Name: using synthetic biology to engineer living cells that interface with programmable materials
Uploaded: 2017-03-09T15:00:00.000+00:00
Duration: 10 min 28 s
Description: Watch this Scientific Journal Video about Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials at JoVE.com

Yazarlar minnetle ABD Bilimsel Araştırma Hava Kuvvetleri Ofisi ödül FA9550-13-1-0108 destek kabul. Yazarlar ayrıca Virginia Politeknik Enstitüsü ve Devlet Üniversitesi&#39;nde Kritik Teknoloji ve Uygulamalı Bilimler Enstitüsü&#39;nde ve Ulusal Bilim Vakfı Lisansüstü Research fon, ABD Donanma Araştırma Ofisi ödül N00014-15-1-2502 destek kabul Burs Programı, ödül sayısı 1.607.310.

<ol>
	<li>Zhang, R., Heyde, K. C., Scott, F. Y., Paek, S. -. H., Ruder, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Programming+Surface+Chemistry+with+Engineered+Cells.">Programming Surface Chemistry with Engineered Cells.</a> ACS Synth. Biol. , (2016).</li><li>Zhou, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reduced+graphene+oxide+films+used+as+matrix+of+MALDI-TOF-MS+for+detection+of+octachlorodibenzo-p-dioxin.">Reduced graphene oxide films used as matrix of MALDI-TOF-MS for detection of octachlorodibenzo-p-dioxin.</a> Chem. Commun. 46, 6974-6976 (2010).</li><li>Pardee, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Low-Cost+Detection+of+Zika+Virus+Using+Programmable+Biomolecular+Components.">Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components.</a> Cell. 165, 1255-1266 (2016).</li><li>B&#228;hring, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+Sensing+Properties+of+a+Self-Assembled+Supramolecular+Oligomer.">Design and Sensing Properties of a Self-Assembled Supramolecular Oligomer.</a> Chem. Eur. J. 22, 1958-1967 (2016).</li><li>Nicolau Jr, D. V., Armitage, J. P., Maini, P. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directional+persistence+and+the+optimality+of+run-and-tumble+chemotaxis.">Directional persistence and the optimality of run-and-tumble chemotaxis.</a> Comp. Biol. Chem. 33, 269-274 (2009).</li><li>Du, J., Shao, Z., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+microbial+factories+for+synthesis+of+value-added+products.">Engineering microbial factories for synthesis of value-added products.</a> J. Ind. Microbiol. Biotechnol. 38, 873-890 (2011).</li><li>Kim, H., Kim, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electric+Field+Control+of+Bacteria-Powered+Microrobots+Using+a+Static+Obstacle+Avoidance+Algorithm.">Electric Field Control of Bacteria-Powered Microrobots Using a Static Obstacle Avoidance Algorithm.</a> IEEE Trans. Rob. 32, 125-137 (2016).</li><li>Gardner, T. S., Cantor, C. R., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+a+genetic+toggle+switch+in+Escherichia+coli.">Construction of a genetic toggle switch in Escherichia coli.</a> Nature. 403, 339-342 (2000).</li><li>Heyde, K. C., Ruder, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+Host-Microbiome+Interactions+using+an+in+Silico+Model+of+Biomimetic+Robots+and+Engineered+Living+Cells.">Exploring Host-Microbiome Interactions using an in Silico Model of Biomimetic Robots and Engineered Living Cells.</a> Sci. Rep. 5, 11988 (2015).</li><li>Rice, M. K., Ruder, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Creating+biological+nanomaterials+using+synthetic+biology.">Creating biological nanomaterials using synthetic biology.</a> Sci. Tech. Adv. Mater. 15, 014401 (2014).</li><li>Green, N. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avidin.+3.+The+nature+of+the+biotin-binding+site.">Avidin. 3. The nature of the biotin-binding site.</a> Biochem. J. 89, 599-609 (1963).</li><li>Mesulam, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tetramethyl+benzidine+for+horseradish+peroxidase+neurohistochemistry:+a+non-carcinogenic+blue+reaction+product+with+superior+sensitivity+for+visualizing+neural+afferents+and+efferents.">Tetramethyl benzidine for horseradish peroxidase neurohistochemistry: a non-carcinogenic blue reaction product with superior sensitivity for visualizing neural afferents and efferents.</a> J Histochem. Cytochem. 26, 106-117 (1978).</li><li>Litcofsky, K. D., Afeyan, R. B., Krom, R. J., Khalil, A. S., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iterative+plug-and-play+methodology+for+constructing+and+modifying+synthetic+gene+networks.">Iterative plug-and-play methodology for constructing and modifying synthetic gene networks.</a> Nat. Meth. 9, 1077-1080 (2012).</li><li>Gibson, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complete+Chemical+Synthesis,+Assembly,+and+Cloning+of+a+Mycoplasma+genitalium+Genome.">Complete Chemical Synthesis, Assembly, and Cloning of a Mycoplasma genitalium Genome.</a> Science. 319, 1215-1220 (2008).</li><li>Diamandis, E. P., Christopoulos, T. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biotin-(strept)avidin+system:+principles+and+applications+in+biotechnology.">The biotin-(strept)avidin system: principles and applications in biotechnology.</a> Clin. Chem. 37, 625-636 (1991).</li><li>Nerurkar, L. S., Namba, M., Brashears, G., Jacob, A. J., Lee, Y. J., Sever, J., L, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+detection+of+herpes+simplex+virus+in+clinical+specimens+by+use+of+capture+biotin-streptavidin+enzyme-linked+immunosorbent+assay.">Rapid detection of herpes simplex virus in clinical specimens by use of capture biotin-streptavidin enzyme-linked immunosorbent assay.</a> J. Clin. Micro. 20, 109-114 (1984).</li><li>Cui, Y., Wei, Q., Park, H., Lieber, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nanowire+Nanosensors+for+Highly+Sensitive+and+Selective+Detection+of+Biological+and+Chemical+Species.">Nanowire Nanosensors for Highly Sensitive and Selective Detection of Biological and Chemical Species.</a> Science. 293, 1289-1292 (2001).</li></ol>

Yazarlar ifşa hiçbir şey yok.

