We thank Dr. Tadashi Koyama for technical help. This work was supported in part by JSPS KAKENHI Grant Numbers 23249045, 15K09211, 15K19172; a grant to the Respiratory Failure Research Group from the Ministry of Health, Labour and Welfare, Japan; a grant for research on allergic disease and immunology, Japan.

1. Hazırlıklar ve Kültür Akciğer Epitel Hücreleri <ol><li> Dulbecco Modifiye Edilmiş Eagle Ortamı (DMEM) içinde kültür A549 insan akciğer epitel hücreleri (yapışık hücre çizgisi), 100 ug / ml streptomisin ve% 10 fetal sığır serumu (FBS), 100 lU / ml penisilin, ve. </li><li> Çıkarın ve Kültür bir tabaktan alınan hücre kültürü ortamı atmak ve 5 ile bir kez yıkayın - fosfat tamponlu tuzlu su, 10 ml (PBS). Yıkandıktan sonra, hemen PBS aspire. </li><li> 3 dakika boyunca CO2 2 ml tripsin / etilendiamintetraasetik asit (EDTA) (% 0.05) ilave edin ve 37 ° C&#39;de inkübe ve% 5. </li><li> Hücre kültürü ortamı, santrifüj 150 x g&#39;de 4 dakika boyunca oda sıcaklığında tüpler ihtiva eden santrifüj tüplerine müstakil hücreleri toplamak. </li><li> hücreler, hücre kültür ortamının 2 ml pelet ve hücre sayımı için bir örnek çıkarın. hücre canlılığı kontrol etmek için Tripan mavi leke hemasitometre kullanarak hücrelerin sayısını. </li><li> Tohum A549 hücreleri0.5 bir yoğunlukta en az 10 cm polistiren plakaları - jel daralma deneyi için ortam, 10 ml 1.0 x 10 6 hücre / çanak. 0.5 yoğunluğunda 6 oyuklu polistiren plâkalar üzerine hücreleri Tohum - 1.0 x 10 5 hücre / göz ile EMT onay orta 2 mi. 24 saat boyunca CO2 37 ° C&#39;de inkübe hücreleri ve% 5. </li></ol> 2. EMT Prosedürü <ol><li> Aşama 1.6 tohumlandı jel daralma deneyi için plakaya TGF-ß1 (5 ug / ml) 10 ul ve TNF-a, 10 ul (10 ug / ml) eklenir. Aşama 1.6 tohumlandı EMT onay plakasına TGF-ß1 (5 ug / ml) 2 ul ve TNF-a 2 ul (10 ug / ml) eklenir. 48 saat boyunca CO2 37 ° C&#39;de inkübe edilir ve% 5. </li></ol> PCR ve Western Blot ile EMT Usul 3. Onay <ol><li> Faz kontrast mikroskopi kullanılarak tedavi hücrelerin (şekil mili için çakıl taşı gibi itibaren) morfoloji değişikliği onaylayın. Not: Normark A549 hücreleri, epitel hücreleri bir özelliğidir çakıl taşı gibi ve üçgen şekilli bir görünüşe sahip, ancak, TGF-ß1 ve TNF-a ile uyarılmasından sonra hücreler uzun görünür ve mil bu mezenkimal hücreler 14,15 benzer şekilli. </li><li> Bu E-kadherin gibi bir epitel işaretleyici ekspresyonunu değerlendirmek ve PCR ve Batı lekeleme ile örneğin N-kaderin, vimentin ve α-düz kas aktin gibi mezenşimal belirteçleri. <ol><li> RNA özütleme kiti 16 ile hücrelerden toplam RNA ekstrakte edin ve üreticinin protokolüne uygun olarak, ters transkriptaz 17 kullanarak cDNA sentezlemek. </li><li> Gerçek zamanlı PCR sistemi 18 ve üreticilerin talimatlarına göre monomerik siyanin boyası PCR kiti kullanılarak mRNA seviyelerinin ifadesini ölçün. GAPDH için spesifik primerler (gliseraldehid 3-fosfat dehidrojenaz), ACTA2 (alfa-aktin-2), CDH1 (kaderin-1; E-kadherin) ve VIM (vimentin), Tablo 1 &#39;de gösterilmiştir </st&gt; Rong. </li><li> Lyse bir parçalama tamponu (Tablo 2)% 1 proteaz önleyici kokteyl içeren çözelti ile hücreleri. Bir protein tahlil kiti 19,20 kullanarak tüm numune protein konsantrasyonlarını ölçmek ve bir poliakrilamid jel protein aynı miktarda uygulanır. <ol><li> SDS jel-elektroforez ve PVDF membranı 21 proteinlerin yarı-kuru transferi gerçekleştirin. 2 saat 1 - blokaj tamponunda primer antikorlar ile membran inkübe edin. İnkübasyondan sonra yıkama tamponu ile iki defa zarın yıkanması ve ikinci antikor ile membran 1 saat inkübe edilir. Not: Bu çalışmalarda kullanılan antikorlar ve seyreltileri malzemeleri / donatım tabloya bakınız. Bloke edici tampon bileşenleri için Tablo 2&#39;ye bakınız. </li><li> iki kez yıkama tamponu ile membran yıkayın. Soğuk CCD kamera 11,23 kullanarak Western lekeleme tespit kiti 22 ile membran fotoğraf çekmek. </li></ol></li></ol></li></ol> 4. Değerlendirilmesi EMT için Jel Daralma Deneyi <ol><li> Hücre kültürü kabından koşullu ortam aspire ve 5 ile iyice yıkayın - ölü hücreleri çıkarmak için 10 ml PBS. Yıkandıktan sonra, hemen PBS aspire. </li><li> 3 dakika boyunca CO2,% 0.05 tripsin / EDTA 2 ml ilave edilir ve 37 ° C&#39;de inkübe ve% 5. </li><li> DMEM 150 x g&#39;de 4 dakika boyunca oda sıcaklığında tripsin inhibitörü (1 mg / ml), santrifüj tüpleri ile takviye içeren santrifüj tüplerine müstakil hücreleri toplamak. </li><li> damıtılmış su olan tip 1 kollajen jel karıştırın ve DMEM konsantre edildi 4 x 1.75 mg / ml&#39;lik bir konsantrasyon elde etmek için kolajen seviyesini ayarlamak için ve 1 x DMEM konsantrasyonu. Bu adımı sırasında buz üzerinde jel ortamı tutmak için emin olun. Not: Jel ortamı 6 mi yapmak için, iyi 3.5 mi tip 1 kollajen jel (3 mg / ml) 1.5 ila 4 x konsantre edildi mL DMEM ve 1 ml damıtılmış su karıştırılır. </li><li> 500 ul PBS hücre pelletini ve hücre sayımı için bir örnek çıkarın. OrtakTripan mavi boyası ile bir hemositometre kullanılarak hücre sayısı, hücre canlılığı ile kontrol edin. </li><li> Yavaşça, bir hücre 3.0 x 10 5 hücre yoğunluğu / oyuk (6.0 x 10 5 hücre / ml) ve elde ancak hızla jelleşme olmadan pipetleme ile karıştırarak seviyesini ayarlamak için jel orta ekleyin. </li><li> düzgün silindir biçiminde yapmak için hızlı ve dikkatli bir şekilde 24 oyuklu işlenmemiş plakanın her oyuğuna 0.5 ml koyun. Herhangi bir hava kabarcıkları jeller (Şekil 1A) kirletmesine izin vermemek için dikkatli olun. hücreleri içeren jel orta viskoz ve kolayca kuyuda jel ve form hilal şekli olabilir: Not. </li><li> 37 ° C&#39;de bir hücre kuluçka makinesi içinde, 15 dakika boyunca inkübasyona bırakılır,% 5 CO2 ve% 95 nem, tamamen jel. </li><li> Bir yönde bir çevresi çekmek için bir şekilde sterilize edilmiş bir spatula taşıyarak bozmadan plaka jeller ayırın. Bir spatula kullanarak, yavaşça 60 mm doku kültürü yemekleri jeller aktarmakya da TGF-ß1 (5 ng / ml) ve TNF-a (10 ng / ml) olmadan DMEM /% 1 FBS, 5 ml ihtiva etmektedir. </li><li> Yavaşça jeller ortamda yüzen sağlamak için yemekler sallayın. 37 ° C&#39;de,% 5 CO2 ve% 95 nemde bir hücre kuluçka makinesi içinde inkübe edin. </li></ol> Jel Boyutu 5. Ölçüm <ol><li> bir görüntü analiz sistemi kullanılarak, 0, 24, 48, ve 72 saat sonra kolajen jel boyutu ölçülür. <ol><li> Jel dokümantasyon sistemi (Şekil 2A) açın ve ışık geçirmeyen bir kabinin içine yemekler koymak. Sonra kabine yemeklerin kapağını çıkarmak. </li><li> İlgili jel analiz yazılımı açın. kabine jellerin görüntü göstermek için menü çubuğunda &quot;görüntü elde etme lütfen&quot; tıklayın. Sonra, jeller (Şekil 2B) fotoğraf çekmek için menü çubuğunda &quot;acquire&quot; tıklayın. </li><li> Ölçüm bölgesini menü çubuğunda (Şekil 2C) &quot;algılama düğmesini&quot; tıklayın ve ayarlamak (sarı daire ifareyi sürükleyerek n Şekil 2C). Ardından, menü çubuğunda &quot;otomatik algılama düğmesi&quot; (Şekil 2B düğmesini bakınız). Yazılım otomatik olarak bir ısı haritası (Şekil 2B) gösteren jeller algılar. </li><li> Görüntü işleme ile jellerin taslağını çıkarmak ve anahat (Şekil 2E) ile çevrili alanlar hesaplamak için &quot;Tamam&quot; a tıklayın. Alan hesaplandıktan sonra, hesaplanan alan ayrı bir pop-up penceresi görüntülenir. Not: jeller görüntüleme sırasında birbirleriyle örtüşen, hafifçe steril bir pipet kullanarak jeller taşıyın. </li></ol></li></ol>

