Name: rescue and characterization of recombinant virus from a new world zika virus infectious clone
Uploaded: 2017-06-07T15:00:00.000+00:00
Duration: 7 min 35 s
Description: Watch this Scientific Journal Video about Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone at JoVE.com

Yazarlar Klon&#39;dan türeyen virüsün karakterize edilmesine yardım ettikleri için Kristen Bullard-Feibelman, Milena Veselinovic ve Claudia Rückert&#39;e teşekkür etmek istiyorlar. Bu çalışma, Ulusal Allerji ve Enfeksiyon Hastalıkları Enstitüsü (NIH) tarafından hibe AI114675 (BJG) ve AI067380 (GDE) altındaki hibelerden kısmen desteklenmiştir.

1. Enfeksiyoz klon plasmidlerinin transformasyonu ve geri kazanımı <ol><li> Bazı değişikliklerle birlikte ticari bir dönüştürme protokolü ( örn. , NEB 5 Dakikada Dönüştürme Protokolü) kullanarak her iki plazmayı da (ayrı ayrı) transforme edin. Her iki plazmid ampisilin direncini kodlayan bir gen içerdiğinden, seçim için ampisilin veya karbenisilin kullanın. Karbenisilin daha kararlı olduğu için tercih edilir. <ol><li> -80 ° C derin dondurucudan hücreleri çıkarın (Malzeme Tablosuna bakın) ve buz üzerinde 5-10 dakika eritin. 37 ° C&#39;de, lösojen broy (LB) (10 g / L NaCl ve 25 μg / mL karbenisilin içeren; LB-karben) plakaları ve katabolit baskılanmış suyu (antibiyotik içermeyen SOC) yerleştirin. </li><li> 50 μL yetkili hücre içeren bir tüp içine 1 μL plazmid DNA&#39;sında 100 pg - 10 ng ekleyin; Tüpü hafifçe oynatarak karıştırın. </li><li> Tüpleri 5 dakika boyunca buzda inkübe edin. </li><li> Isı şok tüpleri 42 ° C&#39;de 30 saniyeBir su banyosunda. Isı şokunu takiben hemen buza 2 dakika dönün. </li><li> Her tüpe oda sıcaklığında SOC&#39;yi 950 μL pipetleyin ve pipetleme ile karıştırın. Bakteri karışımının 100 μL&#39;sini bir LB-carb plakasına yayın ve gece boyunca 37 ° C&#39;de (kabaca 12-14 saat) inkübe edin. </li></ol></li><li> 12-14 saat inkübasyondan sonra plakaları 37 ° C inkübatörden çıkarın. Kolonilerin büyümeye devam etmesini sağlamak için plakları oda sıcaklığında koyu renkli bir çekmeceye koyun (kabaca 8-9 saat). </li><li> 5 mL Terrific broth (TB, carbamycillin içeren 25 μg / mL carbenicillin içeren) kullanarak, bakteriyel bir çalkalayıcıda (kabaca 14-16 saat) 30 ° C&#39;de her plazmid için 5-10 küçük koloni oluşturun. NOT: Küçük koloniler plazmitin bozulmamış olduğunun bir göstergesidir; Delesyonlar, düzenlenmeler veya mutasyonlar içeren (burada instabilite olayları olarak da adlandırılan) plazmitlere sahip koloniler daha hızlı büyür ve böylece daha büyük olurlar. Dolayısıyla, plakadaki en küçük kolonileri seçmeye çalışmalı, özellikle de hayırT mevcut en büyük kolonileri seçmek. Tamamlanması için bazı orta boy koloniler de seçilebilir. Kullanılan düşük sıcaklık, hücrelerin aşırı büyümek olasılığını azaltır (OD 600 , 0.6-0.8&#39;den büyük). Çoğu araştırmacı, bir gecede büyüme gerçekleştirdiğinden, daha fazla kontrol ve aşırı büyüme ihtimalini düşürür. </li><li> Sıvı kültürleri bulanıklık açısından kontrol edin (kabaca OD 600 , 0.6-0.8). Herhangi bir bulanık boruyu 4 ° C&#39;ye yerleştirin ve diğer tüplerin daha uzun süre büyüyerek bulanık hale gelmesine izin verin. NOT: Plazmid instabilite olayları oluşabileceği için, bakterileri OD 600 değerlerine göre daha fazla büyütmeyin. </li><li> Plazmid DNA&#39;yı, ticari bir plasmid miniprep kiti ile bakterilerden ayırabilirsiniz (Malzeme Tablosuna bakınız). 15 μL önceden ısıtılmış (bir ısıtma bloğunda 70 ° C&#39;ye kadar) elüsyon tamponu içinde elute edin. Seyreltme tamponunun, santrifüje tabi tutulmadan önce 5 dakika sütun üzerinde inkübe edilmesine izin verin. NOT: Bu başlangıç ​​kültüründen en az 1 mL 4 ° C&#39;de saklanmalıdır.Bir sonraki adımda daha fazla kullanabilirsiniz. </li><li> Plazmid instabilite olaylarının kültür esnasında oluşup oluşmadığını değerlendirmek için geri kazanılmış plazmidlerin 10 uL&#39;ini sindirin. NOT: SalI / NheI ile p2&#39;yi ve BamHI / Hindlll ile p2&#39;yi 37 ° C&#39;de 1 saat boyunca özümleyin. Jel elektroforeziyle sindirim sonrasında doğru bantların varlığını teyit edin ( Şekil 2a ) ve 2. adıma geçin. Yuvarlanan daire amplifikasyonu (RCA) ile plazmid DNA hazırlarken, bazı miniprep eluatın bir şablon görevi için rezerve edin. </li></ol> 2. Bağlama için Yeterli Plazmid DNA&#39;nın Hazırlanması NOT: Bağlama ve sonraki elektroporasyon, maxiprep veya RCA vasıtasıyla üretilmesi gereken yeterli miktarda plazmid DNA&#39;sı gerektirir. Maxiprep, geleneksel olarak kullanılan bir yaklaşım olsa da, RCA, bakterilere ihtiyaç duymamakta ve dolayısıyla istikrarsızlık olaylarına neden olabilecek plazmid kaynaklı toksisite potansiyelini ortadan kaldırmaktadır. <ol><li><stRong&gt; Aşağıdaki maxiprep prosedürünü uygulayın. <ol><li> Önceki bölümde doğru kısıtlama enzimi sindirim modelini gösteren her bir plazmid için 1 L TB-Carb (25 ug / mL karbenisilin) ​​et suyuna 500 mcL marş kültürü ilave edin ve gece boyunca 30 ° C&#39;de çalkalayın (kabaca 14-16 saat , Kabaca OD 600 0.6-0.8). Not: kültürü, bu OD 600 değeri üzerinde büyümesine izin vermeyin. Bu, plasmidler içindeki potansiyel olarak istikrarsızlık olaylarıyla sonuçlanır. </li><li> Bakterileri hasat edin ve üreticinin protokolüne göre maxipreps yapın (Bkz. Malzeme Tablosu). </li></ol></li><li> Adım 1.6&#39;dan kaydedilen miniprep&#39;i kullanarak, RCA yordamı için aşağıdakileri yapın. <ol><li> 1 mcL plazmid DNA&#39;sını 50 uL numune tamponu içeren bir tüp içine aktarın. </li><li> Numuneyi 95 ° C&#39;de 3 dakika boyunca ısıyla denature edin ve sonra kullanıma hazır olana kadar 4 ° C&#39;de inkübe