Biz bir fonksiyonelleştirilmiş malzeme yüzeyi ile yaşayan mühendislik hücrelerin arayüz için yeni bir strateji sundu. Bu IPTG ile indüklenmiştir zaman biyotin yüksek seviyelerde sentez edebilme yeteneğine sahip olan bir hücre hattı geliştirilmesi ile gerçekleştirildi. biotin yüksek seviyeler daha sonra fonksiyonalize yüzeyini değiştirmek için kullanılabilir. Protokoller E.coli hücre hattını mühendis nasıl ve iki farklı fonksiyonalize yüzeyler oluşturmak için nasıl ayrıntılı. Bu protokol kritik adımlar mühendislik hücre hattı inşaatı boyunca meydana gelir. Mansap sorunları, hem de büyüme eğrileri ile tasarlanmış hücre suşları karakterize (Şekil 2) ve floresan yanıt (Şekil 3) önlemek için teşvik edilmektedir. Usul sorunları ortaya çıkarsa, bu tür PCR çıkarma ve Gibson montajı 14 gibi diğer moleküler klonlama stratejileri, nerede adımlar için uygun ikame edilebilir. biotin Yie optimize içinişlenmiş hücre çizgisinin LD, DTB yeterli bir miktarda hücrelere sağlanan sağlamak için çok önemlidir. Çalışmalarımızda olarak, hücreler, IPTG ile indüklenmiştir zaman 200 ng / ml DTB biyotin üretiminde önemli ve anlamlı bir artış ortaya bulundu. Ayrıca, BSA-Biotin, SA-HRP ve Biotin-HRP başarılı çekimleri etkili bir performans ve dolaylı ve doğrudan kontrol şemaları izlemek için çok önemlidir. ışığa, gereksiz maruz kalmasını önlemek ve konjugatları etkin konjugat oluşturulmaktadır sağlamak için 4 ° C&#39;de bir gece boyunca inkübe izin dikkat edin. Bizim protokolünün örneğin 4&#39;-hydroxyazobenzene-2-karboksilik asite dayanan ticari olarak biyotin tespit kiti ile karşılaştırıldığında (pg / ml ölçeği) biyolojik olarak alakalı biyotin küçük miktarlarda tespit edebilme kabiliyeti için alternatif yöntemler 15 göre avantajlar sunar kompetitif bağlanma stratejileri. streptavidin bio kullanarak rağmenkalay sistem biyoteknoloji 16, 17 yaygındır, biotin küçük miktarlarda yanıt vermek sistemin yeteneği doğrudan işlevsel yüzey ile genetiği değiştirilmiş hücre hattını bağlamak için bize izin verir. Bizim protokol potansiyel bir sınırlama biotin algılama ortaya çıkan dinamik aralık olduğunu. Dolaylı ve doğrudan kontrol şemaları, biz (4 Şekil) sırasıyla / mL pg 4 -10 6 3 -10 2 10 ila 10 biyotin tespit edebiliyoruz. Neyse ki, dolaylı kontrol şeması düşük aralık bizi kolayca tasarlanmış hücrelerden biyotin üretimini algılamasını sağlar. Ancak, dolaylı kontrolü dinamik aralık sıkı bant biyotin konsantrasyonlarında büyük değişiklikler (100 kat) anlamda kabiliyetini sınırlar. hem dolaylı ve doğrudan kontrol şemaları için dinamik aralığı değiştirilmesi ek mühendislik gerektirir. Bununla birlikte, saptama hücre-üretmek eğerd biotin dolaylı kontrol şeması (Şekil 5) dinamik aralık hedef araştırmacı izin vermelidir adım 4.6 biotin süpernatant dilüsyonları hazırlamak, bir konudur. süpernatant 5 seyreltme bizi etkili dolaylı kontrol planın dinamik aralığı hedeflemesine izin: Biz 1 bulundu. Bu seyreltme stratejisi doğrudan dinamik aralığını değiştirmek ihtiyacını hafifletmek gerekir. Burada yer alan iki parçalı, hücre malzeme sistemi işlevsel yüzey bileşimini değiştirmek için hücreleri işenmiş sağlar. Dinamik, canlı hücreler genetik yanıt üretmek için kimyasal çevresi yorumlayabilir. biyotin üretimini artırmak için bu genetik yanıtı mühendislik, biz bir fonksiyonlaşmış yüzeyi kontrol ve manipüle etme yeteneği ile mühendislik yaşam hücreleri bağışlamak olabilir. sunulan protokolleri takip ederek, mühendislik hücreler okuma, işleme kapasitesine sahip olduğu dinamik sensörleri, hareket edebiliyoruz, ve inci etrafında koşulları kayıtfonksiyonlaşmış arabirimler üzerinden em. Bu teknoloji moleküler tıp çevresel iyileştirme için analit algılama değişen alanları etkileyebilir.

Burada, bir mühendislik hücre hattından bir kimyasal sinyali cevap verebilen bir programlanabilir alt tabakanın geliştirilmesi için prosedürler bildirmektedir. 1 Biz sentetik tasarlanmış Escherichia coli (E. coli) hücreler tarafından üretilen biyotin yanıt veren bir biyotin-streptavidin arayüz oluşturarak bunu. Daha önce, programlanabilir yüzeyler toksin tespiti 2 ve nokta-bakım teşhisi 3 savunma ve güvenlik için geniş bir uygulama yelpazesi için tasarlanmış edilmiştir. Programlanabilir yüzeyler sensörler ve aktüatörler olarak yararlı olabilir 4, onlar farklı çevresel zorluklara uyum yeteneği ile donatarak, &quot;akıllı&quot; hale getirilebilir. Bunun aksine, örneğin, E. coli gibi daha basit bir mikroorganizmalar doğal uyum ve karmaşık ve çoğu zaman, beklenmedik çözümlerle zorluklara yanıt yeteneğine sahiptir. Bu uyum E. sağladıkompleks gen ağları tarafından kontrol coli popülasyonları, maliyet-etkin bir kaynak aramaya, 5 katma değerli ürünler, 6 ve hatta güç mikro ölçekli robotik oluşturun. 7 programlanabilir yüzeylerin kullanımı ile yaşayan hücrelerin adaptif avantajlarını birleştirerek, farklı çevre koşullarına cevap verebilecek bir akıllı substrat oluşturabilirsiniz. Sentetik biyoloji canlıların davranışlarını programlamak için araştırmacılara yeni yetenekler vermiştir. yeni gen düzenleyici ağları içeren hücrelerin mühendislik, araştırmacılar programlanmış bir dizi davranışı gösteren hücreleri tasarlayabilirsiniz. Temel araştırma ötesinde 8, 9, bu davranışlar gibi katma değerli ürünler malzeme düzeneğini kontrol ve biyolojik üretmek gibi uygulamalar için kullanılabilir. 10 Burada, sentetik biyoloji araçlarını kullanılan ayrıntılarıyla nasıl trindüksiyondan sonra biotin sentezleyen bir E. coli suşu disi. Bu soy, bir plazmid, pKE1-lacl-biyobalistik monte sınırlama enzimi klonlama yöntemleri kullanılarak geliştirilmiştir. E. coli K-12 MG1655 dönüştürülmüştür, bu plasmid, biyobalistik, biyotin sentezi için gerekli bir enzimin, yüksek seviyelerde ifade yeteneğine sahip hücrelerin endows. dönüştürülmüş hücreler izopropil β-D-1-tiogalaktopiranosid (IPTG) ile teşvik ve bir biyotin ön, destiobiyotin (DTB) ile sağlanan zaman, biotin yüksek seviyelerde üretildi. streptavidin, biyotin en bağlanma etkileşimi doğada bulunan güçlü kovalent olmayan bağlar biridir. örneğin, biyotin-streptavidin interaksiyonundan iyi karakterize edilmiş ve son derece biyoteknoloji kullanılan hem de. Bu yazının içinde 11 biz duygusu ve işlevsel yüzey hücre üretilen biyotin algılamak için biyotin-streptavidin etkileşimi kullanan iki strateji sunuyoruz. Biz&quot;Dolaylı&quot; ve &quot;doğrudan&quot; kontrol programları gibi bu zıt yüzeylere bakın. Dolaylı kontrol şeması, hücre üretilen biyotin konjuge ve bağlayıcı siteler streptavidin bir polistiren yüzey üzerine immobilize edilmiş biotin ile rekabet eder. Buna ek olarak, streptavidin-yaban turpu peroksidaz (HRP) ile konjuge edilir. HRP 3, 3 &#39;, 5, 5&#39;-tetrametilbenzidin (TMB), 450 nm (OD 450), spektral emicilik (yani, optik yoğunluk) miktarının izlenebilir bir optik sinyalin, 12 üretilmesi için değiştirir. Böylece, dolaylı kontrol düzeni araştırmacılar OD 450 sinyal attentuation izleyerek hücre üretilen biyotin ölçmek için sağlar. doğrudan kontrol şeması bir malzeme yüzeyine doğrudan streptavidin hareketsiz hale ve bağlayıcı siteleri streptavidin için rekabet hücre üretilen biyotin ve biyotinile HRP izin vererek streptavidin-biotin olay patlatır. Yine,Hücre üretilen biyotin nispi seviyeleri, bir OD 450 sinyalinin ölçülmesi ile takip edilir. Birlikte ele alındığında, mühendislikten geçirilen hücreler ve fonksiyonalize yüzeyler US canlı hücre ağları uyararak programlanabilir yüzey özelliklerini kontrol sağlar. Diğer bir deyişle, biz birlikte bu sistemleri birbirine bağlayarak bir mühendislik malzemesi arayüzü canlıların uyum ve güvenilirlik ve şartname yararlanır bir sistem oluşturduk.