<ol><li>Wynn, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cellular+and+molecular+mechanisms+of+fibrosis%5BTitle%5D)+AND+%22The+Journal+of+pathology%22%5BJournal%5D)">Cellular and molecular mechanisms of fibrosis.</a> The Journal of pathology. 214, 199-214 (2008).</li>
<li>Hardie, W. D., Glasser, S. W., Hagood, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Emerging+concepts+in+the+pathogenesis+of+lung+fibrosis%5BTitle%5D)+AND+%22The+American+journal+of+pathology%22%5BJournal%5D)">Emerging concepts in the pathogenesis of lung fibrosis.</a> The American journal of pathology. 175, 3-16 (2009).</li>
<li>Kovacic, J. C., Mercader, N., Torres, M., Boehm, M., Fuster, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Epithelial-to-mesenchymal+and+endothelial-to-mesenchymal+transition%3A+from+cardiovascular+development+to+disease%5BTitle%5D)+AND+%22Circulation%22%5BJournal%5D)">Epithelial-to-mesenchymal and endothelial-to-mesenchymal transition: from cardiovascular development to disease.</a> Circulation. 125, 1795-1808 (2012).</li>
<li>Thiery, J. P., Acloque, H., Huang, R. Y., Nieto, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Epithelial-mesenchymal+transitions+in+development+and+disease%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Epithelial-mesenchymal transitions in development and disease.</a> Cell. 139, 871-890 (2009).</li>
<li>Kalluri, R., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+basics+of+epithelial-mesenchymal+transition%5BTitle%5D)+AND+%22The+Journal+of+clinical+investigation%22%5BJournal%5D)">The basics of epithelial-mesenchymal transition.</a> The Journal of clinical investigation. 119, 1420-1428 (2009).</li>
<li>Forino, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((TGFbeta1+induces+epithelial-mesenchymal+transition%2C+but+not+myofibroblast+transdifferentiation+of+human+kidney+tubular+epithelial+cells+in+primary+culture%5BTitle%5D)+AND+%22International+journal+of+experimental+pathology%22%5BJournal%5D)">TGFbeta1 induces epithelial-mesenchymal transition, but not myofibroblast transdifferentiation of human kidney tubular epithelial cells in primary culture.</a> International journal of experimental pathology. 87, 197-208 (2006).</li>
<li>Yang, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Participation+of+miR-200+in+pulmonary+fibrosis%5BTitle%5D)+AND+%22The+American+journal+of+pathology%22%5BJournal%5D)">Participation of miR-200 in pulmonary fibrosis.</a> The American journal of pathology. 180, 484-493 (2012).</li>
<li>Reynolds, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Lung+inflammation+and+fibrosis%3A+an+alveolar+macrophage-centered+perspective+from+the+1970s+to+1980s%5BTitle%5D)+AND+%22American+journal+of+respiratory+and+critical+care+medicine%22%5BJournal%5D)">Lung inflammation and fibrosis: an alveolar macrophage-centered perspective from the 1970s to 1980s.</a> American journal of respiratory and critical care medicine. 171, 98-102 (2005).</li>
<li>Camara, J., Jarai, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Epithelial-mesenchymal+transition+in+primary+human+bronchial+epithelial+cells+is+Smad-dependent+and+enhanced+by+fibronectin+and+TNF-alpha%5BTitle%5D)+AND+%22Fibrogenesis+%26+tissue+repair%22%5BJournal%5D)">Epithelial-mesenchymal transition in primary human bronchial epithelial cells is Smad-dependent and enhanced by fibronectin and TNF-alpha.</a> Fibrogenesis & tissue repair. 3, 2(2010).</li>
<li>Kamitani, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Simultaneous+stimulation+with+TGF-beta1+and+TNF-alpha+induces+epithelial+mesenchymal+transition+in+bronchial+epithelial+cells%5BTitle%5D)+AND+%22International+archives+of+allergy+and+immunology%22%5BJournal%5D)">Simultaneous stimulation with TGF-beta1 and TNF-alpha induces epithelial mesenchymal transition in bronchial epithelial cells.</a> International archives of allergy and immunology. 155, 119-128 (2011).</li>
<li>Mikami, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Lymphotoxin+beta+receptor+signaling+induces+IL-8+production+in+human+bronchial+epithelial+cells%5BTitle%5D)+AND+%22PloS+one%22%5BJournal%5D)">Lymphotoxin beta receptor signaling induces IL-8 production in human bronchial epithelial cells.</a> PloS one. 9, e114791(2014).</li>
<li>Yamauchi, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Tumor+necrosis+factor-alpha+enhances+both+epithelial-mesenchymal+transition+and+cell+contraction+induced+in+A549+human+alveolar+epithelial+cells+by+transforming+growth+factor-beta1%5BTitle%5D)+AND+%22Experimental+lung+research%22%5BJournal%5D)">Tumor necrosis factor-alpha enhances both epithelial-mesenchymal transition and cell contraction induced in A549 human alveolar epithelial cells by transforming growth factor-beta1.</a> Experimental lung research. 36, 12-24 (2010).</li>
<li>Grinnell, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Fibroblasts%2C+myofibroblasts%2C+and+wound+contraction%5BTitle%5D)+AND+%22The+Journal+of+cell+biology%22%5BJournal%5D)">Fibroblasts, myofibroblasts, and wound contraction.</a> The Journal of cell biology. 124, 401-404 (1994).</li>
<li>Ramos, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((FGF-1+reverts+epithelial-mesenchymal+transition+induced+by+TGF-%7Bbeta%7D1+through+MAPK%2FERK+kinase+pathway+%5BTitle%5D)+AND+%22American+journal+of+physiology.+Lung+cellular+and+molecular+physiology%22%5BJournal%5D)">FGF-1 reverts epithelial-mesenchymal transition induced by TGF-{beta}1 through MAPK/ERK kinase pathway .</a> American journal of physiology. Lung cellular and molecular physiology. 299, L222-L231 (2010).</li>
<li>Ren, Z. X., Yu, H. B., Li, J. S., Shen, J. L., Du, W. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Suitable+parameter+choice+on+quantitative+morphology+of+A549+cell+in+epithelial-mesenchymal+transition%5BTitle%5D)+AND+%22Bioscience+reports%22%5BJournal%5D)">Suitable parameter choice on quantitative morphology of A549 cell in epithelial-mesenchymal transition.</a> Bioscience reports. 35, (2015).</li>
<li>Brinkmann, V., Kinzel, B., Kristofic, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((TCR-independent+activation+of+human+CD4%2B+45RO-+T+cells+by+anti-CD28+plus+IL-2%3A+Induction+of+clonal+expansion+and+priming+for+a+Th2+phenotype%5BTitle%5D)+AND+%22Journal+of+immunology%22%5BJournal%5D)">TCR-independent activation of human CD4+ 45RO- T cells by anti-CD28 plus IL-2: Induction of clonal expansion and priming for a Th2 phenotype.</a> Journal of immunology. 156, 4100-4106 (1996).</li>
<li>Krug, M. S., Berger, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((First-strand+cDNA+synthesis+primed+with+oligo%28dT%29%5BTitle%5D)+AND+%22Methods+in+enzymology%22%5BJournal%5D)">First-strand cDNA synthesis primed with oligo(dT).</a> Methods in enzymology. 152, 316-325 (1987).</li>