edin. </li><li> Ticari amplifikasyonu hazırlayınPremiks (Bkz. Malzeme Tablosu ). Buz üzerinde ayarlanmış bir tüp içinde 50 uL reaksiyon tamponu ile 2 uL enzim karışımı birleştirin. NOT: Amplifikasyon ön karışımı, kullanıma hazır oluncaya kadar buzda tutulmalıdır. Gerekli sayıda amplifikasyon reaksiyonu için yeterli tepkin maddeleri birleştirerek bir ana karışım hazırlamak uygundur. Kullanılmayan herhangi bir ön karışım atılmalıdır. </li><li> Düzeltilmiş numuneye 50 μL hazırlanmış amplifikasyon ön karışımı aktarın. </li><li> Reaksiyon tüplerini 30 ° C&#39;de 18 saat inkübe edin. </li><li> Ø29 DNA polimerazını devre dışı bırakmak için tüpleri 65 ° C&#39;de 10 dakika inkübe edin. </li><li> Reaksiyon tüplerini kullanıma hazır olana kadar 4 ° C veya -20 ° C&#39;de saklayın. NOT: Bu noktada, her iki yöntemle hazırlanan plazmid DNA&#39;sı (260 nm&#39;de emilim kullanılarak) nicelendirilmelidir ve hazırlama sırasında herhangi bir istikrarsızlık olayı (silme ve yeniden düzenlemeler) oluştuğunu doğrulamak için ZIKV genomu Sanger dizilimi olmalıdır. </li></ol></li></ol><table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Astar Adı </td><td> Sıra (5 &#39;- 3&#39;) </td></tr><tr><td> ZIKV PRVABC59 1For. </td><td> AGTTGTTGATCTGTGTGAATCAGAC </td></tr><tr><td> ZIKV Korunmuş 632For. </td><td> GCCCTATGCTGGATGAGG </td></tr><tr><td> ZIKV Korunmuş 692Rev. </td><td> GGTTCCGTACACAACCCAAGTTG </td></tr><tr><td> ZIKV Conserved 1313Rev. </td><td> CTCCCTTTGCCAAAAAGTCCACA </td></tr><tr><td> ZIKV Conserved 1201For. </td><td> CCAACACAAGGTGAAGCCTAC </td></tr><tr><td> ZIKV Korunan 1663For. </td><td> GCAGACACCGGAACTCCACACT </td></tr><tr><td> ZIKV 2008&#39;de Korundu. </td><td> CAGATGGCGGTGGACATGC </td></tr><tr><td> ZIKV Korunmuş 2350Rev. </td><td> GTGAGAACCAGGACATTCCTCC </td></tr><tr><td> ZIKV Korundu 2605For. </td><td> TACAAGTACCATCCTGACTCCC </td></tr><tr><td> ZIKV Korunan 3499Rev. </td><td>GCCTTATCTCCATTCCATACCA </td></tr><tr><td> ZIKV Korunmuş 3961Rev. </td><td> TTGCCAACCAGGCCAAAG </td></tr><tr><td> ZIKV Korunmuş 4132For. </td><td> CATTTGTCATGGCCCTGG </td></tr><tr><td> ZIKV Conserved 4561Rev. </td><td> CTATTGGGTTCATGCCACAGAT </td></tr><tr><td> ZIKV Korunmuş 4665For. </td><td> GACCACAGATGGAGTGTACAGAGT </td></tr><tr><td> ZIKV Conserved 5189Rev. </td><td> AAGACAGTTAGCTGCTTCTTCTTCAG </td></tr><tr><td> ZIKV Korunmuş 5219For. </td><td> GAGAGTTCTTCCTGAAATAGTCCGTGA </td></tr><tr><td> ZIKV Conserved 6086Rev. </td><td> CTTGCTTCAAGCCAGTGTGC </td></tr><tr><td> ZIKV Korunmuş 6119For. </td><td> GCCTCATAGCCTCGCTCTATCG </td></tr><tr><td> ZIKV Korunmuş 6721Rev. </td><td> CCATTCCAAAGCCCATCTTCCC </td></tr><tr><td> ZIKV Korunmuş 6769For. </td><td> CCAGCCAGAATTGCATGTGTCC </td></tr><tr><td> ZIKV Conserved 7209Rev. </td><td> ATCATTAGCAGCGGGACTCCAA </td></tr><tr><td> ZIKV Korunan 7343For. </td><td> GTTGTGGATGGAATAGTGGT </td></tr><tr><td> ZIKV Korunan 8243For. </td><td> TGCCCATACACCAGCACTATGA </td></tr><tr><td> ZIKV PRVABC59 8893Rev. </td><td> TGCATTGCTACGAACCTTGTTG </td></tr><tr><td> ZIKV korundu 9133For. </td><td> AGCCCTTGGATTCTTGAACGAGGA </td></tr><tr><td> ZIKV PRVABC59 9673Rev. </td><td> AACGCAATCATCTCCACTGACT </td></tr><tr><td> ZIKV Korunmuş 9686For. </td><td> GATGATAGGTTTGCACATGCC </td></tr><tr><td> ZIKV Conserved 10321Rev. </td><td> GTCCATGTACTTTTCTTCATCACCTAT </td></tr><tr><td> ZIKV Korunmuş 10455For. </td><td> CAGGAGAAGCTGGGAAACC </td></tr><tr><td> ZIKV Conserved 10621Rev. </td><td> CAGATTGAAGGGTGGGGAAGGTC </td></tr></tbody></table> Tablo 1: cDNA klonlarının dizilimi için primerler. Plazmidler listelenen primerler ile sıralanabilir. &quot;Korunan&quot; olarak işaretlenmiş astarlarZIKV&#39;in tüm genotiplerini sıralama / yükseltme olasılıklarının yüksek olduğunu belirtin. &quot;PRVABC59&quot; olarak etiketlenen primerler bu suşa özeldir ancak diğer Asya genotip türleri ve muhtemelen diğer genotipler için de çalışabilir. 3. In Vitro Transkripsiyon RNA Hazırlanması <ol><li> Maxiprep veya RCA hazırlanmış DNA&#39;nın sindirim reaksiyonunu ayarlayın. <ol><li> P1 sindirimi için 10 uL 10x reaksiyon tamponu, 3 uL ApaLI, 3 μL BamHI-HF, 3 uL rSAP veya CIP ve 3,3 μg p1 DNA karıştırın. 100 uL&#39;ye ddH20 ilave edin. </li><li> P2 sindirimi için, 10 uL 10x reaksiyon tamponu, 3 uL ApaLI, 3 uL EcoRI-HF ve 13.3 μg p2 DNA&#39;yı karıştırın. 100 uL&#39;ye ddH20 ilave edin. </li><li> 1-2 saat boyunca 37 ° C&#39;de inkübe edin. </li><li> Ticari bir jel ve PCR temizleme seti kullanarak arındırın (Malzeme Tablosuna bakın). Isıtma bloğunda 70 ° C&#39;ye önceden ısıtılmış 30 uL elüsyon tamponu içinde elute edin (inkübe edinSütun 5 dak.). NOT: Daha sonra bir jel üzerinde çalışmak için 1 uL tutun. </li></ol></li><li> Ligasyon reaksiyonu hazırlayın. <ol><li> 10 uL 10x T4 DNA ligasyon reaksiyon tamponu, 3 μL T4 DNA ligaz (400 U / μL), saflaştırılmış p1 29 uL ve 29 μL saflaştırılmış p2&#39;yi birleştirin. 100 uL&#39;ye ddH20 ilave edin. </li><li> Oda sıcaklığında 2 saat veya gece boyunca 16 ° C&#39;de inkübe edin. </li><li> Ticari bir jel ve PCR temizleme seti kullanarak arındırın (Malzeme Tablosuna bakın). Isıtma bloğunda 70 ° C&#39;ye önceden ısıtılmış 10 uL elüsyon tamponunda elute edin (eğrilmeden önce 5 dakika kuluçka sütunu). NOT: Daha sonra bir jel üzerinde çalışmak için 1 uL tutun. </li></ol></li><li> Sindirilmemiş plasmidleri, sindirilmiş plasmidleri ve bir agaroz jelinde bağlayın. Ligasyon ürününün, ligasyonun başarılı olduğunu gösteren tek başına sindirilmiş plazmitten daha yüksek bir moleküler ağırlık bandına (yaklaşık 11 kb) sahip olması gerekir ( Şekil 2b ).