<table><tbody><tr><td>LB Broth, Miller&amp;nbsp;</td><td>Fisher Scientific</td><td>12-795-027</td><td></td></tr><tr><td>Agar</td><td>Fisher Scientific</td><td>BP9744500</td><td></td></tr><tr><td>Carbenicillin&amp;nbsp;</td><td>Fisher Scientific</td><td>BP26481</td><td></td></tr><tr><td>M9, Minimimal Salts, 5x</td><td>Sigma-Aldrich</td><td>M6030</td><td></td></tr><tr><td>Casamino Acids&amp;nbsp;</td><td>Fisher Scientific</td><td>BP1424-100</td><td></td></tr><tr><td>Magnesium Sulfate, Anhydrous</td><td>Fisher Scientific</td><td>M65-500</td><td></td></tr><tr><td>Calcium Chloride, Dihydrate</td><td>Fisher Scientific</td><td>C79-500</td><td></td></tr><tr><td>Dextrose (D-Glucose), Anhydrous</td><td>Fisher Scientific</td><td>D16-1</td><td></td></tr><tr><td>NEB Turbo Cell Line</td><td>New England Biolabs</td><td>C2984l</td><td></td></tr><tr><td>Oligonucleotide Primers</td><td>Thermo Fisher Scientific</td><td>N/A</td><td>25N synthesis, DSL purification</td></tr><tr><td>Q5 High-Fidelity Polymerase</td><td>New England Biolabs</td><td>M0491S</td><td></td></tr><tr><td>Q5 Reaction Buffer</td><td>New England Biolabs</td><td>B9027S</td><td></td></tr><tr><td>dNTP Solution Mix</td><td>New England Biolabs</td><td>N0447S</td><td></td></tr><tr><td>Agarose</td><td>Bioexpress</td><td>E-3120-125</td><td></td></tr><tr><td>Ethidium Bromide, 1%</td><td>Fisher Scientific</td><td>BP1302-10</td><td></td></tr><tr><td>Gel Extraction Kits</td><td>Epoch Biolabs</td><td>2260250</td><td></td></tr><tr><td>GenCatch Plasmid DNA Miniprep Kit</td><td>Epoch Biolabs</td><td>2160250</td><td></td></tr><tr><td>AatII</td><td>New England Biolabs</td><td>R0117S</td><td></td></tr><tr><td>SacII</td><td>New England Biolabs</td><td>R0157S</td><td></td></tr><tr><td>HindIII-HF</td><td>New England Biolabs</td><td>R3104S</td><td></td></tr><tr><td>EcoRI-HF</td><td>New England Biolabs</td><td>R3101S</td><td></td></tr><tr><td>Cutsmart Buffer</td><td>New England Biolabs</td><td>B7204S</td><td></td></tr><tr><td>T4 DNA Ligase</td><td>New England Biolabs</td><td>M0202S</td><td></td></tr><tr><td>T4 DNA Ligase Reaction Buffer</td><td>New England Biolabs</td><td>B0202S</td><td></td></tr><tr><td>ColiRolle Glass Plating Beads&amp;nbsp;</td><td>EMD Millipore</td><td>7101-3</td><td></td></tr><tr><td>Glycerol</td><td>Fisher Scientific</td><td>BP229-1</td><td></td></tr><tr><td>Isopropyl &amp;beta;-D-1-thiogalactopyranoside (IPTG)</td><td>Fisher Scientific</td><td>BP1755-10</td><td></td></tr><tr><td>NHS-Desthiobiotin (DTB)</td><td>Thermo Fisher Scientific</td><td>16129</td><td></td></tr><tr><td>Succinimidyl Trans-4-(maleimidylmethyl) Cyclohexane-1-Carboxylate (SMCC)&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>S1534</td><td></td></tr><tr><td>Dimethyl Sulfoxide (DMSO)&amp;nbsp;</td><td>Fisher Scientific</td><td>BP231-100</td><td></td></tr><tr><td>Succinimidyl 3-(2-pyridyldithio) Propionate (SPDP)&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>S1531</td><td></td></tr><tr><td>NHS-LC-LC-biotin</td><td>Thermo Fisher Scientific</td><td>21343</td><td></td></tr><tr><td>Horseradish Peroxidase (HRP)&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>31490</td><td></td></tr><tr><td>Phosphate Buffered Saline (PBS), 10x Solution</td><td>Fisher Scientific</td><td>BP399500</td><td></td></tr><tr><td>Streptavidin (SA)&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>21145</td><td></td></tr><tr><td>Bovine Serum Albumin (BSA)</td><td>Fisher Scientific</td><td>BP1600-100</td><td></td></tr><tr><td>Dithiothreitol (DTT)</td><td>Fisher Scientific</td><td>BP172-5</td><td></td></tr><tr><td>Ethylenediaminetetaacetic acid (EDTA)&amp;nbsp;</td><td>Fisher Scientific</td><td>S311-500</td><td></td></tr><tr><td>Tween 80&amp;nbsp;</td><td>Fisher Scientific</td><td>T164-500</td><td></td></tr><tr><td>Hydrogen Peroxide</td><td>Fisher Scientific</td><td>H325-4</td><td></td></tr><tr><td>3, 3&#039;, 5, 5&#039;-tetramethylbenzidine (TMB)</td><td>Fisher Scientific</td><td>AC229280050</td><td></td></tr><tr><td>Vivaspin 500 Centrifugal Concentrators&amp;nbsp;</td><td>Viva Products</td><td>VS0192</td><td></td></tr><tr><td>Sodium Acetate, Anhydrous</td><td>Fisher Scientific</td><td>BP333-500</td><td></td></tr><tr><td>96-Well Polystyrene Plates</td><td>Thermo Fisher Scientific</td><td>266120</td><td></td></tr></tbody></table>

using synthetic biology to engineer living cells that interface with programmable materials