<li>Morozumi, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Simultaneous+detection+of+pathogens+in+clinical+samples+from+patients+with+community-acquired+pneumonia+by+real-time+PCR+with+pathogen-specific+molecular+beacon+probes%5BTitle%5D)+AND+%22Journal+of+clinical+microbiology%22%5BJournal%5D)">Simultaneous detection of pathogens in clinical samples from patients with community-acquired pneumonia by real-time PCR with pathogen-specific molecular beacon probes.</a> Journal of clinical microbiology. 44, 1440-1446 (2006).</li>
<li>Smith, P. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Measurement+of+protein+using+bicinchoninic+acid%5BTitle%5D)+AND+%22Analytical+biochemistry%22%5BJournal%5D)">Measurement of protein using bicinchoninic acid.</a> Analytical biochemistry. 150, 76-85 (1985).</li>
<li>Wiechelman, K. J., Braun, R. D., Fitzpatrick, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Investigation+of+the+bicinchoninic+acid+protein+assay%3A+identification+of+the+groups+responsible+for+color+formation%5BTitle%5D)+AND+%22Analytical+biochemistry%22%5BJournal%5D)">Investigation of the bicinchoninic acid protein assay: identification of the groups responsible for color formation.</a> Analytical biochemistry. 175, 231-237 (1988).</li>
<li>Ursitti, J. A., Mozdzanowski, J., Speicher, D. W., et al. Electroblotting from polyacrylamide gels. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aUrsitti%2C+JA+%22Current+protocols+in+protein+science%22">Current protocols in protein science</a>. Chapter 10, Unit 10.7(2001).</li>
<li>Kricka, L. J., Voyta, J. C., Bronstein, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Chemiluminescent+methods+for+detecting+and+quantitating+enzyme+activity%5BTitle%5D)+AND+%22Methods+in+enzymology%22%5BJournal%5D)">Chemiluminescent methods for detecting and quantitating enzyme activity.</a> Methods in enzymology. 305, 370-390 (2000).</li>
<li>Noguchi, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((An+integrative+analysis+of+the+tumorigenic+role+of+TAZ+in+human+non-small+cell+lung+cancer%5BTitle%5D)+AND+%22Clinical+cancer+research+%3A+an+official+journal+of+the+American+Association+for+Cancer+Research%22%5BJournal%5D)">An integrative analysis of the tumorigenic role of TAZ in human non-small cell lung cancer.</a> Clinical cancer research : an official journal of the American Association for Cancer Research. 20, 4660-4672 (2014).</li>
<li>Kasai, H., Allen, J. T., Mason, R. M., Kamimura, T., Zhang, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((TGF-beta1+induces+human+alveolar+epithelial+to+mesenchymal+cell+transition+%28EMT%29%5BTitle%5D)+AND+%22Respiratory+research%22%5BJournal%5D)">TGF-beta1 induces human alveolar epithelial to mesenchymal cell transition (EMT).</a> Respiratory research. 6, 56(2005).</li>
<li>Chen, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Integrin-mediated+type+II+TGF-beta+receptor+tyrosine+dephosphorylation+controls+SMAD-dependent+profibrotic+signaling%5BTitle%5D)+AND+%22The+Journal+of+clinical+investigation%22%5BJournal%5D)">Integrin-mediated type II TGF-beta receptor tyrosine dephosphorylation controls SMAD-dependent profibrotic signaling.</a> The Journal of clinical investigation. 124, 3295-3310 (2014).</li>
<li>Saito, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((An+integrated+expression+profiling+reveals+target+genes+of+TGF-beta+and+TNF-alpha+possibly+mediated+by+microRNAs+in+lung+cancer+cells%5BTitle%5D)+AND+%22PloS+one%22%5BJournal%5D)">An integrated expression profiling reveals target genes of TGF-beta and TNF-alpha possibly mediated by microRNAs in lung cancer cells.</a> PloS one. 8, e56587(2013).</li>
<li>Dvashi, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Protein+phosphatase+magnesium+dependent+1A+governs+the+wound+healing-inflammation-angiogenesis+cross+talk+on+injury%5BTitle%5D)+AND+%22The+American+journal+of+pathology%22%5BJournal%5D)">Protein phosphatase magnesium dependent 1A governs the wound healing-inflammation-angiogenesis cross talk on injury.</a> The American journal of pathology. 184, 2936-2950 (2014).</li>
<li>Hallgren, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Enhanced+ROCK1+dependent+contractility+in+fibroblast+from+chronic+obstructive+pulmonary+disease+patients%5BTitle%5D)+AND+%22Journal+of+translational+medicine%22%5BJournal%5D)">Enhanced ROCK1 dependent contractility in fibroblast from chronic obstructive pulmonary disease patients.</a> Journal of translational medicine. 10, 171(2012).</li>
<li>Kobayashi, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Matrix+metalloproteinase-9+activates+TGF-beta+and+stimulates+fibroblast+contraction+of+collagen+gels%5BTitle%5D)+AND+%22American+journal+of+physiology.+Lung+cellular+and+molecular+physiology%22%5BJournal%5D)">Matrix metalloproteinase-9 activates TGF-beta and stimulates fibroblast contraction of collagen gels.</a> American journal of physiology. Lung cellular and molecular physiology. 306, L1006-L1015 (2014).</li>
<li>Horie, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Histamine+induces+human+lung+fibroblast-mediated+collagen+gel+contraction+via+histamine+H1+receptor%5BTitle%5D)+AND+%22Experimental+lung+research%22%5BJournal%5D)">Histamine induces human lung fibroblast-mediated collagen gel contraction via histamine H1 receptor.</a> Experimental lung research. 40, 222-236 (2014).</li>
<li>Kohyama, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((PGD%282%29+modulates+fibroblast-mediated+native+collagen+gel+contraction%5BTitle%5D)+AND+%22American+journal+of+respiratory+cell+and+molecular+biology%22%5BJournal%5D)">PGD(2) modulates fibroblast-mediated native collagen gel contraction.</a> American journal of respiratory cell and molecular biology. 27, 375-381 (2002).</li>
<li>Muir, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Esophageal+epithelial+cells+acquire+functional+characteristics+of+activated+myofibroblasts+after+undergoing+an+epithelial+to+mesenchymal+transition%5BTitle%5D)+AND+%22Experimental+cell+research%22%5BJournal%5D)">Esophageal epithelial cells acquire functional characteristics of activated myofibroblasts after undergoing an epithelial to mesenchymal transition.</a> Experimental cell research. 330, 102-110 (2015).</li>
<li>Zhong, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Role+of+endoplasmic+reticulum+stress+in+epithelial-mesenchymal+transition+of+alveolar+epithelial+cells%3A+effects+of+misfolded+surfactant+protein%5BTitle%5D)+AND+%22American+journal+of+respiratory+cell+and+molecular+biology%22%5BJournal%5D)">Role of endoplasmic reticulum stress in epithelial-mesenchymal transition of alveolar epithelial cells: effects of misfolded surfactant protein.</a> American journal of respiratory cell and molecular biology. 45, 498-509 (2011).</li>
<li>Liu, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Inflammatory+cytokines+augments+TGF-beta1-induced+epithelial-mesenchymal+transition+in+A549+cells+by+up-regulating+TbetaR-I%5BTitle%5D)+AND+%22Cell+motility+and+the+cytoskeleton%22%5BJournal%5D)">Inflammatory cytokines augments TGF-beta1-induced epithelial-mesenchymal transition in A549 cells by up-regulating TbetaR-I.</a> Cell motility and the cytoskeleton. 65, 935-944 (2008).</li>
</ol>