</li><li> T7 in vitro transkripsiyon reaksiyonu oluşturun. <ol><li> 10 uL 2x ARCA / NTP Mix, 2 μL T7 RNA polimeraz karışımı ve 8 μL saf ligasyon reaksiyonu ile 20 uL son bir hacim birleştirin. NOT: Karışıma dahil edilen ARCA, yalnızca doğru yönlendirmeyle birleştirilen bir kap analogudur. Standart kap analogları, transkriptlerin yalnızca ~% 50&#39;sinde doğru oryantasyonda bir başlık oluşturabilir. </li><li> 37 ° C&#39;de 4 saat inkübe edin. </li><li> Bir UV spektrofotometre yardımıyla RNA konsantrasyonunu ölçün. İsteğe bağlı olarak, RNA transkriptinin uzunluğunu teyit etmek için bir denatüre edici agaroz jeli çalıştırın. </li></ol></li></ol> 4. Elektroporasyon ile Bulaşıcı Virüs Kurtarma <ol><li> Elektroporasyondan önceki günlerde, kurtarılacak olan yapı başına 1 T182 şişesiVero hücresi (T150 ile T182 arasında kabul edilebilir; DMEM +% 10 Fetal sığır serumu (FBS) içinde yetiştirilir) hazırlayın. Sahte bir transfeksiyon kontrolü olarak 1 T182&#39;yi ekleyin. CeLl% 70-80 konfluende kullanılmalıdır. </li><li> Hücreler hazır olduğunda, 12 mL / DMEM reaksiyonu +% 15 FBS + 10 mM HEPES&#39;i 37 ° C&#39;ye kadar ısıtılan su banyosuna yerleştirin. </li><li> Standart bir protokol ile tripsinizasyon ile hücreleri ayırın ve tripsin inaktive etmek için% 10 FBS ile ortamda hücreleri kurtarmak; 4 ° C&#39;de 5 dakika 150 x g&#39;de santrifüj hücreleri. </li><li> 1 x fosfat tamponlu salin (PBS), hücreleri pelet hücreleri 150 xg&#39;de 5 dakika 4 ° C&#39;de yıkayın. Bu adımı toplam üç yıkama için iki kere tekrarlayın. </li><li> Örneklerin sayısı başına 200 mcL RPMI 1640 + 10 mM HEPES (steril) hücreleri tekrar süspansiyon haline getirin. Steril bir tüpe 200 uL hücre süspansiyonu aktarın. Hücreler ~ 0.5 x 107 hücre / mL olmalıdır. </li><li> Adım 3.4&#39;te üretilen 20 μL su (sahte negatif kontrol) veya 20 μL RNA (tercihen 5-10 μg) hücrelerin her setine ekleyin. Tüpü hafifçe oynatarak karıştırın ve tüpün içeriğini 2 mm&#39;lik boşluk elektroporasyon küvetine aktarın. </li><li> Elektrarı ayarlaOporator 170 V LV, omega (direnç) 0 ve 950 μF&#39;de (kabaca 625 V / cm ve diğer makineler için 20 ms zaman sabiti). Mümkün olan en düşük mevcut ayara direnç ayarlayın, varsa 0 veya ∞. </li><li> Pulse bir kez ve hemen adım 4.2&#39;de ısıtılmış DMEM +% 15 FBS + 10 mM HEPES 600 mcL ekleyin. Tüm hücreleri çıkarmak için küvetin içine iyice yıkayın. 10 mL önceden ısıtılmış ortam içeren bir T75 doku kültürü şişesine hücreler ekleyin. Küvette bulunan damlalık kullanarak ilave ortamı küvetlerden çıkarın. Steriliyeti korumaya dikkat edin. </li><li> Ortamı ve hücreleri karıştırmak için 37 ° C inkübatöre yerleştirilen Swirl şişesi. </li><li> Ertesi gün hücre canlılığı olup olmadığını kontrol edin ve her gün bunu% 50-75 hücre ölümüne kadar bekleyin. Alınan elektroporasyonlu kontrol ile karşılaştırıldığında hücre ölümü gözlemlenir. NOT: Vero hücrelerinde ZIKV sitopatik etki (CPE) oldukça belirgindir ve kültür ortamında yüzen hücreleri parçalayıp yuvarlatır. SahibizHasat için ideal olarak 8-10 gün aralığı gözlemledi. </li><li> Konik bir tüp içinde süpernatantı hasat edin ve 4 ° C&#39;de 10 dakika süreyle&gt; 3000 xg&#39;deki hücre döküntülerini gidermek için santrifüjleyin. </li><li> Berraklaştırılmış süpernatanı yeni bir tüple ve% 20 FBS son konsantrasyonuyla takviye edin (% 100 stoktan). Ayrıca, dondurulmuş haldeyken (1 M steril bir stoktan) virüs enfeksiyonunu korumak için bir tamponlayıcı madde olarak 10 mM&#39;lik nihai konsantrasyonda steril HEPES ekleyin. </li><li> Vorteks ve alikot ile vidalı kap şişelerine karıştırın. Gelecekteki kullanım için -80 ° C&#39;de saklayın. </li></ol> 5. Kurtarılan Virüsün Titrasyonu <ol><li> Titrasyonun yapılmasından bir gün önce Vero hücrelerinin uygun sayıdaki 6- veya 12 oyuklu plakalarını tohumlayın. </li><li> Virüsü dondurucudan çıkarın ve tüplerde veya 96 oyuklu plakalarda DMEM +% 2 FBS içinde seri 10 kat dilüsyonlar yapın. NOT: Kurtarılan klonlardan beklenen titre 1 x 10 6 ile 5 x 10 7 PFU / mL arasındadır. </li><li> 200 o ekleSırasıyla bir 12 veya 6 oyuklu plakanın bir çukuruna çiftli olarak her bir seyreltmenin 400 uL&#39;lik bir miktarı. </li><li> 37 ° C inkübatörde plakalar koyun ve her 15 dakikada bir, ~ 1-1.5 saatlik adsorpsiyon periyodu boyunca kaya yerleştirin. </li><li> Viral inokülumu çıkarın ve her göze 1 mL (12-kuyucuklu) veya 2 mL (6-kuyucuklu) DMEM-Tragacanth kaplama ekleyin. NOT: Buraya agaroz, agar, metilselüloz veya diğer kaplama malzemeleri kullanmak mümkündür. </li><li> 5 gün boyunca 37 ° C inkübatöre hücreleri inkübe edin. Uygun plak oluşumunun süresi, kullanılan kaplamaya bağlı olarak değişir. </li><li> Hücreleri düzeltmek için, plakaları inkübatörden çıkarın ve dezenfektana hafifçe dökün. </li><li> Kaplamak ve karıştırmak için girdap yapmak için her oyuğa yeterli% 20 etanol /% 0.1 kristal mor (CV) ekleyin. NOT: Birçok başka fiksatif var ve burada kullanılabilir. Buna ek olarak, bir agaroz veya agar kaplaması kullanılıyorsa, sabitlemesiz plakları görselleştirmek için nötr kırmızı ile birlikte ikinci bir kaplama kullanılabilir. % 20 etanol var olduğu gösterildiÖnceki çalışmalarda zarflı virüslerin inaktivasyonunda etkili; Zarflanmamış virüsler için bu miktarı kullanmayın, aksi halde devre dışı bırakılmaz 19 . </li><li> Plakaları oda sıcaklığında 30-60 dakika inkübe edin (sınıf II biyogüvenlik kabininde); CV&#39;yi atın (yerel yönetmeliklere göre) ve musluk suyuyla yıkayın. </li><li> Plakaların kurumasına izin verin ve plakları manuel olarak sayın. NOT: Referans 20, plak tahlilleri yapmak için ek bir referans olarak kullanılabilir. </li></ol>