Biz mühendislik hücreler işlevsel yüzey malzeme özelliklerini kontrol sağlayan bir abiyotik-biyotik bir arayüz geliştirdik. E. coli hücrelerinin bir sentetik tasarlanmış suşu ve işlevselleştirilmiş ara yüzüne: Bu sistem, iki modül oluşturarak yapılır. Bu metinde yer alan, biz detay genetik moleküler klonlama stratejileri kullanarak E.coli suşu içinde seçilen davranışları mühendislik için bir protokol. Bir kimyasal uyarıcı maruz kaldığında kez geliştirilen bu suş biotin yüksek seviyelerde üretir. Buna ek olarak, hücre sentezlenmiş biyotin cevap verebilecek her biri iki farklı işlevselleştirilmiş yüzeyler oluşturmak için ayrıntılarıyla protokolleri. Birlikte ele alındığında, biz cansız yüzeylerde malzeme bileşimi ve montaj kontrol hücreleri mühendislik sağlayan bir bağlantılı, abiyotik-biyotik sistemi oluşturmak için bir metodoloji sunuyoruz.

Temsilcisi sonuçları ekteki beş şekillerde sunulmaktadır. Okuyucu görsel sentetik mühendislik E.coli suşu oluşturmak için kritik adımları böylece Öncelikle, biz grafiksel klonlama işlemini (Şekil 1) sunuyoruz. Hücrelerin popülasyon dinamiklerini karakterize etmek amacıyla, nüfusun, 600 nm (OD 600) de optik yoğunluk ölçümü ile üretilen bir büyüme eğrisi (Şekil 2) bulunur. Sonra, biz düzenleyici gen ağı bize optik IPTG ile indüksiyon üzerine hücre tarafından üretilen olacağını biyobalistik nispi miktarını ölçmek için izin biyobalistik için bir vekil olarak (Şekil 3) mCherry kullanarak, doğrulanmaktadır nasıl gösterir. Sonra, dolaylı kontrolü ve direkt kontrol fonksiyonlaşmış yüzeyler için yanıt verileri sunmak. Bu veriler araziler (Şekil 4) ücretsiz ölçülen çözümlerini kullanılarak geliştirilenBiotin işlevselleştirilmiş yüzeylerin tepki profillerini karakterize etmek. Son olarak, bu şekilde fonksiyonalize yüzey modifiye üzerine dizayn edilen hücreler, biyotin (Şekil 5) üretilmesi için indüklenir gösteren karakteristik verilerini sunmaktadır. <img alt="Şekil 1" src="/files/ftp_upload/55300/55300fig1.jpg" /> Şekil 1: Tasarım ve İndüklenebilir, Engineered Hücreleri inşaatı. (A), primerler biyotin sentez yolağındaki önemli bir enzimi kodlayan, E. coli genomu, adlı biyobalistik geni izole etmek için tasarlandı. (B) p L teto-1 -lacI ve p TRC-2 karşılık gelen sekanslar primerler ile genetik değiştirme anahtarını ihtiva eden bir plazmidden izole edilebilir. (Cı) ile ekstre biyobalistik geni ve geçiş anahtarı iki fragman daha sonra gen devre oluşturmak için de kullanılabilir. IND&#39;ye olabilir IPTG eklenmesiDTB biyobalistik için alt-tabaka olarak ilave edildiğinde biyobalistik ve böylece biyotin sentezi ifade üçe. (D) bir araya plazmid K-12 MG1655 E. coli &#39;ye transforme edildi. Bu DTB bir alt-tabaka olarak temin edilmiştir zaman işlenmiş hücre hattı ile biyobalistik ve böylece biyotin sentez ekspresyonunu indükleme IPTG varlığında neden oldu. <a href="http://ecsource.jove.com/files/ftp_upload/55300/55300fig1large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img alt="şekil 2" src="/files/ftp_upload/55300/55300fig2.jpg" /> Şekil 2: İşlenmiş Hücreleri Büyüme Eğrileri. Işlenmiş, uyarılabilir MG1655 doğal tipte hücreler, büyütüldü ve minimal ortam (örneğin, biyotin içermeyen M9 ortam), hem de minimal ortam DTB ile takviye (200 ng / ml) ve / veya IPTG (0.5 mm) içinde izlenmiştir. Araziler OD 600 okuma ölçülen her 5 ml göstermektedir<html> 24 saat boyunca n. <a href="http://ecsource.jove.com/files/ftp_upload/55300/55300fig2large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img alt="Şekil 3," src="/files/ftp_upload/55300/55300fig3.jpg" /> Şekil 3: Engineered Gen Ağı Test. floresan protein MCherry yerine kullanılmıştır mühendislik hücreler IPTG ile uyarılmıştır zaman biz optik indüksiyon profili ölçmek böylece biyobalistik gen. Biz IPTG (mavi elmas) ile uyarılan değil hücreleri ile IPTG (kırmızı elmas) ile uyarılan hücreler kontrast. Bu sonuçlar, uyanlabilir gen ağ etkinliğini göstermektedir. <a href="http://ecsource.jove.com/files/ftp_upload/55300/55300fig3large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> /55300/55300fig4.jpg &quot;/&gt; Şekil 4: Fonksiyonel Malzeme Arayüz doğrulanması. Biotin konsantrasyonları için fonksiyonalize yüzey teşhir ederek, OD 450 absorbansı ölçülerek optik cevap ölçebilir. Bu sonuçlar, karşılık optik yoğunluğuna biyotin konsantrasyonu bağlama ABD bir kalibrasyon eğrisi oluşturmak için izin verir. Burada, hem dolaylı (solda) ve doğrudan (sağ) fonksiyonelleştirilmiş yüzey düzenleri için optik sinyal eğrileri vs biotin sunuyoruz. <a href="http://ecsource.jove.com/files/ftp_upload/55300/55300fig4large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img alt="Şekil 5," src="/files/ftp_upload/55300/55300fig5.jpg" /> Şekil 5: İşlenmiş Hücreler Malzeme Arayüzü kontrol edin. protokol bölümleri 5 veya 6 yararlanarak, biz kaynaklı, mühendislik c ürünlerini kullanmak mümkünarşın kimyasal fonksiyonalize yüzeyini değiştirmek için. Biz OD 450 ölçerek optik bu yanıtları izleyebilirsiniz. Bundan başka, Şekil 4 içinde geliştirilen kalibrasyon eğrisi kullanılarak, yoğunlaştırma olan biyotine karşılık optik yoğunluğu bağlantı olabilir. Burada doğal tipte hücreler (beyaz), pKE1-lacl-biyobalistik plazmid (turuncu) ihtiva eden indüklenmemiş hücreleri için dolaylı bir kontrol şeması fonksiyonalize yüzey ile ölçülen farklı biyotin konsantrasyonları, ve pKE1-lacl-biyobalistik ihtiva eden bağlı hücrelerin mevcut plazmid (gri). <a href="http://ecsource.jove.com/files/ftp_upload/55300/55300fig5large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Kimyasal </td><td> nihai konsantrasyon </td><td> Tutar </td></tr><tr><td> 5x M9 tuzları </td><td> 1x </td><td> 20 mL </td></tr><tr><td> 1 M MgSO 4 </td><td> 2 mM </td><td> 200 uL </td></tr><tr><td> 1 M CaCI2 </td><td> 0.1 mM </td><td> 10 uL </td></tr><tr><td> % 20 glükoz </td><td> % 0,40 </td><td> 2 mL </td></tr><tr><td> % 2 biyotin-serbest kasamido asit </td><td> % 0.02 </td><td> 1 mL </td></tr><tr><td> DI Su </td><td> N / A </td><td> 76.8 ml </td></tr></tbody></table> Tablo 1: M9 aracı tarifi. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> isim </td><td colspan="2"> primer sekans </td><td> kullanım </td></tr><tr><td> 1-F </td><td colspan="2"> CCGCCGGAATTCTCCCTATCAGTGATAGAGATT </td><td> laeI kaset çıkarma </td></tr><tr><td> 1-r </td><td colspan="2"> CCGACGTCTCACTGCCCGCTTTCCAGTC </td><td> laeI kaset çıkarma </td></tr><tr><td> nBioB1-F </td><td colspan="2"> CCCAAGCTTCTGAAATGAGCTGTTGACAATTAATCAT </td><td> P trc-2 çıkarma </td></tr><tr><td> nBioB1-r </td><td colspan="2"> GGGGGGTTCTTTTAATAAAGGTACCGTGTGAAATTGTT </td><td> P trc-2 çıkarma </td></tr><tr><td> nBioB2-f1 </td><td colspan="2"> ACCCCCCTAAGGAGGTCATCATGGCTCACCGCCCACG </td><td> biyobalistik çıkarma </td></tr><tr><td> nBioB2-r </td><td colspan="2"> TCCCCGCGGTCATAATGCTGCCGCGTTGTAATATTC </td><td> biyobalistik çıkarma </td></tr><tr><td> nBioB2-f2 </td><td colspan="2"> ACGGTACCTTTATTAAAAGAACCCCCCTAAGGAGGTCATC </td><td> Sentetik RBS ekleme </td></tr></tbody></table> Tablo 2: astar listesi. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td&gt; Adım 1 </td><td> Adım 2 </td><td> Aşama 3 </td><td> Aşama 4 </td><td> Adım 5 </td><td> Aşama 6 </td><td> Aşama 7 </td><td> Aşama 8 </td><td> Aşama 9 </td></tr><tr><td> 98 ° C </td><td> 98 ° C </td><td> 70 ° C </td><td> 72 ° C </td><td> 98 ° C </td><td> 60 ° C </td><td> 72 ° C </td><td> 72 ° C </td><td> 4 ° C </td></tr><tr><td> 00:30 </td><td> 00:10 </td><td> 00:30 </td><td> 01: 00 / kb </td><td> 00:10 </td><td> 00:30 </td><td> 01: 00 / kb </td><td> 02:00 </td><td> ∞ </td></tr><tr><td rowspan="2"></td><td colspan="3"> 12 kez tekrarlayın </td><td colspan="3" rowspan="2"> 25 kez tekrarlayın </td><td colspan="2" rowspan="2"></td></tr><tr><td colspan="3"> -1 C / döngüsü ° </td></tr></tbody></table>Tablo 3: PCR Programı. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> isim </td><td> hacim </td></tr><tr><td> Hücre lizatı (şablon) </td><td> 10 uL </td></tr><tr><td> Astar (her biri) </td><td> 0.625 uL (her biri) </td></tr><tr><td> 5x Q5 tampon </td><td> 5 uL </td></tr><tr><td> Q5 Polimeraz </td><td> 0.25 uL </td></tr><tr><td> dNTP karışımı </td><td> 0.5 uL </td></tr><tr><td> DI Su </td><td> 6.75 uL </td></tr></tbody></table> Tablo 4: Tüm Hücre PCR Reaksiyon (25 ul). <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> isim </td><td> hacim </td></tr><tr><td> 10x reaksiyon tamponu </td><td> 5 uL </td></tr><tr><td> enzim 1 </td><td> 1 pL </td></tr><tr><td> Enzim 2 </td><td> 1 pL </td></tr><tr><td> Şablon DNA, </td><td> 1 ug </td></tr><tr><td> DI Su </td><td> 43 uL - DNA hacmi </td></tr></tbody></table> Tablo 5: kısıtlayıcı enzim sindirimi Reaksiyon (50 ul). <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> isim </td><td> hacim </td></tr><tr><td> DNA </td><td> + X ug insert 50 ug vektör </td></tr><tr><td> 10x ligaz tamponu </td><td> 1 pL </td></tr><tr><td> T4 ligaz </td><td> 1 pL </td></tr><tr><td> DI Su </td><td> 8 uL - DNA hacmi </td></tr></tbody></table>Tablo 6: ligasyon reaksiyonu (10 uL). <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> isim </td><td> konsantrasyon </td><td> notlar </td></tr><tr><td> CaCl2 </td><td> 100 mM </td><td></td></tr><tr><td> Carbeniccilin </td><td> 50 mg / ml (1000x) </td><td></td></tr><tr><td> DTB </td><td> 50 ug / ml </td><td></td></tr><tr><td> IPTG </td><td> 0.5 M </td><td></td></tr><tr><td> SMCC </td><td> 20 mg / ml </td><td> 100uL DMSO içinde 2mg </td></tr><tr><td> SPDP </td><td> 20 mg / ml </td><td> 100uL DMSO içinde 2mg </td></tr><tr><td> LC-LC-biyotin </td><td> 20 mg / ml </td><td> 100uL DMSO içinde 2mg </td></tr><tr><td> HRP </td><td> 10 mg / ml </td><td> PBS içinde </td></tr><tr><td> SA (dolaylı) </td><td> 10 mg / ml </td><td> PBS içinde </td></tr><tr><td> SA (doğrudan) </td><td> 0.17 ug / ml </td><td> PBS içinde </td></tr><tr><td> BSA </td><td> 20 mg / ml </td><td> PBS içinde </td></tr><tr><td> DTT </td><td> 100mM </td><td> DI Water </td></tr><tr><td> EDTA </td><td> 5 mM </td><td> 10 ml PBS içine 18.6 mg </td></tr><tr><td> Kazein </td><td> % 0,50 </td><td> PBS içinde </td></tr><tr><td> Tween 80 </td><td> % 20 </td><td> DI Water </td></tr><tr><td> PBS Tween 80 </td><td> % 0.05 </td><td></td></tr><tr><td> Sodyum asetat </td><td> 50 mM </td><td> DI Water, 3 M HCI kullanılarak 5.1 pH ayarlayın </td></tr><tr><td> TMB </td><td> % 1 </td><td> DMSO içinde </td></tr><tr><td> H2O 2 </td><td> % 3 </td><td> DI Water </td></tr><tr><td> H 2 SO 4 </td><td> 2M </td><td> DI Water </td></tr></tbody></table>Tablo 7: Reaktif Solutions listesi.

