Amplicon sıralama

In recent decades, vector-borne diseases have re-emerged and expanded at alarming rates, causing considerable morbidity and mortality worldwide. Effective ...