<ol>
	<li>Kindhauser, M. K., Allen, T., Frank, V., Santhana, R. S., Dye, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika:+the+origin+and+spread+of+a+mosquito-borne+virus.">Zika: the origin and spread of a mosquito-borne virus.</a> Bull World Health Organ. 94 (9), 675C-686C (2016).</li><li>Oehler, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika+virus+infection+complicated+by+Guillain-Barre+syndrome--case+report,+French+Polynesia,+December+2013.">Zika virus infection complicated by Guillain-Barre syndrome--case report, French Polynesia, December 2013.</a> Euro Surveill. 19 (9), (2014).</li><li>Li, D., Aaskov, J., Lott, W. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+cryptic+prokaryotic+promoter+within+the+cDNA+encoding+the+5'+end+of+dengue+virus+RNA+genome.">Identification of a cryptic prokaryotic promoter within the cDNA encoding the 5' end of dengue virus RNA genome.</a> PLoS One. 6 (3), e18197 (2011).</li><li>Pu, S. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+approach+to+propagate+flavivirus+infectious+cDNA+clones+in+bacteria+by+introducing+tandem+repeat+sequences+upstream+of+virus+genome.">A novel approach to propagate flavivirus infectious cDNA clones in bacteria by introducing tandem repeat sequences upstream of virus genome.</a> J Gen Virol. 95 (Pt 7), 1493-1503 (2014).</li><li>Pu, S. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Successful+propagation+of+flavivirus+infectious+cDNAs+by+a+novel+method+to+reduce+the+cryptic+bacterial+promoter+activity+of+virus+genomes.">Successful propagation of flavivirus infectious cDNAs by a novel method to reduce the cryptic bacterial promoter activity of virus genomes.</a> J Virol. 85 (6), 2927-2941 (2011).</li><li>Rice, C. M., Grakoui, A., Galler, R., Chambers, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+of+infectious+yellow+fever+RNA+from+full-length+cDNA+templates+produced+by+in+vitro+ligation.">Transcription of infectious yellow fever RNA from full-length cDNA templates produced by in vitro ligation.</a> New Biol. 1 (3), 285-296 (1989).</li><li>Yun, S. I., Kim, S. Y., Rice, C. M., Lee, Y. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+application+of+a+reverse+genetics+system+for+Japanese+encephalitis+virus.">Development and application of a reverse genetics system for Japanese encephalitis virus.</a> J Virol. 77 (11), 6450-6465 (2003).</li><li>Gualano, R. C., Pryor, M. J., Cauchi, M. R., Wright, P. J., Davidson, A. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+major+determinant+of+mouse+neurovirulence+of+dengue+virus+type+2+using+stably+cloned+genomic-length+cDNA.">Identification of a major determinant of mouse neurovirulence of dengue virus type 2 using stably cloned genomic-length cDNA.</a> J Gen Virol. 79 (Pt 3), 437-446 (1998).</li><li>Johansen, I. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intron+insertion+facilitates+amplification+of+cloned+virus+cDNA+in+Escherichia+coli+while+biological+activity+is+reestablished+after+transcription+in+vivo.">Intron insertion facilitates amplification of cloned virus cDNA in Escherichia coli while biological activity is reestablished after transcription in vivo.</a> Proc Natl Acad Sci U S A. 93 (22), 12400-12405 (1996).</li><li>Shan, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Infectious+cDNA+Clone+of+Zika+Virus+to+Study+Viral+Virulence,+Mosquito+Transmission,+and+Antiviral+Inhibitors.">An Infectious cDNA Clone of Zika Virus to Study Viral Virulence, Mosquito Transmission, and Antiviral Inhibitors.</a> Cell Host Microbe. 19 (6), 891-900 (2016).</li><li>Schwarz, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rescue+of+the+1947+Zika+Virus+Prototype+Strain+with+a+Cytomegalovirus+Promoter-Driven+cDNA+Clone.">Rescue of the 1947 Zika Virus Prototype Strain with a Cytomegalovirus Promoter-Driven cDNA Clone.</a> mSphere. 1 (5), (2016).</li><li>Tsetsarkin, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Full-Length+Infectious+cDNA+Clone+of+Zika+Virus+from+the+2015+Epidemic+in+Brazil+as+a+Genetic+Platform+for+Studies+of+Virus-Host+Interactions+and+Vaccine+Development.">A Full-Length Infectious cDNA Clone of Zika Virus from the 2015 Epidemic in Brazil as a Genetic Platform for Studies of Virus-Host Interactions and Vaccine Development.</a> MBio. 7 (4), (2016).</li><li>Gadea, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+robust+method+for+the+rapid+generation+of+recombinant+Zika+virus+expressing+the+GFP+reporter+gene.">A robust method for the rapid generation of recombinant Zika virus expressing the GFP reporter gene.</a> Virology. 497, 157-162 (2016).</li><li>Kapoor, M., Zhang, L., Mohan, P. M., Padmanabhan, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+and+characterization+of+an+infectious+dengue+virus+type-2+RNA+genome+(New+Guinea+C+strain).">Synthesis and characterization of an infectious dengue virus type-2 RNA genome (New Guinea C strain).</a> Gene. 162 (2), 175-180 (1995).</li><li>Messer, W. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+characterization+of+a+reverse+genetic+system+for+studying+dengue+virus+serotype+3+strain+variation+and+neutralization.">Development and characterization of a reverse genetic system for studying dengue virus serotype 3 strain variation and neutralization.</a> PLoS Negl Trop Dis. 6 (2), e1486 (2012).</li><li>Kinney, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avian+virulence+and+thermostable+replication+of+the+North+American+strain+of+West+Nile+virus.">Avian virulence and thermostable replication of the North American strain of West Nile virus.</a> J Gen Virol. 87 (Pt 12), 3611-3622 (2006).</li><li>Chang, A. C., Cohen, S. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+amplifiable+multicopy+DNA+cloning+vehicles+derived+from+the+P15A+cryptic+miniplasmid.">Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid.</a> J Bacteriol. 134 (3), 1141-1156 (1978).</li><li>Weger-Lucarelli, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+Characterization+of+Recombinant+Virus+Generated+from+a+New+World+Zika+Virus+Infectious+Clone.">Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone.</a> J Virol. 91 (1), (2017).</li><li>Roberts, P. L., Lloyd, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus+inactivation+by+protein+denaturants+used+in+affinity+chromatography.">Virus inactivation by protein denaturants used in affinity chromatography.</a> Biologicals. 35 (4), 343-347 (2007).</li><li>Baer, A., Kehn-Hall, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+concentration+determination+through+plaque+assays:+using+traditional+and+novel+overlay+systems.">Viral concentration determination through plaque assays: using traditional and novel overlay systems.</a> J Vis Exp. (93), e52065 (2014).</li><li>Weger-Lucarelli, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+Characterization+of+Recombinant+Virus+Generated+from+a+New+World+Zika+Virus+Infectious+Clone.">Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone.</a> J Virol. , (2016).</li><li>Grubaugh, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+Drift+during+Systemic+Arbovirus+Infection+of+Mosquito+Vectors+Leads+to+Decreased+Relative+Fitness+during+Host+Switching.">Genetic Drift during Systemic Arbovirus Infection of Mosquito Vectors Leads to Decreased Relative Fitness during Host Switching.</a> Cell Host Microbe. 19 (4), 481-492 (2016).</li></ol>