Yazarlar ifşa etmek herhangi bir çıkar çatışmaları var.

Bu çalışmada geliştirilen protokol iki adımları içerir. İlk adım, ikinci bir basamaklı bir jel tahlili daralma ise, EMT indüklemek için gerçekleştirilir. hücrelerin EMT uygulanan onaylamak için önemli olduğundan, adım 2 morfolojik ve gen ekspresyon değişiklikleri için mükemmel bir tamamlayıcı sağlar. Daha önceki çalışmalar, A549 hücrelerinin EMT, TGF-ß1 sadece 24 tarafından indüklendiğini göstermiştir; Daha önce 10 rapor ettiği gibi, ancak, TNF-α tedavisi EMT ve mezenkimal hücre belirteçleri kazanılması artırır. TGF-β-aracılı EMT mekanizmaları Smad bağımlı 25 olduğu düşünülmektedir. TNFa jel daralma arttırılmasına neden TGF-β1 kaynaklı EMT arttırır. TGF-β1 kaynaklı EMT arttırılması için TNFa mekanizmaları Smad2 bağlayıcı bölgenin tek fosforilasyonu olmadığı rapor edilmiştir, ama aynı zamanda düzenleme 26 MAPK sinyal. Bu nedenle, bu çalışmada geliştirilen protokol stimülasyon dahilTGF-ß1 ve TNF-a hem tirme. I kolajen jel türü içine EMT uygulandı ve ortam üzerinde yüzen hücrelerin gömme, bu deneyde (aşama 4) merkez yönleri vardır. jeller, yumuşak ve kolayca zarar ve her iki tarafta farklı boyutlara sahip olduğundan orta jelleri uygulanması ve bunların boyutlarını ölçerken, son derece dikkatli gereklidir. Bu adımı yürütmek zor ise, 60 mm çanak 27,28 içine jeller hareket ettirmeden de jel boyutlarını ölçmek için alternatif bir yöntem yoktur. Birkaç ortak sorunlar vardır, ilk sorun adımı 4.7&#39;de belirtildiği gibi jeller genellikle deforme böylece kolajen jeller kolayca oda sıcaklığında gelate olmasıdır. Bu nedenle, plaka nazikçe onlar düzgün silindirik formda almak emin olmak için kuyu içine jeller attıktan sonra çalkalanmalıdır. İkinci sorun herhangi bir hava kabarcıkları jelleşme sırasında jeller girerseniz, o zaman jellerin boyutu düzensiz olmasıdır. Herhangi bir hava Bubbl izin dikkatli olunes jelleri kirletmesine. Orijinal yöntem ve bu yöntemin arasındaki iki temel farklılıklar vardır. Orijinal yöntemin kolajen jellerin nihai konsantrasyon ml 0.75 mg / ancak bu yöntemin 1.75 mg / jeller orijinal yöntemle göre daha fazla büzülmesini sağlar amacıyla mi olduğunu ilk farklılıklardır. İkinci bir fark, orijinal bir yöntem jel kayan ortam serum içermeyen ortam kullanan, ancak bu yöntem, hücre daralmasını, hücre canlılığını korumak ve sürdürmek için jel yüzen ortam içinde% 1 FBS kullanır. Orjinal olarak, fibroblastlar için geliştirilmiş jel daralma deney yara iyileşmesi ve fibrozis 13 sürecine katkıda bulunan hücrelerin kasılma değerlendirilmesi için in vitro model bir idealdir. 1 kollajen tip fibroblast bağlanma Sonuç olarak kollajen jel boyutunda bir azalmaya yol açar, mekanik gerilimleri üretilmesi için gerekiyordu. Buna ek olarak, bu deney en son kullanılmışbronşiyal astım ve KOAH 29-31 dahil olmak üzere inflamatuar hastalıklar, hava yolu hücrelerinin kasılma çalışmak için in vitro bir model olarak. belirli cihazlar gerektirir ve yüksek sayısal sergileyen ve yok jel daralma tahlili, hücre göçü deneyleri gibi deneylerde, karşılaştırılabilir. Ancak, EMT 32 değerlendirmek için jel daralma tahlil uygulayarak az sayıda rapor vardır. Bu çalışmada, EMT uygulanan hücre içeren jeller önemli ölçüde hücre daralma gösteren jelleşme 72 saat sonra için 24 ila küçültülür. Bu yöntemin sınırlamalar ancak vardır. ilk olarak bu tahlilde, jeller boyutunu değiştirmek jeller tüm hücrelerin kasılma toplamını göstermektedir olmasıdır. Bununla birlikte, bu deneyde kullanılan jeller tek hücre kasılma değerlendirilmesi güçtür. İkinci A549 hücreleri, bir kanser hücresi hattı değil, normal insan epitelyal hücreler olmasıdır. Nedenle, O uyarlamak çok zordurdoğrudan pulmoner fibrozis patogenezinde ur sonuçları. Bununla birlikte, A549 hücreleri, yaygın olarak hava yolu epitel hücrelerin fonksiyonlarını incelemek için kullanılır ve çeşitli çalışmalar pulmoner fibroz 33,34 bir model olarak, A549 hücreleri kullanılarak EMT kanıtlarını vermiştir. Özet olarak, Tip I EMT bu hücrelerin kasılma gösterir boyutu azalmıştır uygulanan mezenkimal hücreler ihtiva eden jeller hücre oranında yerleştirilmiştir. Sonuç olarak, jelleşme daralma deney EMT sürecinde hücrelerde kontraktil fonksiyonun satın değerlendirmek için in vitro olarak genişletilmiş deneyi olarak kabul edilmelidir.

Fibroz, interstisyel akciğer hastalığı, kardiyak fibroz, karaciğer sirozu, böbrek yetmezliği, terminal, sistemik skleroz, otoimmün hastalık 1 gibi çeşitli kronik progresif hastalıkların patogenezinde rol oynamaktadır. interstisyel akciğer hastalıkları arasında, idiyopatik pulmoner fibrozis (IPF) kronik ilerleyici bir hastalıktır ve kötü prognozu gösterir. IPF patolojik bulgusudur prognoz ile ilişkili olduğu aktive fibroblast ve miyofibroblastlar oluşan fibroblastik odaklar geliştirilmesidir. Bu tür akciğer fibroblast kökenleri aslen ikamet akciğer fibroblastlar dahil olmak üzere ve kemik iliği fibrositlerden dolaşan birkaç mezenkimal hücrelerden, elde edilecek önerilmektedir. Son zamanlarda, epitelyal mezenkimal geçişi (EMT) mezenkimal hücreler 2 oluşumu ile ilişkili olduğu öne sürülmüştür ve fibrotik hastalıkların patogenezine katkıda bulunmak. Bu düşünülmektedir EMT tümör invazyonu ve metastaz 3 olmak üzere fetal gelişim sürecinde önemli roller, yara iyileşmesi ve kanserin ilerlemesini, oynar. EMT süreci takiben, epitel hücreler, E-kadherin gibi epitelyal belirteçleri kaybıyla mezenkimal hücrelerin yeteneği elde etmek ve örneğin vimentin gibi mezenşimal belirteçleri ve α-düz kas aktini (SMA) 4,5 ekspresyonuyla. Önceki çalışmalar EMT süreç böbrek 6 ve akciğer 7 doku fibrozis gelişimi ile ilişkili olduğunu kanıt gösterdi. Ayrıca, kronik inflamasyon fibrotik hastalığı 8 teşvik; Bundan başka, tümör nekroz faktörü üst aile üyesini 14 (TNFSF14; LIGHT) gibi enflamatuar sitokinler, tümör nekroz faktörü (TNF) -a ve interlökin-1, EMT 9-12 geliştirmek için gösterilmiştir. Kollajen jel daralma tahlili, fibroblastlar tip I gömülü olduğu bir kollajen bazlı hücre kasılması deneyikolajen jeli üç boyutlu, kontraktilite değerlendirilmesi için in vitro model bir idealdir. Kontraktilite fibroblast karakteristik işlevlerinden biridir ve normal yara onarımı ve fibrozis 13 katkıda bulunur. Bu deneyde, fibroblast ek bazı koşullar altında, mekanik gerilim üretilmesi için gereken I integrin bağlantılı mekanizmalar vasıtasıyla kolajen tip, ve bunun sonucu olarak doku daralmaya yol düşünülmektedir. Burada, jel daralma deneyinin geliştirilmesi EMT yapılan hücrelerde kontraktil fonksiyonun satın değerlendirmek üzere uyarlanmış olduğu bildirilmektedir. Bu raporda, bu modifiye edilmiş deney EMT uygulanan mezenkimal hücreler kontraktiliteııin değerlendirilmesi için uygun olduğunu göstermektedir.