Watch this Scientific Journal Video about Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials at JoVE.com

Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials

Bu yazıda mühendislik hücreleri ve sentetik kontrol ve programlanabilir malzeme yüzeylerini işlemek için E. coli mühendislik enable işlevselleştirilmiş yüzeylerin geliştirilmesi için bir dizi protokol sunar.

Yaşayan Hücreleri Mühendise Sentetik Biyoloji kullanarak That Programlanabilir Malzemelerle Arayüzü

We have developed an abiotic-biotic interface that allows engineered cells to control the material properties of a functionalized surface. This system is ...

using-synthetic-biology-to-engineer-living-cells-that-interface-with

Nanyang Technological University

Research

JoVE Journal

Bioengineering

8.8K Görüntüleme.  Carnegie Mellon University.  Bu yazıda mühendislik hücreleri ve sentetik kontrol ve programlanabilir malzeme yüzeylerini işlemek için E. coli mühendislik enable işlevselleştirilmiş yüzeylerin geliştirilmesi için bir dizi protokol sunar. 

Video: Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials

Bridging the Bio-Electronic Interface with Biofabrication

Advancements in lab-on-a-chip technology promise to revolutionize both research and medicine through lower costs, better sensitivity, portability, and higher throughput. The incorporation of biological components onto biological microelectromechanical systems (bioMEMS) has shown great potential for achieving these goals. Microfabricated electronic chips allow for micrometer-scale features as well as an electrical connection for sensing and actuation. Functional biological components give the system the capacity for specific detection of analytes, enzymatic functions, and whole-cell capabilities. Standard microfabrication processes and bio-analytical techniques have been successfully utilized for decades in the computer and biological industries, respectively. Their combination and interfacing in a lab-on-a-chip environment, however, brings forth new challenges. There is a call for techniques that can build an interface between the electrode and biological component that is mild and is easy to fabricate and pattern.
Biofabrication, described here, is one such approach that has shown great promise for its easy-to-assemble incorporation of biological components with versatility in the on-chip functions that are enabled. Biofabrication uses biological materials and biological mechanisms (self-assembly, enzymatic assembly) for bottom-up hierarchical assembly. While our labs have demonstrated these concepts in many formats 1,2,3, here we demonstrate the assembly process based on electrodeposition followed by multiple applications of signal-based interactions. The assembly process consists of the electrodeposition of biocompatible stimuli-responsive polymer films on electrodes and their subsequent functionalization with biological components such as DNA, enzymes, or live cells 4,5. Electrodeposition takes advantage of the pH gradient created at the surface of a biased electrode from the electrolysis of water 6,7,. Chitosan and alginate are stimuli-responsive biological polymers that can be triggered to self-assemble into hydrogel films in response to imposed electrical signals 8. The thickness of these hydrogels is determined by the extent to which the pH gradient extends from the electrode. This can be modified using varying current densities and deposition times 6,7. This protocol will describe how chitosan films are deposited and functionalized by covalently attaching biological components to the abundant primary amine groups present on the film through either enzymatic or electrochemical methods 9,10. Alginate films and their entrapment of live cells will also be addressed 11. Finally, the utility of biofabrication is demonstrated through examples of signal-based interaction, including chemical-to-electrical, cell-to-cell, and also enzyme-to-cell signal transmission. 
Both the electrodeposition and functionalization can be performed under near-physiological conditions without the need for reagents and thus spare labile biological components from harsh conditions. Additionally, both chitosan and alginate have long been used for biologically-relevant purposes 12,13. Overall, biofabrication, a rapid technique that can be simply performed on a benchtop, can be used for creating micron scale patterns of functional biological components on electrodes and can be used for a variety of lab-on-a-chip applications.

This article describes a biofabrication approach: deposition of stimuli-responsive polysaccharides in the presence of biased electrodes to create biocompatible films which can be functionalized with cells or proteins. We demonstrate a bench-top strategy for the generation of the films as well as their basic uses for creating interactive biofunctionalized surfaces for lab-on-a-chip applications.

Biofabrication ile Bio-Elektronik Arayüz Bridging

Advancements in lab-on-a-chip technology promise to revolutionize both research and medicine through lower costs, better sensitivity, portability, and ...

Biyomühendislik

Manipulating Living Cells to Construct Stable 3D Cellular Assembly Without Artificial Scaffold

Regenerative medicine and tissue engineering offer several advantages for the treatment of intractable diseases, and several studies have demonstrated the importance of 3-dimensional (3D) cellular assemblies in these fields. Artificial scaffolds have often been used to construct 3D cellular assemblies. However, the scaffolds used to construct cellular assemblies are sometimes toxic and may change the properties of the cells. Thus, it would be beneficial to establish a non-toxic method for facilitating cell-cell contact. In this paper, we introduce a novel method for constructing stable cellular assemblies by using optical tweezers with dextran. One of the advantages of this method is that it establishes stable cell-to-cell contact within a few minutes. This new method allows the construction of 3D cellular assemblies in a natural hydrophilic polymer and is expected to be useful for constructing next-generation 3D single-cell assemblies in the fields of regenerative medicine and tissue engineering.

We demonstrate a novel method for constructing a single-cell-based 3-dimensional (3D) assembly without an artificial scaffold.

Canlı hücreler yapay iskele olmayan istikrarlı 3D hücresel derleme oluşturmak için değiştirme

Regenerative medicine and tissue engineering offer several advantages for the treatment of intractable diseases, and several studies have demonstrated the ...

Biyokimya

Engineering Intracellular Protein Sensors in Mammalian Cells

Proteins can function as biomarkers of pathological conditions, such as neurodegenerative diseases, infections or metabolic syndromes. Engineering cells to sense and respond to these biomarkers may help the understanding of molecular mechanisms underlying pathologies, as well as to develop new cell-based therapies. While several systems that detect extracellular proteins have been developed, a modular framework that can be easily re-engineered to sense different intracellular proteins was missing.
Here, we describe a protocol to implement a modular genetic platform that senses intracellular proteins and activates a specific cellular response. The device operates on intracellular antibodies or small peptides to sense with high specificity the protein of interest, triggering the transcriptional activation of output genes, through a TEV protease (TEVp)-based actuation module. TEVp is a viral protease that selectively cleaves short cognate peptides and is widely used in biotechnology and synthetic biology for its high orthogonality to the cleavage site. Specifically, we engineered devices that recognize and respond to protein-biomarkers of viral infections and genetic diseases, including mutated huntingtin, NS3 serine-protease, Tat and Nef proteins to detect Huntington&#8217;s disease, hepatitis C virus (HCV) and human immunodeficiency virus (HIV) infections, respectively. Importantly, the system can be hand tailored for the desired input-output functional outcome, such as fluorescent readouts for biosensors, stimulation of antigen presentation for immune response, or initiation of apoptosis to eliminate unhealthy cells.