Yazarların açıklayacak bir şeyi yok.

Here we describe a method for the recovery of a bipartite infectious cDNA clone system for ZIKV. Previously described clones for ZIKV suffer from either attenuation or require the addition of introns, making plasmids larger and preventing rescue in insect cells. Infectious virus can be recovered using the two-plasmid clone system in either mammalian or insect cells (data not shown). In addition, virus recovered from this system behaves similarly to wild-type virus in several cell lines, in an immunocompromised mouse mode...

Zika virüsü (ZIKV; Aile Flaviviridae : Genus Flavivirus ), 2013-14 yılları arasında Brezilya&#39;ya gelen sivrisinek taşıyan bir flavivirüs olup, daha sonra Amerika Birleşik Devletleri&#39;nde yaygınlaşan ateşli bir hastalık patlamasıyla ilişkilendirilmiştir 1 . Buna ek olarak, ZIKV, yetişkinlerde Guillain-Barré sendromu ve fetüsler ve yenidoğanlarda mikrocefali gibi ağır hastalık sonuçlarıyla bağlantılıdır2. Batı yarımkürede hızla yayılmadan önce ZIKV hakkında pek az şey biliniyordu. Bu, moleküler araçların eksikliğini içeriyordu, bu yüzden mekanistik araştırmayı engelledi. Bulaşıcı cDNA klonları gibi virüsler için moleküler araçlar aşı ve antiviral terapötik gelişmeyi kolaylaştırır ve farklı viral patogenez, bağışıklık yanıtı ve viral evrim ile ilgili viral genetik faktörlerin değerlendirilmesine izin verir. Flavivirüs bulaşıcı klonların bakterilerde cr nedeniyle oldukça kararsız olduğu bilinmektedirGenomlarında bulunan yptik prokaryotik hızlandırıcılar 3 . Bu sorunu hafifletmek için çeşitli yaklaşımlar kullanılmıştır; Virütik dizilerin 4 üst akışında tandem tekrarların yerleştirilmesi, varsayılan prokaryotik promoter dizilerinin 5 mutasyonu, genomun birden çok plazmid 6&#39;ya bölünmesi, düşük kopya sayı vektörleri (bakteri yapay kromozomlar dahil) 7,8 ve viral genomda intronların sokulması da dahil olmak üzere 9 . ZIKV için modifikasyonsuz bir tam uzunluklu sistem tanımlanmıştır; Bununla birlikte, bu klonun hücre kültüründe ve farelerde zayıfladığı görülmüştür. Diğer gruplar ZIKV genomuna intronlar tasarladılar ve in vitro memeliler hücrelerinde enfeksiyöz virüsün üretilmesi için eklenebilen bakterilerdeki istikrarsız dizilerin bozulmasına izin verdi 11, 12 . Ek olarak, ZIKV 13&#39;ün prototip MR766 suşunu kurtarmak için İnfeksiyöz-Subgenomik-Amplikon başlıklı bir PCR tabanlı sistem başarıyla kullanılmıştır. Burada açıklanan yaklaşım, yabancı sekanslara ihtiyaç duymamakta, daha önce sarı humma 6 , dang 14 , 15 ve Batı Nil virüsleri 16 ile başarıyla kullanılan çok sayıda plazmid kullanarak yüksek instabilite bölgesinde genomu bozmaktadır. Dahası, viral genomik uçtaki hepatit D ribozim dizisinin eklenmesi, bir doğrusallaştırma bölgesi eklenmesine gerek kalmadan otantik bir 3 &#39;ucunun oluşturulmasını kolaylaştırır. Buna ek olarak, her iki plazmid, herhangi bir artık toksisite 17 azaltmak için düşük kopya sayısı vektör (pACYC177, hücre başına ~ 15 kopya) inşa edilmiştir. Geri kazanılan virüs,Hem anne hem de böceklerden türeyen çeşitli hücre tiplerini içeren 8 hücre hattındaki in vitro büyüme eğrilerinde ebeveyn virüs bulaştırdı ve farelerde aynı patojenik profilleri, sivrisineklerde enfeksiyon, yayılım ve iletim oranlarını sergiledi. Burada, bulaşıcı klon plasmidlerin büyümesini , in vitro olarak tam uzunlukta viral RNA (viral genom) üretmek ve hücre kültüründe bulaşıcı virüsün nasıl toplanacağını açıklayan bir protokol açıklanmaktadır. İlk olarak bakterilerdeki plazmidlerin çoğalmasını veya yuvarlanan daire amplifikasyonunu (RCA) kullanarak bakteri içermeyen amplifikasyonunu anlatacağız. Sonra, iki plazmitin nasıl sindirildiğini ve ardından tam uzunlukta virüs üretmek için birlikte bağlandığını gösteriyoruz. Son olarak, transkripsiyon RNA üretimini ve daha sonra Vero hücrelerine elektroporasyonunu, ardından geri kazanılan virüs titrasyonunu tarif ediyoruz ( Şekil 1 ). Açıklanan yaklaşım hızlıdır,Enfeksiyonlu virüs stoklarının 1-2 hafta içinde toparlanması.