<table><tbody><tr><td>DMEM</td><td>sigma aldrich</td><td>11965-092</td><td>For A549 medium</td></tr><tr><td>FBS</td><td>GIBCO</td><td>10437</td><td></td></tr><tr><td>Transforming Growth Factor-&amp;beta;1, Human, recombinant</td><td>Wako Laboratory chemicals</td><td>209-16544</td><td></td></tr><tr><td>Recombinant Human TNF-&amp;alpha;</td><td>R&amp;amp;D systems</td><td>210-TA/CF</td><td></td></tr><tr><td>E-Cadherin (24E10) Rabbit mAb</td><td>Cell Signaling Technology</td><td>#3195</td><td>1:3,000 dilution</td></tr><tr><td>Vimentin (D21H3) Rabbit mAb</td><td>Cell Signaling Technology</td><td>#5741</td><td>1:3,000 dilution</td></tr><tr><td>Anti-&amp;alpha;-Tubulin antibody</td><td>sigma aldrich</td><td>T9026</td><td>1:10,000 dilution</td></tr><tr><td>Monoclonal Anti-Actin, &amp;alpha;-Smooth Muscle antibody&amp;nbsp;</td><td>sigma aldrich</td><td>A5228</td><td>1:10,000 dilution</td></tr><tr><td>Anti-N-cadherin antibody</td><td>BD Transduction Laboratories</td><td>#610920</td><td>1:1,000 dilution</td></tr><tr><td>Anti-Mouse IgG, HRP-Linked Whole Ab Sheep (secondary antibody)</td><td>GE Healthcare</td><td>NA931-100UL</td><td>1:20,000 dilution</td></tr><tr><td>Anti-Rabbit IgG, HRP-Linked Whole Ab Donkey (secondary antibody)</td><td>GE Healthcare</td><td>NA934-100UL</td><td>1:20,000 dilution</td></tr><tr><td>Blocking reagent</td><td>GE Healthcare</td><td>RPN418</td><td>2% in TBS-T</td></tr><tr><td>6 Well Clear Flat Bottom TC-Treated Multiwell Cell Culture Plate, with Lid</td><td>corning</td><td>#353046</td><td></td></tr><tr><td>100 mm Cell culture dish</td><td>TPP</td><td>#93100</td><td></td></tr><tr><td>DMEM, powder</td><td>life technologies</td><td>12100-046</td><td>For 4&amp;times; DMEM</td></tr><tr><td>Type 1 collagen gel</td><td>Nitta gelatin</td><td>Cellmatrix type I-A</td><td></td></tr><tr><td>24 Well cell culture plate</td><td>AGC TECHNO GLASS</td><td>1820-024</td><td></td></tr><tr><td>Gel Documentation System&amp;nbsp;</td><td>ATTO</td><td>AE-6911FXN</td><td>Gel imager</td></tr><tr><td>Gel analyzing software</td><td>ATTO</td><td>Densitograph, ver. 3.00</td><td>analysing software bundled with AE-6911FXN</td></tr><tr><td>Trypsin-EDTA (0.05%), phenol red</td><td>life technologies</td><td>25300054</td><td></td></tr><tr><td>24 Well Plates, Non-Treated</td><td>IWAKI</td><td>1820-024</td><td></td></tr><tr><td>Trypan Blue Solution, 0.4%</td><td>life technologies</td><td>15250-061</td><td></td></tr><tr><td>RNA extraction kit</td><td>Qiagen</td><td>74106</td><td></td></tr><tr><td>Reverse transcriptase</td><td>life technologies</td><td>18080044</td><td></td></tr><tr><td>Real time PCR system</td><td>Stratagene</td><td>Mx-3000P</td><td></td></tr><tr><td>SYBR green PCR kit</td><td>Qiagen</td><td>204145</td><td></td></tr><tr><td>Protease Inhibitor Cocktail (100x)</td><td>life technologies</td><td>78429</td><td></td></tr><tr><td>PVDF membrane</td><td>ATTO</td><td>2392390</td><td></td></tr><tr><td>Protein assay kit</td><td>bio-rad</td><td>5000006JA&amp;nbsp;</td><td></td></tr><tr><td>Polyacrylamide gel</td><td>ATTO</td><td>2331810</td><td></td></tr><tr><td>Western blotting detection reagent</td><td>GE Healthcare</td><td>RPN2232</td><td></td></tr><tr><td>Cold CCD camera</td><td>ATTO</td><td>Ez-Capture MG/ST</td><td></td></tr><tr><td>Trypsin inhibitor</td><td>sigma aldrich</td><td>T9003-100MG</td><td></td></tr><tr><td>Polyoxyethylene (20)Sorbitan Monolaurate</td><td>Wako Laboratory chemicals</td><td>163-11512</td><td></td></tr><tr><td>Polyoxyethylene (9) octyiphenyl ether</td><td>Wako Laboratory chemicals</td><td>141-08321</td><td></td></tr></tbody></table>

development of an in vitro assay to evaluate contractile function of mesenchymal cells that underwent epithelial-mesenchymal transition

Fibrosis is often involved in the pathogenesis of various chronic progressive diseases such as interstitial pulmonary disease. Pathological hallmark is the formation of fibroblastic foci, which is associated with the disease severity. Mesenchymal cells consisting of the fibroblastic foci are proposed to be derived from several cell sources, including originally resident intrapulmonary fibroblasts and circulating fibrocytes from bone marrow. Recently, mesenchymal cells that underwent epithelial-mesenchymal transition (EMT) have been also supposed to contribute to the pathogenesis of fibrosis. In addition, EMT can be induced by transforming growth factor &#946;, and EMT can be enhanced by pro-inflammatory cytokines like tumor necrosis factor &#945;. The gel contraction assay is an ideal in vitro model for the evaluation of contractility, which is one of the characteristic functions of fibroblasts and contributes to wound repair and fibrosis. Here, the development of a gel contraction assay is demonstrated for evaluating contractile ability of mesenchymal cells that underwent EMT.