Here, we present a protocol for engineering genetically-encoded intracellular protein sensor-actuator(s). The device specifically detects target proteins through intracellular antibodies (intrabodies) and responds by switching on gene transcriptional output. A general framework is built to rapidly replace intrabodies, enabling rapid detection of any desired protein, without altering the general architecture.

Proteins can function as biomarkers of pathological conditions, such as neurodegenerative diseases, infections or metabolic syndromes. Engineering cells ...

Genetik

Automated Robotic Liquid Handling Assembly of Modular DNA Devices

Recent advances in modular DNA assembly techniques have enabled synthetic biologists to test significantly more of the available &#34;design space&#34; represented by &#34;devices&#34; created as combinations of individual genetic components. However, manual assembly of such large numbers of devices is time-intensive, error-prone, and costly. The increasing sophistication and scale of synthetic biology research necessitates an efficient, reproducible way to accommodate large-scale, complex, and high throughput device construction.
Here, a DNA assembly protocol using the Type-IIS restriction endonuclease based Modular Cloning (MoClo) technique is automated on two liquid-handling robotic platforms. Automated liquid-handling robots require careful, often times tedious optimization of pipetting parameters for liquids of different viscosities (e.g. enzymes, DNA, water, buffers), as well as explicit programming to ensure correct aspiration and dispensing of DNA parts and reagents. This makes manual script writing for complex assemblies just as problematic as manual DNA assembly, and necessitates a software tool that can automate script generation. To this end, we have developed a web-based software tool, http://mocloassembly.com, for generating combinatorial DNA device libraries from basic DNA parts uploaded as Genbank files. We provide access to the tool, and an export file from our liquid handler software which includes optimized liquid classes, labware parameters, and deck layout. All DNA parts used are available through Addgene, and their digital maps can be accessed via the Boston University BDC ICE Registry. Together, these elements provide a foundation for other organizations to automate modular cloning experiments and similar protocols.
The automated DNA assembly workflow presented here enables the repeatable, automated, high-throughput production of DNA devices, and reduces the risk of human error arising from repetitive manual pipetting. Sequencing data show the automated DNA assembly reactions generated from this workflow are ~95% correct and require as little as 4% as much hands-on time, compared to manual reaction preparation.

Here, an automated workflow to perform modular DNA &#34;device&#34; assembly using a modular cloning DNA assembly method on liquid-handling robots is presented. The protocol uses an intuitive software tool for generating liquid handler picklists for combinatorial DNA device library generation, which we demonstrate using two liquid handling platforms.

Robot sıvı işleme derleme modüler DNA cihazların otomatik

Recent advances in modular DNA assembly techniques have enabled synthetic biologists to test significantly more of the available &#34;design space&#34; ...

Functional Surface-immobilization of Genes Using Multistep Strand Displacement Lithography

Immobilization of genes on lithographically structured surfaces allows the study of compartmentalized gene expression processes in an open microfluidic bioreactor system. In contrast to other approaches towards artificial cellular systems, such a setup allows for a continuous supply with gene expression reagents and simultaneous draining of waste products. This facilitates the implementation of cell-free gene expression processes over extended periods of time, which is important for the realization of dynamic gene regulatory feedback systems. Here we provide a detailed protocol for the fabrication of genetic biochips using a simple-to-use lithographic technique based on DNA strand displacement reactions, which exclusively uses commercially available components. We also provide a protocol on the integration of compartmentalized genes with a polydimethylsiloxane (PDMS)-based microfluidic system. Furthermore, we show that the system is compatible with total internal reflection fluorescence (TIRF) microscopy, which can be used for the direct observation of molecular interactions between DNA and molecules contained in the expression mix.

We describe a simple lithographic procedure for the immobilization of gene-length DNA molecules on a surface, which can be used to perform cell-free gene expression experiments on biochips.

Genlerin Multistep Strand deplasman litografi kullanarak işlevsel yüzey immobilizasyon

Immobilization of genes on lithographically structured surfaces allows the study of compartmentalized gene expression processes in an open microfluidic ...

A Multilayer Microfluidic Platform for the Conduction of Prolonged Cell-Free Gene Expression

The limitations of cell-based synthetic biology are becoming increasingly apparent as researchers aim to develop larger and more complex synthetic genetic regulatory circuits. The analysis of synthetic genetic regulatory networks in vivo is time consuming and suffers from a lack of environmental control, with exogenous synthetic components interacting with host processes resulting in undesired behavior. To overcome these issues, cell-free characterization of novel circuitry is becoming more prevalent. In vitro transcription and translation (IVTT) mixtures allow the regulation of the experimental environment and can be optimized for each unique system. The protocols presented here detail the fabrication of a multilayer microfluidic device that can be utilized to sustain IVTT reactions for prolonged durations. In contrast to batch reactions, where resources are depleted over time and (by-) products accumulate, the use of microfluidic devices allows the replenishment of resources as well as the removal of reaction products. In this manner, the cellular environment is emulated by maintaining an out-of-equilibrium environment in which the dynamic behavior of gene circuits can be investigated over extended periods of time. To fully exploit the multilayer microfluidic device, hardware and software have been integrated to automate the IVTT reactions. By combining IVTT reactions with the microfluidic platform presented here, it becomes possible to comprehensively analyze complex network behaviors, furthering our understanding of the mechanisms that regulate cellular processes.

The fabrication process of a PDMS-based, multilayer, microfluidic device that allows in vitro transcription and translation (IVTT) reactions to be performed over prolonged periods is described. Furthermore, a comprehensive overview of the hardware and software required to automate and maintain these reactions for prolonged durations is provided.

Uzun Süreli Hücresiz Gen Ekspresyonunun İletimi için Çok Katmanlı Mikroakışkan Platform

The limitations of cell-based synthetic biology are becoming increasingly apparent as researchers aim to develop larger and more complex synthetic genetic ...

Preparing Protein Producing Synthetic Cells using Cell Free Bacterial Extracts, Liposomes and Emulsion Transfer

The bottom-up assembly approach for construction of synthetic cells is an effective tool for isolating and investigating cellular processes in a cell mimicking environment. Furthermore, the development of cell-free expression systems has demonstrated the ability to reconstitute the protein production, transcription and translation processes (DNA&#8594;RNA&#8594;protein) in a controlled manner, harnessing synthetic biology. Here we describe a protocol for preparing a cell-free expression system, including the production of a potent bacterial lysate and encapsulating this lysate inside cholesterol-rich lipid-based giant unilamellar vesicles (GUVs) (i.e., stable liposomes), to form synthetic cells. The protocol describes the methods for preparing the components of the synthetic cells including the production of active bacterial lysates, followed by a detailed step-by-step preparation of the synthetic cells based on a water-in-oil emulsion transfer method. These facilitate the production of millions of synthetic cells in a simple and affordable manner with a high versatility for producing different types of proteins. The obtained synthetic cells can be used to investigate protein/RNA production and activity in an isolated environment, in directed evolution, and also as a controlled drug delivery platform for on-demand production of therapeutic proteins inside the body.

This protocol describes the method, materials, equipment and steps for bottom-up preparation of RNA and protein producing synthetic cells. The inner aqueous compartment of the synthetic cells contained the S30 bacterial lysate encapsulated within a lipid bilayer (i.e., stable liposomes), using a water-in-oil emulsion transfer method.

Hücre Serbest Bakteriyel Özler, Lipozomlar ve Emülsiyon Transferi Kullanarak Protein Üreten Sentetik Hücreler Hazırlama

The bottom-up assembly approach for construction of synthetic cells is an effective tool for isolating and investigating cellular processes in a cell ...

Simple, Affordable, and Modular Patterning of Cells using DNA

The relative positioning of cells is a key feature of the microenvironment that organizes cell-cell interactions. To study the interactions between cells of the same or different type, micropatterning techniques have proved useful. DNA Programmed Assembly of Cells (DPAC) is a micropatterning technique that targets the adhesion of cells to a substrate or other cells using DNA hybridization. The most basic operations in DPAC begin with decorating cell membranes with lipid-modified oligonucleotides, then flowing them over a substrate that has been patterned with complementary DNA sequences. Cells adhere selectively to the substrate only where they find a complementary DNA sequence. Non-adherent cells are washed away, revealing a pattern of adherent cells. Additional operations include further rounds of cell-substrate or cell-cell adhesion, as well as transferring the patterns formed by DPAC to an embedding hydrogel for long-term culture. Previously, methods for patterning oligonucleotides on surfaces and decorating cells with DNA sequences required specialized equipment and custom DNA synthesis, respectively. We report an updated version of the protocol, utilizing an inexpensive benchtop photolithography setup and commercially available cholesterol modified oligonucleotides (CMOs) deployed using a modular format. CMO-labeled cells adhere with high efficiency to DNA-patterned substrates. This approach can be used to pattern multiple cell types at once with high precision and to create arrays of microtissues embedded within an extracellular matrix. Advantages of this method include its high resolution, ability to embed cells into a three-dimensional microenvironment without disrupting the micropattern, and flexibility in patterning any cell type.

Here we present a protocol to micropattern cells at single-cell resolution using DNA-programmed adhesion. This protocol uses a benchtop photolithography platform to create patterns of DNA oligonucleotides on a glass slide and then labels cell membranes with commercially available complementary oligonucleotides. Hybridization of the oligos results in programmed cell adhesion.

DNA Kullanarak Hücrelerin Basit, Uygun Fiyatlı ve Modüler Deseni

The relative positioning of cells is a key feature of the microenvironment that organizes cell-cell interactions. To study the interactions between cells ...

Rapid Characterization of Genetic Parts with Cell-Free Systems

Characterizing and cataloging genetic parts are critical to the design of useful genetic circuits. Having well-characterized parts allows for the fine-tuning of genetic circuits, such that their function results in predictable outcomes. With the growth of synthetic biology as a field, there has been an explosion of genetic circuits that have been implemented in microbes to execute functions pertaining to sensing, metabolic alteration, and cellular computing. Here, we show a rapid and cost-effective method for characterizing genetic parts. Our method utilizes cell-free lysate, prepared in-house as a medium to evaluate parts via the expression of a reporter protein. Template DNA is prepared by PCR amplification using inexpensive primers to add variant parts to the reporter gene, and the template is added to the reaction as linear DNA without cloning. Parts that can be added in this way include promoters, operators, ribosome binding sites, insulators, and terminators. This approach, combined with the incorporation of an acoustic liquid handler and 384-well plates, allows the user to carry out high-throughput evaluations of genetic parts in a single day. By comparison, cell-based screening approaches require time-consuming cloning and have longer testing times due to overnight culture and culture density normalization steps. Further, working in cell-free lysate allows the user to exact tighter control over the expression conditions through the addition of exogenous components and DNA at precise concentrations. Results obtained from cell-free screening can be used directly in applications of cell-free systems or, in some cases, as a way to predict function in whole cells.

Well-characterized genetic parts are necessary for the design of novel genetic circuits. Here we describe a cost-effective, high-throughput method for rapidly characterizing genetic parts. Our method reduces cost and time by combining cell-free lysates, linear DNA to avoid cloning, and acoustic liquid handling to increase throughput and reduce reaction volumes.

Genetik Parçaların Hücresiz Sistemlerle Hızlı Karakterizasyonu

Characterizing and cataloging genetic parts are critical to the design of useful genetic circuits. Having well-characterized parts allows for the ...

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

Ideal cell-free expression systems can theoretically emulate an in vivo cellular environment in a controlled in vitro platform.1 This is useful for expressing proteins and genetic circuits in a controlled manner as well as for providing a prototyping environment for synthetic biology.2,3 To achieve the latter goal, cell-free expression systems that preserve endogenous Escherichia coli transcription-translation mechanisms are able to more accurately reflect in vivo cellular dynamics than those based on T7 RNA polymerase transcription. We describe the preparation and execution of an efficient endogenous E. coli based transcription-translation (TX-TL) cell-free expression system that can produce equivalent amounts of protein as T7-based systems at a 98% cost reduction to similar commercial systems.4,5 The preparation of buffers and crude cell extract are described, as well as the execution of a three tube TX-TL reaction. The entire protocol takes five days to prepare and yields enough material for up to 3000 single reactions in one preparation. Once prepared, each reaction takes under 8 hr from setup to data collection and analysis. Mechanisms of regulation and transcription exogenous to E. coli, such as lac/tet repressors and T7 RNA polymerase, can be supplemented.6 Endogenous properties, such as mRNA and DNA degradation rates, can also be adjusted.7 The TX-TL cell-free expression system has been demonstrated for large-scale circuit assembly, exploring biological phenomena, and expression of proteins under both T7- and endogenous promoters.6,8 Accompanying mathematical models are available.9,10 The resulting system has unique applications in synthetic biology as a prototyping environment, or "TX-TL biomolecular breadboard."

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

This five-day protocol outlines all steps, equipment, and supplemental software necessary for creating and running an efficient endogenous Escherichia coli based TX-TL cell-free expression system from scratch. With reagents, the protocol takes 8 hours or less to setup a reaction, collect, and process data.

Bir uygulama için Protokoller<em&gt; Escherichia coli</emSentetik Biyoloji&gt; Tabanlı TX-TL Hücre-Özgür İfade Sistemi

Ideal cell-free expression systems can theoretically emulate an in vivo cellular environment in a controlled in vitro platform.1 This is useful for ...