<table><tbody><tr><td>NEB Stable CompetentE. coli</td><td>New England BioLabs</td><td>C3040H</td><td></td></tr><tr><td>Carbenicillin, Disodium Salt</td><td>various</td><td></td><td></td></tr><tr><td>Zyppy Plasmid Miniprep Kit</td><td>Zymo Research</td><td>D4036</td><td></td></tr><tr><td>ZymoPURE Plasmid Maxiprep Kit</td><td>Zymo Research</td><td>D4202</td><td></td></tr><tr><td>SalI-HF</td><td>New England BioLabs</td><td>R3138S</td><td>20,000 units/ml</td></tr><tr><td>NheI-HF</td><td>New England BioLabs</td><td>R3131S</td><td>20,000 units/ml</td></tr><tr><td>ApaLI</td><td>New England BioLabs</td><td>R0507S</td><td>10,000 units/ml</td></tr><tr><td>EcoRI-HF</td><td>New England BioLabs</td><td>R3101S</td><td>20,000 units/ml</td></tr><tr><td>BamHI-HF</td><td>New England BioLabs</td><td>R3136S</td><td>20,000 units/ml</td></tr><tr><td>HindIII-HF</td><td>New England BioLabs</td><td>R3104S</td><td>20,000 units/ml</td></tr><tr><td>illustra TempliPhi 100 Amplification Kit</td><td>GE Healthcare Life Sciences</td><td>25640010</td><td></td></tr><tr><td>NucleoSpin Gel and PCR Clean-up</td><td>Macherey-Nagel</td><td>740609.5</td><td></td></tr><tr><td>Shrimp Alkaline Phosphatase (rSAP)</td><td>New England BioLabs</td><td>M0371S</td><td>1,000 units/ml</td></tr><tr><td>Alkaline Phosphatase, Calf Intestinal (CIP)</td><td>New England BioLabs</td><td>M0290S</td><td>10,000 units/ml</td></tr><tr><td>T4 DNA Ligase</td><td>New England BioLabs</td><td>M0202S</td><td>400,000units/mL</td></tr><tr><td>HiScribe T7 ARCA mRNA Kit</td><td>New England BioLabs</td><td>E2065S</td><td></td></tr><tr><td>Vero cells</td><td>ATCC</td><td>CCL-81</td><td></td></tr><tr><td>ECM 630 High Throughput Electroporation System</td><td>BTX</td><td>45-0423</td><td>Other machines are acceptable.</td></tr><tr><td>LB Broth with agar (Miller)</td><td>Sigma</td><td>L3147</td><td>Can be homemade as well.</td></tr><tr><td>Terrific Broth</td><td>Sigma</td><td>T0918</td><td>Can be homemade as well.</td></tr><tr><td>Petri Dish</td><td>Celltreat</td><td>229693</td><td></td></tr><tr><td>Culture Tubes</td><td>VWR International</td><td>60818-576</td><td></td></tr><tr><td>T75 flasks</td><td>Celltreat</td><td>229340</td><td></td></tr><tr><td>T182 flasks</td><td>Celltreat</td><td>229350</td><td></td></tr><tr><td>1x PBS</td><td>Corning</td><td>21-040-CV</td><td></td></tr><tr><td>RPMI 1640 with L-glutamine</td><td>Corning</td><td>10-040-CV</td><td></td></tr><tr><td>DMEM with L-glutamine and 4.5 g/L glucose</td><td>Corning</td><td>10-017-CV</td><td></td></tr><tr><td>Fetal Bovine Serum (FBS)</td><td>Atlas Biologicals</td><td>FP-0500-A</td><td></td></tr><tr><td>Tragacanth Powder</td><td>MP Bio</td><td>MP 104792</td><td></td></tr><tr><td>Crystal Violet</td><td>Amresco</td><td>0528-1006</td><td></td></tr><tr><td>Ethanol Denatured</td><td>VWR International</td><td>BDH1156-1LP</td><td></td></tr><tr><td>6 well plate</td><td>Celltreat</td><td>229106</td><td></td></tr><tr><td>12 well plate</td><td>Celltreat</td><td>229111</td><td></td></tr><tr><td>Sequencing Oligos</td><td>IDT</td><td>see table 1</td><td></td></tr><tr><td>Qubit 3.0</td><td>ThermoFisher</td><td>Qubit 3.0</td><td>other methods are acceptable.</td></tr><tr><td>Qubit dsDNA BR Assay Kit</td><td>ThermoFisher</td><td>Q32850</td><td>other methods are acceptable.</td></tr><tr><td>Qubit RNA HS Assay Kit</td><td>ThermoFisher</td><td>Q32852</td><td>other methods are acceptable.</td></tr><tr><td>Class II Biosafety Cabinet</td><td>Varies</td><td>N/A</td><td>This is necessary for live-virus work.</td></tr></tbody></table>

rescue and characterization of recombinant virus from a new world zika virus infectious clone

Enfeksiyöz cDNA klonları bir virüsün genetik manipülasyonuna izin verir, böylece aşılar üzerinde çalışma, patogenez, replikasyon, bulaşma ve viral evrimi kolaylaştırır. Burada Zika virüsü (ZIKV) için şu anda Amerika&#39;da patlayıcı bir salgına neden olan bulaşıcı bir klonun yapımını anlatıyoruz. Flavivirüs kaynaklı plazmidlerle sıkça görülen bakterilere toksisiteyi önlemek için genomu NS1 geninde ayıran ve mutasyonsuz başarıyla kurtarılamayan tam uzunluktaki yapılardan daha kararlı olan iki plazmid sistemi ürettik. İki parçaya katılmak için sindirim ve ligasyondan sonra, T7 RNA polimeraz ile in vitro transkripsiyon ile tam uzunluktaki viral RNA üretilebilir. Transkribe RNA&#39;nın hücrelere elektroporasyonundan sonra sırasıyla farelerde ve sivrisineklerde benzer in vitro büyüme kinetikleri ve in vivo virülans ve enfeksiyon fenotiplerini sergileyen virüs bulunmuştur.

Burada açıklanan protokol, bulaşıcı klon türevi Zika virüsünün iyileşmesine izin verir. İki plazmid bulaşıcı klon sisteminin manipülasyonu, son derece dengesiz olan tam uzunluktaki versiyonlara kıyasla (bakınız veriler gösterilmemiştir), özen gösterildiğinde açıktır. Sindirimden ve iki ayrı parçanın bağlanmasından sonra, T7 polimeraz ile in vitro transkripsiyon kullanılarak kapaklı RNA üretilir ve daha sonra Vero hücrelerine elektroporasyon yap...

Watch this Scientific Journal Video about Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone at JoVE.com

Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Bu protokol, iki-plazmid bulaşıcı bir cDNA klonundan bulaşıcı Zika virüsünün iyileşmesini tanımlıyor.

Yeni Bir Dünyadan Rekombinant Virüsün Kurtarılması ve Karakterizasyonu Zika Virüsü Bulaşıcı Klon

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral ...

rescue-characterization-recombinant-virus-from-new-world-zika-virus

Research

JoVE Journal

Immunology and Infection

9.7K Görüntüleme.  Colorado State University.  Bu protokol, iki-plazmid bulaşıcı bir cDNA klonundan bulaşıcı Zika virüsünün iyileşmesini tanımlıyor. 

Video: Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Generation of Recombinant Influenza Virus from Plasmid DNA

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally established in 1999 1,2 plasmid-based reverse genetic techniques to generate recombinant viruses have revolutionized the influenza research field because specific questions have been answered by genetically engineered, infectious, recombinant influenza viruses. Such studies include virus replication, function of viral proteins, the contribution of specific mutations in viral proteins in viral replication and/or pathogenesis and, also, viral vectors using recombinant influenza viruses expressing foreign proteins 3.

Rescue of influenza A viruses from plasmid DNA is a basic and essential experimental technique that allows influenza researchers to generate recombinant viruses to study multiple aspects in the biology of influenza virus, and to be used as potential vectors or vaccines.

Plazmid DNA Rekombinant Grip Virüsü Üretimi

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally ...