EMT sırasında, epitel hücreleri E-kaderin gibi epitel belirteçleri, kaybetmek ve bu vimentin ve α-düz kas 4,5 aktin olarak mezenkimal belirteçler, ifadesini kazanır. TGF-ß1 ve TNF-a ile A549 insan akciğer epitel hücrelerine inkübasyonu EMT indükler. Normal A549 hücrelerinin görünümü epitel hücreleri (Şekil 3A) bir özelliğidir şekil ve üçgen şekli gibi çakıl taşı, ancak, TGF-ß1 ve TNF-a ile uyarılmış sonra görünümü mezenşimal benzer uzun bir mil bir biçime hücreleri (Şekil 3B). epitelyal ve mezenkimal belirteçlerinin ifade hücreleri EMT uygulanan onaylamak için değerlendirilmiştir. Bağıl mRNA ekspresyon ΔΔCt yöntemi ile hesaplanmıştır. Bireysel veri oda temizliği g gliseraldehid-3-fosfat dehidrojenaz (GAPDH) karşı normalize edildien. TGF-ß1 ve 48 saat süre ile, TNF-a ile tedavi edilen A549 hücreleri önemli ölçüde CDH1 ekspresyonunu azaltmış ve önemli ölçüde VIM ve ACTA2 (Şekil 4A) ekspresyonunu artmıştır. Q-PCR için kullanılan primerler, sekansları Tablo 1 &#39;de gösterilmiştir. Vimentin, N-kadherin ve α-düz kas aktini sentezlenmesi ise, Şekil 4B&#39;de, TGF-ß1 ve TNF-α zayıflatılmış E-kadherin ekspresyonu ile uyarılmasında gösterildiği gibi oluşturuldu. Jel daralma tahlil EMT uygulanan hücrelerin kasılma değerlendirmek amacıyla yapılmıştır. TGF-ß1 ve TNF-a ile uyarılması EMT sonra, hücreler kolajen jel içine dökülmüştür ve TGF-ß1 ve TNF-a ya da PBS içeren ortamda 72 saat için kuluçkalanmıştır. Şekil 5A&#39;da gösterildiği gibi, TGF-ß1 ve TNF-a ile tedavi edilen hücreleri ihtiva eden j eller, PBS ile muamele edilmiş hücreleri ihtiva eden kontrol jeller daha düşüktü. Adugit içinJel boyutunda değişiklik ntify, jeller, bir jel analizörü, 0, 24, 48, ve tedaviden 72 saat kullanılarak analiz edilmiştir. 72 saat sonra, TGF-ß1 ve TNF-a ile tedavi edilen hücreler ihtiva eden jellerin boyutları önemli ölçüde kontrol jeller (Şekil 5B) ile karşılaştırıldığında azaltılmıştır. Ayrıca TGF-ß1 ile muamele hücreleri ihtiva eden j eller, tek başına kontrol jeller daha küçük ama (veriler gösterilmemiştir), TGF-ß1 ve TNF-a ile tedavi edilen jeller daha küçük olmayan olduğunu gösterdi. <img alt="Şekil 1" src="/files/ftp_upload/53974/53974fig1.jpg" /> Şekil 1. Jeller yapmak için Ek Şekil. Bu görüntüler kuyulara dökme jeller göstermektedir. hücreleri içeren jel orta viskoz ve kolayca jel ve kuyu form hilal şekli olabilir. (A) sol görüntü jeller doğru döküm olduğunu gösterir ve sağ görüntü &quot;temiz silindirik formda&quot; şemasını göstermektedir. (B &lt;/ Strong&gt;) sol görüntü jeller deforme olduğunu gösterir ve sağ görüntü hava kabarcıkları jeller kontamine olduğunu göstermektedir. (C) jeller, kolayca zarar yumuşak ve genellikle &quot;Pac-Man&quot; gibi deforme. <a href="https://www.jove.com/files/ftp_upload/53974/53974fig1large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img alt="şekil 2" src="/files/ftp_upload/53974/53974fig2.jpg" /> Jel Boyutu Ölçüm Şekil 2. Adımlar. (A) jel dokümantasyon sistemi PC ve bir jel görüntüleme sistemi oluşur. (B) &quot;görüntü elde etme düğmesi&quot;, ve jellerin bir resim. (C) &quot;algılama düğmesi&quot;, ve ölçüm bölgeyi (sarı daire) ayarlamak için bir pencere. (D) &quot;otomatik algılama düğmesi&quot;, ve yazılım de bir resimden jeller bir ısı haritası yapar<html> jellerin anahat cuğunuz. (E) yazılım görüntü işleme ile jellerin taslağını ayıklar ve anahat çevrili alanlar hesaplar. <a href="https://www.jove.com/files/ftp_upload/53974/53974fig2large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img alt="Şekil 3," src="/files/ftp_upload/53974/53974fig3.jpg" /> Şekil 3. EMT kaynaklı hücreler morfolojileri. A549 insan akciğer epitelyum / oyuk, 6 oyuklu plaka içinde 1.0 x 10 5 hücre yoğunluğunda kaplanmıştır ve veya 5 ng / ml TGF-ß1 ve 10 ng / ml olmadan kuluçkalanmıştır faz kontras mikroskopik görüntülemesi, ardından 48 saat boyunca, TNF-α. (A) ve (B) × 200 altında elde edilen görüntülerdir. Ölçeği (A) bar ve (B), 100 um.<html> t = &quot;_ blank&quot;&gt; bu rakamın daha büyük bir versiyonunu görmek için lütfen buraya tıklayınız. <img alt="Şekil 4," src="/files/ftp_upload/53974/53974fig4.jpg" /> Şekil 4. TGF-ß1 ve TNF-a ile EMT uyarılması. (A) EMT işaretleyici ifade (CDH1, VIM ve ACTA2) ve QRT-PCR analizi. (B) E-kaderin, N-kaderin, vimentin ekspresyonunu gösteren bir Western blot ve ya da TGF-ß1 ve TNF-a olmayan uyarılmış A549 hücrelerinde protein aktin düz kas a. α-tübülin iç kontrol olarak kullanıldı. A549 hücreleri, Şekil 1, N = 3 bağımsız deneyde olduğu gibi kültürlenmiştir. ** P &lt;0.01; Hata çubukları SEM temsil etmektedir. <a href="https://www.jove.com/files/ftp_upload/53974/53974fig4large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> iles / ftp_upload / 53974 / 53974fig5.jpg &quot;/&gt; 5. Hücre Gören EMT Edinilen Kasılma Şekil. A549 hücreleri, 10 sm&#39;lik çanaklar içinde 1.0 x 10 6 hücre / tabak yoğunluğunda plakalandı ve veya 5 ng / ml TGF-ß1 ve 48 saat boyunca 10 ng / ml TNF-a yokken kuluçkaya yatırılır. Hücreler daha sonra 24 oyuklu bir plaka içerisinde / oyuk 3.0 x 10 5 hücre yoğunluğunda 1.75 mg / ml kolajen jel içeren bir maddenin 500 ul içine dökülmüştür. Jel oluşumunun ardından, ya da 5 ng / ml TGF-ß1 ve 60 mm lik tabaklar içinde 10 ng / ml TNF-a olmayan ortam ilave edildi ve görüntüleme (A), ardından 72 saat süre ile inkübe edildi. Jel boyutları, bir görüntü analiz sistemi kullanılarak, 0, 24, 48, ve 72 saat sonra ölçüldü. N = 9 bağımsız deneyler (B). ** P &lt;0.01; Hata çubukları SEM temsil etmektedir. <a href="https://www.jove.com/files/ftp_upload/53974/53974fig5large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <table border="1" fo:keep-together.within-page = &quot;1&quot; fo: keep-ile-next.within sayfa = &quot;always&quot;&gt; <tbody><tr><td> gen Adı </td><td colspan="2"> İleri 5 &#39;→ 3&#39; </td><td colspan="2"> 5 &#39;→ 3&#39; ters </td></tr><tr><td> ACTA2 </td><td colspan="2"> GCACCCAGCACCATGAAGA </td><td colspan="2"> ACCGATCCAGACAGAGTATTT </td></tr><tr><td> GAPDH </td><td colspan="2"> GGTGAAGGTCGGAGTCAACGGA </td><td colspan="2"> GAGGGATCTCGCTCCTGGAAGA </td></tr><tr><td> VIM </td><td colspan="2"> GACAATGCGTCTCTGGCACGTCTT </td><td colspan="2"> TTCTTCTGCCTCCTGCAGGTTCTT </td></tr><tr><td> CDH1 </td><td colspan="2"> CCCATCAGCTGCCCAGAAAATGAA </td><td colspan="2"> CTGTCACCTTCAGCCATCCTGTTT </td></tr></tbody></table> Tablo 1. astar dizilerini sıralamaktadır. QRT-PCR için kullanılan astar dizilerini sıralamaktadır. GAPDH iç kontrol olarak kullanıldı. <table border="1" fo:keep-together.within-page = &quot;1&quot; fo: keep-ile-next.within sayfa = &quot;always&quot;&gt; <tbody><tr><td> Liziz Tamponu: RIPA tamponu </td><td></td></tr><tr><td> 20 mM Tris-HCI pH 7.5 </td><td></td></tr><tr><td> 150 mM NaCI </td><td></td></tr><tr><td> 1 mM EDTA </td><td></td></tr><tr><td> % 1 polioksietilen (9) octyiphenyl eter </td><td></td></tr><tr><td> % 0.1 Na-deoksikolat </td><td></td></tr><tr><td> % 0.1 SDS </td><td></td></tr><tr><td> Bloklama Tamponu </td><td></td></tr><tr><td> Yıkama tamponu içinde% 1 bloke edici ayıracı </td><td></td></tr><tr><td> Yıkama tamponu: TBST Tamponu </td><td></td></tr><tr><td> NaCI </td><td> 45 g </td></tr><tr><td> 1 M Tris pH 7.4 </td><td> 50 mi </td></tr><tr><td> Polioksietilen (20) sorbitan monolaurat </td><td> 2.5 mi </td></tr><tr><td> distile su </td><td> 5 L ekle </td></tr><tr><td&gt; Toplam </td><td> 5 L&#39;lik </td></tr></tbody></table> Tablo 2. Kullanılan Tamponlar Bileşenleri. Lizis bileşenleri, engelleme tampon ve yıkama tamponu.

Watch this Scientific Journal Video about Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition at JoVE.com

Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition

Here, we describe the development and application of a gel contraction assay for evaluating contractile function in mesenchymal cells that underwent epithelial-mesenchymal transition.

Bir Gelişimi<em&gt; İn Vitro</em&gt; Deney Mezenkimal Hücreleri Uyguladığımız Epitel-Mezenkimal Geçiş kasılma Fonksiyonu değerlendirin

Fibrosis is often involved in the pathogenesis of various chronic progressive diseases such as interstitial pulmonary disease. Pathological hallmark is ...

development-an-vitro-assay-to-evaluate-contractile-function

Nanyang Technological University

Research

JoVE Journal

Developmental Biology

Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition

12.2K Görüntüleme.  The University of Tokyo Hospital. Here, we describe the development and application of a gel contraction assay for evaluating contractile function in mesenchymal cells that underwent epithelial-mesenchymal transition.

Video: Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition

Epicardial Outgrowth Culture Assay and Ex Vivo Assessment of Epicardial-derived Cell Migration

A single layer of epicardial cells lines the heart, providing paracrine factors that stimulate cardiomyocyte proliferation and directly contributing cardiovascular progenitors during development and disease. While a number of factors have been implicated in epicardium-derived cell (EPDC) mobilization, the mechanisms governing their subsequent migration and differentiation are poorly understood. Here, we present in vitro and ex vivo strategies to study EPDC motility and differentiation. First, we describe a method of obtaining primary epicardial cells by outgrowth culture from the embryonic mouse heart. We also introduce a detailed protocol to assess three-dimensional migration of labeled EPDC in an organ culture system. We provide evidence using these techniques that genetic deletion of myocardin-related transcription factors in the epicardium attenuates EPDC migration. This approach serves as a platform to evaluate candidate modifiers of EPDC biology and could be used to develop genetic or chemical screens to identify novel regulators of EPDC mobilization that might be useful for cardiac repair.

Epicardial Outgrowth Culture Assay and Ex Vivo Assessment of Epicardial-derived Cell Migration

Here, we describe methods for isolating primary mouse epicardial cells by an outgrowth culture assay and assessing the functional migration of epicardial-derived cells (EPDC) using an ex vivo heart culture system. These protocols are suitable for identifying genetic and chemical modulators of epicardial epithelial-to-mesenchymal transition (EMT) and motility.

Epikardiyal dışsal gelişimi Kültürü Deneyi ve<em&gt; Ex Vivo</em&gt; Epikardiyal türetilmiş Hücre Göç Değerlendirilmesi

A single layer of epicardial cells lines the heart, providing paracrine factors that stimulate cardiomyocyte proliferation and directly contributing ...

Gelişim Biyolojisi

An Enzyme- and Serum-free Neural Stem Cell Culture Model for EMT Investigation Suited for Drug Discovery

Epithelial to mesenchymal transition (EMT) describes the process of epithelium transdifferentiating into mesenchyme. EMT is a fundamental process during embryonic development that also commonly occurs in glioblastoma, the most frequent malignant brain tumor. EMT has also been observed in multiple carcinomas outside the brain including breast cancer, lung cancer, colon cancer, gastric cancer. EMT is centrally linked to malignancy by promoting migration, invasion and metastasis formation. The mechanisms of EMT induction are not fully understood. Here we describe an in vitro system for standardized isolation of cortical neural stem cells (NSCs) and subsequent EMT-induction. This system provides the flexibility to use either single cells or explant culture. In this system, rat or mouse embryonic forebrain NSCs are cultured in a defined medium, devoid of serum and enzymes. The NSCs expressed Olig2 and Sox10, two transcription factors observed in oligodendrocyte precursor cells (OPCs). Using this system, interactions between FGF-, BMP- and TGF&#946;-signaling involving Zeb1, Zeb2, and Twist2 were observed where TGF&#946;-activation significantly enhanced cell migration, suggesting a synergistic BMP-/TGF&#946;-interaction. The results point to a network of FGF-, BMP- and TGF&#946;-signaling to be involved in EMT induction and maintenance. This model system is relevant to investigate EMT in vitro. It is cost-efficient and shows high reproducibility. It also allows for the comparison of different compounds with respect to their migration responses (quantitative distance measurement), and high-throughput screening of compounds to inhibit or enhance EMT (qualitative measurement). The model is therefore well suited to test drug libraries for substances affecting EMT.

Epithelial to mesenchymal transition (EMT) allows cancers to become invasive. To investigate EMT, a neural stem cell (NSC)-based in vitro model devoid of serum and enzymes is described. This standardized system allows quantitative and qualitative assessment of cell migration, gene and protein expression. The model is suited for drug discovery.

Ilaç keşfi için uygundur EMT araştırma için enzim ve serum içermeyen nöral kök hücre kültürü modeli

Epithelial to mesenchymal transition (EMT) describes the process of epithelium transdifferentiating into mesenchyme. EMT is a fundamental process during ...

The Aortic Ring Co-culture Assay: A Convenient Tool to Assess the Angiogenic Potential of Mesenchymal Stromal Cells In Vitro

Angiogenesis is a complex, highly regulated process responsible for providing and maintaining adequate tissue perfusion. Insufficient vasculature maintenance and pathological malformations can result in severe ischemic diseases, while overly abundant vascular development is associated with cancer and inflammatory disorders. A promising form of pro-angiogenic therapy is the use of angiogenic cell sources, which can provide regulatory factors as well as physical support for newly developing vasculature.
Mesenchymal Stromal Cells (MSCs) are extensively investigated candidates for vascular regeneration due to their paracrine effects and their ability to detect and home to ischemic or inflamed tissues. In particular, first trimester human umbilical cord perivascular cells (FTM HUCPVCs) are a highly promising candidate due to their pericyte-like properties, high proliferative and multilineage potential, immune-privileged properties, and robust paracrine profile. To effectively evaluate potentially angiogenic regenerative cells, it is a requisite to test them in reliable and &#34;translatable&#34; pre-clinical assays. The aortic ring assay is an ex vivo angiogenesis model that allows for easy quantification of tubular endothelial structures, provides accessory supportive cells and extracellular matrix (ECM) from the host, excludes inflammatory components, and is fast and inexpensive to set up. This is advantageous when compared to in vivo models (e.g., corneal assay, Matrigel plug assay); the aortic ring assay can track the administered cells and observe intercellular interactions while avoiding xeno-immune rejection.
We present a protocol for a novel application of the aortic ring assay, which includes human MSCs in co-cultures with developing rat aortic endothelial networks. This assay allows for the analysis of the MSC contribution to tube formation and development through physical pericyte-like interactions and of their potency for actively migrating to sites of angiogenesis, and for evaluating their ability to perform and mediate ECM processing. This protocol provides further information on changes in MSC phenotype and gene expression following co-culture.

The Aortic Ring Co-culture Assay: A Convenient Tool to Assess the Angiogenic Potential of Mesenchymal Stromal Cells In Vitro

Here, we present a novel application of the aortic ring assay where prelabelled mesenchymal cells are co-cultured with rat aorta-derived endothelial networks. This novel method allows visualization of Mesenchymal Stromal Cells (MSCs) homing and integration with endothelial networks, quantification of network properties, and evaluation of MSC immunophenotypes and gene expression.

Aort yüzük ortak kültür tahlil: Mezenkimal Stromal hücre Vitro anjiogenik potansiyelini değerlendirmek için uygun bir araç

Angiogenesis is a complex, highly regulated process responsible for providing and maintaining adequate tissue perfusion. Insufficient vasculature ...

Utilization of Microscale Silicon Cantilevers to Assess Cellular Contractile Function In Vitro

The development of more predictive and biologically relevant in vitro assays is predicated on the advancement of versatile cell culture systems which facilitate the functional assessment of the seeded cells. To that end, microscale cantilever technology offers a platform with which to measure the contractile functionality of a range of cell types, including skeletal, cardiac, and smooth muscle cells, through assessment of contraction induced substrate bending. Application of multiplexed cantilever arrays provides the means to develop moderate to high-throughput protocols for assessing drug efficacy and toxicity, disease phenotype and progression, as well as neuromuscular and other cell-cell interactions. This manuscript provides the details for fabricating reliable cantilever arrays for this purpose, and the methods required to successfully culture cells on these surfaces. Further description is provided on the steps necessary to perform functional analysis of contractile cell types maintained on such arrays using a novel laser and photo-detector system. The representative data provided highlights the precision and reproducible nature of the analysis of contractile function possible using this system, as well as the wide range of studies to which such technology can be applied. Successful widespread adoption of this system could provide investigators with the means to perform rapid, low cost functional studies in vitro, leading to more accurate predictions of tissue performance, disease development and response to novel therapeutic treatment.

Utilization of Microscale Silicon Cantilevers to Assess Cellular Contractile Function In Vitro

This protocol describes the use of microscale silicon cantilevers as pliable culture surfaces for measuring the contractility of muscle cells in vitro. Cellular contraction causes cantilever bending, which can be measured, recorded, and converted into readouts of force, providing a non-invasive and scalable system for measuring contractile function in vitro.

Mikro Silikon konsolun Kullanımı Hücresel kasılma fonksiyonunu değerlendirmek için<em&gt; İn Vitro</em

The development of more predictive and biologically relevant in vitro assays is predicated on the advancement of versatile cell culture systems which ...

Biyomühendislik

High Throughput Traction Force Microscopy Using PDMS Reveals Dose-Dependent Effects of Transforming Growth Factor-&#946; on the Epithelial-to-Mesenchymal Transition

Cellular contractility is essential in diverse aspects of biology, driving processes that range from motility and division, to tissue contraction and mechanical stability, and represents a core element of multi-cellular animal life. In adherent cells, acto-myosin contraction is seen in traction forces that cells exert on their substrate. Dysregulation of cellular contractility appears in a myriad of pathologies, making contractility a promising target in diverse diagnostic approaches using biophysics as a metric. Moreover, novel therapeutic strategies can be based on correcting the apparent malfunction of cell contractility. These applications,&#160;however, require direct quantification of these forces.
We have developed silicone elastomer-based traction force microscopy (TFM) in a parallelized multi-well format. Our use of a silicone rubber, specifically polydimethylsiloxane (PDMS), rather than the commonly employed hydrogel polyacrylamide (PAA) enables us to make robust and inert substrates with indefinite shelf-lives requiring no specialized storage conditions. Unlike pillar-PDMS based approaches that have a modulus in the GPa range, the PDMS used here is very compliant, ranging from approximately 0.4 kPa to 100 kPa. We create a high-throughput platform for TFM by partitioning these large monolithic substrates spatially into biochemically independent wells, creating a multi-well platform for traction force screening that is compatible with existing multi-well systems.
In this manuscript, we use this multi-well traction force system to examine the Epithelial to Mesenchymal Transition (EMT); we induce EMT in NMuMG cells by exposing them to TGF-&#946;, and to quantify the biophysical changes during EMT. We measure the contractility as a function of concentration and duration of TGF-&#946; exposure. Our findings here demonstrate the utility of parallelized TFM in the context of disease biophysics.

We present a high throughput traction force assay fabricated with silicone rubber (PDMS). This novel assay is suitable for studying physical changes in cell contractility during various biological and biomedical processes and diseases. We demonstrate this method's utility by measuring a TGF-&#946; dependent increase in contractility during the epithelial-to-mesenchymal transition.

PDMS kullanarak yüksek verim çekiş kuvveti mikroskobu dönüşüm büyüme faktörü-β epitelyal-mezenkimal geçiş üzerinde doz bağımlı etkileri ortaya çıkarır

Cellular contractility is essential in diverse aspects of biology, driving processes that range from motility and division, to tissue contraction and ...

An Explant Assay for Assessing Cellular Behavior of the Cranial Mesenchyme

The central nervous system is derived from the neural plate that undergoes a series of complex morphogenetic movements resulting in formation of the neural tube in a process known as neurulation. During neurulation, morphogenesis of the mesenchyme that underlies the neural plate is believed to drive neural fold elevation. The cranial mesenchyme is comprised of the paraxial mesoderm and neural crest cells. The cells of the cranial mesenchyme form a pourous meshwork composed of stellate shaped cells and intermingling extracellular matrix (ECM) strands that support the neural folds. During neurulation, the cranial mesenchyme undergoes stereotypical rearrangements resulting in its expansion and these movements are believed to provide a driving force for neural fold elevation. However, the pathways and cellular behaviors that drive cranial mesenchyme morphogenesis remain poorly studied. Interactions between the ECM and the cells of the cranial mesenchyme underly these cell behaviors. Here we describe a simple ex vivo explant assay devised to characterize the behaviors of these cells. This assay is amendable to pharmacological manipulations to dissect the signaling pathways involved and live imaging analyses to further characterize the behavior of these cells. We present a representative experiment demonstrating the utility of this assay in characterizing the migratory properties of the cranial mesenchyme on a variety of ECM components.

The cranial mesenchyme undergoes dramatic morphogenic movements that likely provides a driving force for elevation of the neural folds1,2. Here we describe a simple ex vivo explant assay to characterize the cellular behaviors of the cranial mesenchyme during neurulation. This assay has numerous applications including being amenable to pharmacological manipulations and live imaging analyses.

Kranial mesenchyme Hücresel Davranış Değerlendirme için bir Eksplantasyon Assay

The central nervous system is derived from the neural plate that undergoes a series of complex morphogenetic movements resulting in formation of the ...

Biyoloji

Simplified, High-throughput Analysis of Single-cell Contractility using Micropatterned Elastomers

Cellular contractile force generation is a fundamental trait shared by virtually all cells. These contractile forces are crucial to proper development, function at both the cellular and tissue levels,and regulate the mechanical systems in the body. Numerous biological processes are force-dependent, including motility, adhesion, and division of single-cells, as well as contraction and relaxation of organs such as the heart, bladder, lungs, intestines, and uterus. Given its importance in maintaining proper physiological function, cellular contractility can also drive disease processes when exaggerated or disrupted. Asthma, hypertension, preterm labor, fibrotic scarring, and underactive bladder are all examples of mechanically driven disease processes that could potentially be alleviated with proper control of cellular contractile force. Here, we present a comprehensive protocol for utilizing a novel microplate-based contractility assay technology known as fluorescently labeled elastomeric contractible surfaces (FLECS), that provides simplified and intuitive analysis of single-cell contractility in a massively scaled manner. Herein, we provide a step-wise protocol for obtaining two six-point dose-response curves describing the effects of two contractile inhibitors on the contraction of primary human bladder smooth muscle cells in a simple procedure utilizing just a single FLECS assay microplate, to demonstrate proper technique to users of the method. Using FLECS Technology, all researchers with basic biological laboratories and fluorescent microscopy systems gain access to studying this fundamental but difficult-to-quantify functional cell phenotype, effectively lowering the entry barrier into the field of force biology and phenotypic screening of contractile cell force.

This work presents a flexible protocol for utilizing fluorescently labeled elastomeric contractible surfaces (FLECS) Technology in microwell format for simplified, hands-off quantification of single-cell contractile forces based on visualized displacements of fluorescent protein micropatterns.

Mikrodesenli Elastomerler Kullanarak Tek Hücreli Kasılmanın Basitleştirilmiş, Yüksek Verimli Analizi

Cellular contractile force generation is a fundamental trait shared by virtually all cells. These contractile forces are crucial to proper development, ...

Induction and Analysis of Epithelial to Mesenchymal Transition

Epithelial to mesenchymal transition (EMT) is essential for proper morphogenesis during development. Misregulation of this process has been implicated as a key event in fibrosis and the progression of carcinomas to a metastatic state. Understanding the processes that underlie EMT is imperative for the early diagnosis and clinical control of these disease states. Reliable induction of EMT in vitro is a useful tool for drug discovery as well as to identify common gene expression signatures for diagnostic purposes. Here we demonstrate a straightforward method for the induction of EMT in a variety of cell types. Methods for the analysis of cells pre- and post-EMT induction by immunocytochemistry are also included. Additionally, we demonstrate the effectiveness of this method through antibody-based array analysis and migration/invasion assays.

A straightforward method is described for the induction of epithelial to mesenchymal transition (EMT) in a variety of cell types. Methods for the analysis of cells in EMT states by immunocytochemistry are included.

Mezenkimal Geçiş indüksiyon ve Epitel Analizi

Epithelial  to mesenchymal transition (EMT) is essential for proper morphogenesis during  development. Misregulation of this  process has been implicated ...

In Vitro Assessment of Cardiac Function Using Skinned Cardiomyocytes

In this article, we describe the steps required to isolate a single permeabilized (&#34;skinned&#34;) cardiomyocyte and attach it to a force-measuring apparatus and a motor to perform functional studies. These studies will allow measurement of cardiomyocyte stiffness (passive force) and its activation with different calcium (Ca2+)-containing solutions to determine, amongst others: maximum force development, myofilament Ca2+-sensitivity (pCa50), cooperativity (nHill) and the rate of force redevelopment (ktr). This method also enables determination of the effects of drugs acting directly on myofilaments and of the expression of exogenous recombinant proteins on both active and passive properties of cardiomyocytes. Clinically, skinned cardiomyocyte studies highlight the pathophysiology of many myocardial diseases and allow in vitro assessment of the impact of therapeutic interventions targeting the myofilaments. Altogether, this technique enables the clarification of cardiac pathophysiology by investigating correlations between in vitro and in vivo parameters in animal models and human tissue obtained during open heart or transplant surgery.

This protocol aims to describe step-by-step the technique of extraction and assessment of cardiac function using skinned cardiomyocytes. This methodology allows measurement and acutemodulation of myofilament function using small frozen biopsies that can be collected from different cardiac locations, from mice to men.

Derili Kardiyomiyositler Kullanarak Kardiyak Fonksiyonun İn Vitro Değerlendirilmesi

In this article, we describe the steps required to isolate a single permeabilized (&#34;skinned&#34;) cardiomyocyte and attach it to a force-measuring ...

Tıp

Isolation of Primary Patient-specific Aortic Smooth Muscle Cells and Semiquantitative Real-time Contraction Measurements In Vitro

Smooth muscle cells (SMCs) are the predominant cell type in the aortic media. Their contractile machinery is important for the transmission of force in the aorta and regulates vasoconstriction and vasodilation. Mutations in genes encoding for the SMC contractile apparatus proteins are associated with aortic diseases, such as thoracic aortic aneurysms. Measuring SMC contraction in vitro is challenging, especially in a high-throughput manner, which is essential for screening patient material. Currently available methods are not suitable for this purpose. This paper presents a novel method based on electric cell-substrate impedance sensing (ECIS). First, an explant protocol is described to isolate patient-specific human primary SMCs from aortic biopsies and patient-specific human primary dermal fibroblasts for the study of aortic aneurysms. Next, a detailed description of a new contraction method is given to measure the contractile response of these cells, including the subsequent analysis and suggestion for comparing different groups. This method can be used to study the contraction of adherent cells in the context of translational (cardiovascular) studies and patient and drug screening studies.

Isolation of Primary Patient-specific Aortic Smooth Muscle Cells and Semiquantitative Real-time Contraction Measurements In Vitro

This paper describes an explant culture-based method for the isolation and culturing of primary, patient-specific human aortic smooth muscle cells and dermal fibroblasts. Furthermore, a novel method is presented for measuring cell contraction and subsequent analysis, which can be used to study patient-specific differences in these cells.

Primer Hastaya Özgü Aort Düz Kas Hücrelerinin İzolasyonu ve Yarı Kantitatif Gerçek Zamanlı Kasılma Ölçümleri In Vitro

Smooth muscle cells (SMCs) are the predominant cell type in the aortic media. Their contractile machinery is important for the transmission of force in ...

Bir Gelişimi

Özet

Daha Fazla Video Keşfet

Epikardiyal dışsal gelişimi Kültürü Deneyi ve