İmmünoloji ve Enfeksiyon

Generation of Recombinant Arenavirus for Vaccine Development in FDA-Approved Vero Cells

The development and implementation of arenavirus reverse genetics represents a significant breakthrough in the arenavirus field 4. The use of cell-based arenavirus minigenome systems together with the ability to generate recombinant infectious arenaviruses with predetermined mutations in their genomes has facilitated the investigation of the contribution of viral determinants to the different steps of the arenavirus life cycle, as well as virus-host interactions and mechanisms of arenavirus pathogenesis 1, 3, 11 . In addition, the development of trisegmented arenaviruses has permitted the use of the arenavirus genome to express additional foreign genes of interest, thus opening the possibility of arenavirus-based vaccine vector applications 5 . Likewise, the development of single-cycle infectious arenaviruses capable of expressing reporter genes provides a new experimental tool to improve the safety of research involving highly pathogenic human arenaviruses 16 . The generation of recombinant arenaviruses using plasmid-based reverse genetics techniques has so far relied on the use of rodent cell lines 7,19 , which poses some barriers for the development of Food and Drug Administration (FDA)-licensed vaccine or vaccine vectors. To overcome this obstacle, we describe here the efficient generation of recombinant arenaviruses in FDA-approved Vero cells.

Rescue of recombinant arenaviruses from cloned cDNAs, an approach referred to as reverse genetics, allows researchers to investigate the role of specific viral gene products, as well as the contribution of their different specific domains and residues, to many different aspects of the biology of arenavirus. Likewise, reverse genetics techniques in FDA-approved cell lines (Vero) for vaccine development provides novel possibilities for the generation of effective and safe vaccines to combat human pathogenic arenaviruses.

FDA onaylı Vero hücrelerinde Aşı Geliştirme için bir araya getiren Arenavirus üretimi

The development and implementation of arenavirus reverse genetics represents a significant breakthrough in the arenavirus field  4. The use of cell-based ...

Zika Virus Infectious Cell Culture System and the In Vitro Prophylactic Effect of Interferons

Zika Virus (ZIKV) is an emerging pathogen that is linked to fetal developmental abnormalities such as microcephaly, eye defects, and impaired growth. ZIKV is an RNA virus of the Flaviviridae family. ZIKV is mainly transmitted by mosquitoes, but can also be spread by maternal to fetal vertical transmission as well as sexual contact. To date, there are no reliable treatment or vaccine options available to protect those infected by the virus. The development of a reproducible, effective Zika virus infectious cell culture system is critical for studying the molecular mechanisms of ZIKV replication as well as drug and vaccine development. In this regard, a protocol describing a mammalian cell-based in vitro Zika virus culture system for viral production and growth analysis is reported here. Details on the formation of plaques by Zika virus on a cell monolayer and plaque assay for measuring viral titer are presented. Viral genome replication kinetics and double-stranded RNA genome replicatory intermediates are determined. This culture platform was utilized to screen against a library of a small set of cytokines resulting in the identification of interferon-&#945; (IFN-&#945;), IFN-&#946; and IFN-&#947; as potent inhibitors of Zika viral growth. In summary, an in vitro infectious Zika viral culture system and various virological assays are demonstrated in this study, which has the potential to greatly benefit the research community in elucidating further the mechanisms of viral pathogenesis and the evolution of viral virulence. Antiviral IFN-alpha can further be evaluated as a prophylactic, post-exposure prophylactic, and treatment option for Zika virus infections in high-risk populations, including infected pregnant women.

Zika Virus Infectious Cell Culture System and the In Vitro Prophylactic Effect of Interferons

Zika Virus (ZIKV), an emerging pathogen, is linked to fetal developmental abnormalities and microcephaly. The establishment of an effective infectious cell culture system is crucial for studies of ZIKV replication as well as vaccine and drug development. In this study, various virological assays pertaining to ZIKV are illustrated and discussed.

Zika Virüs Bulaşıcı hücre kültürü sistemine ve<em&gt; İn Vitro</emİnterferonların&gt; profilaktik etkisi

Zika Virus (ZIKV) is an emerging pathogen that is linked to fetal developmental abnormalities such as microcephaly, eye defects, and impaired growth. ZIKV ...

Evaluation of Zika Virus-specific T-cell Responses in Immunoprivileged Organs of Infected Ifnar1-/- Mice

The Zika virus (ZIKV) can induce inflammation in immunoprivileged organs (e.g., the brain and testis), leading to the Guillain-Barr&#233; syndrome and damaging the testes. During an infection with the ZIKV, immune cells have been shown to infiltrate into the tissues. However, the cellular mechanisms that define the protection and/or immunopathogenesis of these immune cells during a ZIKV infection are still largely unknown. Herein, we describe methods to evaluate the virus-specific T-cell functionality in these immunoprivileged organs of ZIKV-infected mice. These methods include a) a ZIKV infection and vaccine inoculation in Ifnar1-/- mice; b) histopathology, immunofluorescence, and immunohistochemistry assays to detect the virus infection and inflammation in the brain, testes, and spleen; c) the preparation of a tetramer of ZIKV-derived T-cell epitopes; d) the detection of ZIKV-specific T cells in the monocytes isolated from the brain, testes, and spleen. Using these approaches, it is possible to detect the antigen-specific T cells that have infiltrated into the immunoprivileged organs and to evaluate the functions of these T cells during the infection: potential immune protection via virus clearance and/or immunopathogenesis to exacerbate the inflammation. These findings may also help to clarify the contribution of T cells induced by the immunization against ZIKV.

Evaluation of Zika Virus-specific T-cell Responses in Immunoprivileged Organs of Infected Ifnar1-/- Mice

A protocol to evaluate antigen-specific T-cell responses in the immunoprivileged organs of the Ifnar1-/- murine model for the Zika virus (ZIKV) infection is described. This method is pivotal for investigating the cellular mechanisms of the protection and immunopathogenesis of ZIKV vaccines and is also valuable for their efficacy evaluation.

Virüslü Ifnar1- / - farelerin Immunoprivileged organlarında Zika virüs özgü T hücreli yanıt-e doğru değerlendirilmesi

The Zika virus (ZIKV) can induce inflammation in immunoprivileged organs (e.g., the brain and testis), leading to the Guillain-Barr&#233; syndrome and ...

Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells

The recent emergence of the flavivirus Zika and neurological complications, such as Guillain-Barr&#233; syndrome and microcephaly in infants, has brought serious public safety concerns. Among the risk factors, antibody-dependent enhancement (ADE) poses the most significant threat, as the recent re-emergence of the Zika virus (ZIKV) is primarily in areas where the population has been exposed and is in a state of pre-immunity to other closely related flaviviruses, especially dengue virus (DENV). Here, we describe a protocol for quantifying the effect of human serum antibodies against DENV on ZIKV infection in primary human cells or cell lines.

We describe a method to evaluate the effect of pre-existing immunity against dengue virus on the Zika virus infection by using human serum, primary human cells, and infection quantification by quantitative real-time polymerase chain reaction.

Antikor-bağımlı donanýmýn birincil insan hücrelerinde Zika şunun miktar

The recent emergence of the flavivirus Zika and neurological complications, such as Guillain-Barr&#233; syndrome and microcephaly in infants, has brought ...

Establishing Mouse Models for Zika Virus-induced Neurological Disorders Using Intracerebral Injection Strategies: Embryonic, Neonatal, and Adult

The Zika virus (ZIKV) is a flavivirus currently endemic in North, Central, and South America. It is now established that the ZIKV can cause microcephaly and additional brain abnormalities. However, the mechanism underlying the pathogenesis of ZIKV in the developing brain remains unclear. Intracerebral surgical methods are frequently used in neuroscience research to address questions about both normal and abnormal brain development and brain function. This protocol utilizes classical surgical techniques and describes methods that allow one to model ZIKV-associated human neurological disease in the mouse nervous system. While direct brain inoculation does not model the normal mode of virus transmission, the method allows investigators to ask targeted questions concerning the consequence after ZIKV infection of the developing brain. This protocol describes embryonic, neonatal, and adult stages of intraventricular inoculation of ZIKV. Once mastered, this method can become a straightforward and reproducible technique that only takes a few hours to perform.

Here we describe a method for establishing a model of Zika virus-induced microcephaly in mouse. This protocol includes methods for embryonic, neonatal, and adult-stage intracerebral inoculation of the Zika virus.

İntraserebral enjeksiyon stratejileri kullanarak Zika virüs kaynaklı nörolojik bozukluklar için fare modelleri oluşturma: embriyonik, Yenidoğan ve yetişkin

The Zika virus (ZIKV) is a flavivirus currently endemic in North, Central, and South America. It is now established that the ZIKV can cause microcephaly ...

Nörobilim

Rescue of Recombinant Zika Virus from a Bacterial Artificial Chromosome cDNA Clone

The association of Zika virus (ZIKV) infection with neurological complications during the recent worldwide outbreak and the lack of approved vaccines and/or antivirals have underscored the urgent need to develop ZIKV reverse genetic systems to facilitate the study of ZIKV biology and the development of therapeutic and/or prophylactic approaches. However, like with other flaviviruses, the generation of ZIKV full-length infectious cDNA clones has been hampered due to the toxicity of viral sequences during its amplification in bacteria. To overcome this problem, we have developed a nontraditional approach based on the use of bacterial artificial chromosomes (BACs). Using this approach, the full-length cDNA copy of the ZIKV strain Rio Grande do Norte Natal (ZIKV-RGN) is generated from four synthetic DNA fragments and assembled into the single-copy pBeloBAC11 plasmid under the control of the human cytomegalovirus (CMV) immediate-early promoter. The assembled BAC cDNA clone is stable during propagation in bacteria, and infectious recombinant (r)ZIKV is recovered in Vero cells after transfection of the BAC cDNA clone. The protocol described here provides a powerful technique for the generation of infectious clones of flaviviruses, including ZIKV, and other positive-strand RNA viruses, particularly those with large genomes that have stability problems during bacterial&#160;propagation.

The recent epidemic of Zika virus highlights the importance of establishing reverse genetic approaches to develop vaccines and/or therapeutic strategies. Here, we describe the protocol to rescue an infectious recombinant Zika virus from a full-length cDNA clone assembled in a bacterial artificial chromosome under the control of the human cytomegalovirus immediate-early promoter.

Bir bakteriyel yapay kromozom cDNA klon rekombinant Zika virüs kurtarma

The association of Zika virus (ZIKV) infection with neurological complications during the recent worldwide outbreak and the lack of approved vaccines ...

Isolation and Quantification of Zika Virus from Multiple Organs in a Mouse

The methods being presented demonstrate laboratory procedures for the isolation of organs from Zika virus infected animals and the quantification of viral load. The purpose of the procedure is to quantify viral titers in peripheral and CNS areas of the mouse at different time points post infection or under different experimental conditions to identify virologic and immunological factors that regulate Zika virus infection. The organ isolation procedures demonstrated allow for both focus forming assay quantification and quantitative PCR assessment of viral titers. The rapid organ isolation techniques are designed for the preservation of virus titer. Viral titer quantification by focus forming assay allows for the rapid throughput assessment of Zika virus. The benefit of the focus forming assay is the assessment of infectious virus, the limitation of this assay is the potential for organ toxicity reducing the limit of detection. Viral titer assessment is combined with quantitative PCR, and using a recombinant RNA copy control viral genome copy number within the organ is assessed with low limit of detection. Overall these techniques provide an accurate rapid high throughput method for the analysis of Zika viral titers in the periphery and CNS of Zika virus infected animals and can be applied to the assessment of viral titers in the organs of animals infected with most pathogens, including Dengue virus.

The goal of the protocol is to demonstrate the techniques used to investigate viral disease by isolating and quantifying Zika virus, from multiple organs in a mouse following infection.

Farede Birden Fazla Organdan Zika Virüsünün İzolasyon ve Nicelikselleştirilmesi

The methods being presented demonstrate laboratory procedures for the isolation of organs from Zika virus infected animals and the quantification of viral ...

Vector Competence Analyses on Aedes aegypti Mosquitoes using Zika Virus

The procedures presented describe a generalized methodology to infect Aedes aegypti mosquitoes with Zika virus under laboratory conditions to determine the rate of infection, disseminated infection, and potential transmission of the virus in the mosquito population in question. These procedures are widely utilized with various modifications in vector competence evaluations globally. They are important in determining the potential role that a given mosquito (i.e., species, population, individual) may play in the transmission of a given agent.

Vector Competence Analyses on Aedes aegypti Mosquitoes using Zika Virus

The presented protocol can determine the vector competence of Aedes aegypti mosquito populations for a given virus, such as Zika, in a containment setting.

Zika Virüsü Kullanan Aedes aegypti Sivrisineklerinde Vektör Yetkinlik Analizleri

The procedures presented describe a generalized methodology to infect Aedes aegypti mosquitoes with Zika virus under laboratory conditions to determine ...

High-throughput Antiviral Assays to Screen for Inhibitors of Zika Virus Replication

Antiviral drug discovery requires the development of reliable biochemical and cellular assays that can be performed in high-throughput screening (HTS) formats. The flavivirus non-structural (NS) proteins are thought to co-translationally assemble on the endoplasmic reticulum (ER) membranes, forming the replication complex (RC). The NS3 and NS5 are the most studied enzymes of the RC and constitute the main targets for drug development due to their crucial roles in viral genome replication. NS3 protease domain, which requires NS2B as its cofactor, is responsible for the cleavage of the immature viral polyprotein into the mature NS proteins, whereas NS5 RdRp domain is responsible for the RNA replication. Herein, we describe in detail the protocols used in replicon-based screenings and enzymatic assays to test large compound libraries for inhibitors of the Zika virus (ZIKV) replication. Replicons are self-replicating subgenomic systems expressed in mammalian cells, in which the viral structural genes are replaced by a reporter gene. The inhibitory effects of compounds on viral RNA replication can be easily evaluated by measuring the reduction in the reporter protein activity. The replicon-based screenings were performed using a BHK-21 ZIKV replicon cell line expressing Renilla luciferase as a reporter gene. To characterize the specific targets of identified compounds, we established in-vitro fluorescence-based assays for recombinantly expressed NS3 protease and NS5 RdRp. The proteolytic activity of the viral protease was measured by using the fluorogenic peptide substrate Bz-nKRR-AMC, while the NS5 RdRp elongation activity was directly detected by the increase of the fluorescent signal of SYBR Green I during RNA elongation, using the synthetic biotinylated self-priming template 3&#8242;UTR-U30 (5&#39;-biotin-U30-ACUGGAGAUCGAUCUCCAGU-3&#39;).

In this work, we describe the protocols used in replicon-based and viral enzyme-based assays to screen for inhibitors of Zika virus replication in a high-throughput screening format.

Zika Virüs Replikasyonunun inhibitörlerini taramak için yüksek verimli Antiviral Tahliller

Antiviral drug discovery requires the development of reliable biochemical and cellular assays that can be performed in high-throughput screening (HTS) ...

Yeni Bir Dünyadan Rekombinant Virüsün Kurtarılması ve Karakterizasyonu Zika Virüsü Bulaşıcı Klon

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler