Yazarlar Klon&#39;dan türeyen virüsün karakterize edilmesine yardım ettikleri için Kristen Bullard-Feibelman, Milena Veselinovic ve Claudia Rückert&#39;e teşekkür etmek istiyorlar. Bu çalışma, Ulusal Allerji ve Enfeksiyon Hastalıkları Enstitüsü (NIH) tarafından hibe AI114675 (BJG) ve AI067380 (GDE) altındaki hibelerden kısmen desteklenmiştir.

1. Enfeksiyoz klon plasmidlerinin transformasyonu ve geri kazanımı <ol><li> Bazı değişikliklerle birlikte ticari bir dönüştürme protokolü ( örn. , NEB 5 Dakikada Dönüştürme Protokolü) kullanarak her iki plazmayı da (ayrı ayrı) transforme edin. Her iki plazmid ampisilin direncini kodlayan bir gen içerdiğinden, seçim için ampisilin veya karbenisilin kullanın. Karbenisilin daha kararlı olduğu için tercih edilir. <ol><li> -80 ° C derin dondurucudan hücreleri çıkarın (Malzeme Tablosuna bakın) ve buz üzerinde 5-10 dakika eritin. 37 ° C&#39;de, lösojen broy (LB) (10 g / L NaCl ve 25 μg / mL karbenisilin içeren; LB-karben) plakaları ve katabolit baskılanmış suyu (antibiyotik içermeyen SOC) yerleştirin. </li><li> 50 μL yetkili hücre içeren bir tüp içine 1 μL plazmid DNA&#39;sında 100 pg - 10 ng ekleyin; Tüpü hafifçe oynatarak karıştırın. </li><li> Tüpleri 5 dakika boyunca buzda inkübe edin. </li><li> Isı şok tüpleri 42 ° C&#39;de 30 saniyeBir su banyosunda. Isı şokunu takiben hemen buza 2 dakika dönün. </li><li> Her tüpe oda sıcaklığında SOC&#39;yi 950 μL pipetleyin ve pipetleme ile karıştırın. Bakteri karışımının 100 μL&#39;sini bir LB-carb plakasına yayın ve gece boyunca 37 ° C&#39;de (kabaca 12-14 saat) inkübe edin. </li></ol></li><li> 12-14 saat inkübasyondan sonra plakaları 37 ° C inkübatörden çıkarın. Kolonilerin büyümeye devam etmesini sağlamak için plakları oda sıcaklığında koyu renkli bir çekmeceye koyun (kabaca 8-9 saat). </li><li> 5 mL Terrific broth (TB, carbamycillin içeren 25 μg / mL carbenicillin içeren) kullanarak, bakteriyel bir çalkalayıcıda (kabaca 14-16 saat) 30 ° C&#39;de her plazmid için 5-10 küçük koloni oluşturun. NOT: Küçük koloniler plazmitin bozulmamış olduğunun bir göstergesidir; Delesyonlar, düzenlenmeler veya mutasyonlar içeren (burada instabilite olayları olarak da adlandırılan) plazmitlere sahip koloniler daha hızlı büyür ve böylece daha büyük olurlar. Dolayısıyla, plakadaki en küçük kolonileri seçmeye çalışmalı, özellikle de hayırT mevcut en büyük kolonileri seçmek. Tamamlanması için bazı orta boy koloniler de seçilebilir. Kullanılan düşük sıcaklık, hücrelerin aşırı büyümek olasılığını azaltır (OD 600 , 0.6-0.8&#39;den büyük). Çoğu araştırmacı, bir gecede büyüme gerçekleştirdiğinden, daha fazla kontrol ve aşırı büyüme ihtimalini düşürür. </li><li> Sıvı kültürleri bulanıklık açısından kontrol edin (kabaca OD 600 , 0.6-0.8). Herhangi bir bulanık boruyu 4 ° C&#39;ye yerleştirin ve diğer tüplerin daha uzun süre büyüyerek bulanık hale gelmesine izin verin. NOT: Plazmid instabilite olayları oluşabileceği için, bakterileri OD 600 değerlerine göre daha fazla büyütmeyin. </li><li> Plazmid DNA&#39;yı, ticari bir plasmid miniprep kiti ile bakterilerden ayırabilirsiniz (Malzeme Tablosuna bakınız). 15 μL önceden ısıtılmış (bir ısıtma bloğunda 70 ° C&#39;ye kadar) elüsyon tamponu içinde elute edin. Seyreltme tamponunun, santrifüje tabi tutulmadan önce 5 dakika sütun üzerinde inkübe edilmesine izin verin. NOT: Bu başlangıç ​​kültüründen en az 1 mL 4 ° C&#39;de saklanmalıdır.Bir sonraki adımda daha fazla kullanabilirsiniz. </li><li> Plazmid instabilite olaylarının kültür esnasında oluşup oluşmadığını değerlendirmek için geri kazanılmış plazmidlerin 10 uL&#39;ini sindirin. NOT: SalI / NheI ile p2&#39;yi ve BamHI / Hindlll ile p2&#39;yi 37 ° C&#39;de 1 saat boyunca özümleyin. Jel elektroforeziyle sindirim sonrasında doğru bantların varlığını teyit edin ( Şekil 2a ) ve 2. adıma geçin. Yuvarlanan daire amplifikasyonu (RCA) ile plazmid DNA hazırlarken, bazı miniprep eluatın bir şablon görevi için rezerve edin. </li></ol> 2. Bağlama için Yeterli Plazmid DNA&#39;nın Hazırlanması NOT: Bağlama ve sonraki elektroporasyon, maxiprep veya RCA vasıtasıyla üretilmesi gereken yeterli miktarda plazmid DNA&#39;sı gerektirir. Maxiprep, geleneksel olarak kullanılan bir yaklaşım olsa da, RCA, bakterilere ihtiyaç duymamakta ve dolayısıyla istikrarsızlık olaylarına neden olabilecek plazmid kaynaklı toksisite potansiyelini ortadan kaldırmaktadır. <ol><li><stRong&gt; Aşağıdaki maxiprep prosedürünü uygulayın. <ol><li> Önceki bölümde doğru kısıtlama enzimi sindirim modelini gösteren her bir plazmid için 1 L TB-Carb (25 ug / mL karbenisilin) ​​et suyuna 500 mcL marş kültürü ilave edin ve gece boyunca 30 ° C&#39;de çalkalayın (kabaca 14-16 saat , Kabaca OD 600 0.6-0.8). Not: kültürü, bu OD 600 değeri üzerinde büyümesine izin vermeyin. Bu, plasmidler içindeki potansiyel olarak istikrarsızlık olaylarıyla sonuçlanır. </li><li> Bakterileri hasat edin ve üreticinin protokolüne göre maxipreps yapın (Bkz. Malzeme Tablosu). </li></ol></li><li> Adım 1.6&#39;dan kaydedilen miniprep&#39;i kullanarak, RCA yordamı için aşağıdakileri yapın. <ol><li> 1 mcL plazmid DNA&#39;sını 50 uL numune tamponu içeren bir tüp içine aktarın. </li><li> Numuneyi 95 ° C&#39;de 3 dakika boyunca ısıyla denature edin ve sonra kullanıma hazır olana kadar 4 ° C&#39;de inkübe edin. </li><li> Ticari amplifikasyonu hazırlayınPremiks (Bkz. Malzeme Tablosu ). Buz üzerinde ayarlanmış bir tüp içinde 50 uL reaksiyon tamponu ile 2 uL enzim karışımı birleştirin. NOT: Amplifikasyon ön karışımı, kullanıma hazır oluncaya kadar buzda tutulmalıdır. Gerekli sayıda amplifikasyon reaksiyonu için yeterli tepkin maddeleri birleştirerek bir ana karışım hazırlamak uygundur. Kullanılmayan herhangi bir ön karışım atılmalıdır. </li><li> Düzeltilmiş numuneye 50 μL hazırlanmış amplifikasyon ön karışımı aktarın. </li><li> Reaksiyon tüplerini 30 ° C&#39;de 18 saat inkübe edin. </li><li> Ø29 DNA polimerazını devre dışı bırakmak için tüpleri 65 ° C&#39;de 10 dakika inkübe edin. </li><li> Reaksiyon tüplerini kullanıma hazır olana kadar 4 ° C veya -20 ° C&#39;de saklayın. NOT: Bu noktada, her iki yöntemle hazırlanan plazmid DNA&#39;sı (260 nm&#39;de emilim kullanılarak) nicelendirilmelidir ve hazırlama sırasında herhangi bir istikrarsızlık olayı (silme ve yeniden düzenlemeler) oluştuğunu doğrulamak için ZIKV genomu Sanger dizilimi olmalıdır. </li></ol></li></ol><table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Astar Adı </td><td> Sıra (5 &#39;- 3&#39;) </td></tr><tr><td> ZIKV PRVABC59 1For. </td><td> AGTTGTTGATCTGTGTGAATCAGAC </td></tr><tr><td> ZIKV Korunmuş 632For. </td><td> GCCCTATGCTGGATGAGG </td></tr><tr><td> ZIKV Korunmuş 692Rev. </td><td> GGTTCCGTACACAACCCAAGTTG </td></tr><tr><td> ZIKV Conserved 1313Rev. </td><td> CTCCCTTTGCCAAAAAGTCCACA </td></tr><tr><td> ZIKV Conserved 1201For. </td><td> CCAACACAAGGTGAAGCCTAC </td></tr><tr><td> ZIKV Korunan 1663For. </td><td> GCAGACACCGGAACTCCACACT </td></tr><tr><td> ZIKV 2008&#39;de Korundu. </td><td> CAGATGGCGGTGGACATGC </td></tr><tr><td> ZIKV Korunmuş 2350Rev. </td><td> GTGAGAACCAGGACATTCCTCC </td></tr><tr><td> ZIKV Korundu 2605For. </td><td> TACAAGTACCATCCTGACTCCC </td></tr><tr><td> ZIKV Korunan 3499Rev. </td><td>GCCTTATCTCCATTCCATACCA </td></tr><tr><td> ZIKV Korunmuş 3961Rev. </td><td> TTGCCAACCAGGCCAAAG </td></tr><tr><td> ZIKV Korunmuş 4132For. </td><td> CATTTGTCATGGCCCTGG </td></tr><tr><td> ZIKV Conserved 4561Rev. </td><td> CTATTGGGTTCATGCCACAGAT </td></tr><tr><td> ZIKV Korunmuş 4665For. </td><td> GACCACAGATGGAGTGTACAGAGT </td></tr><tr><td> ZIKV Conserved 5189Rev. </td><td> AAGACAGTTAGCTGCTTCTTCTTCAG </td></tr><tr><td> ZIKV Korunmuş 5219For. </td><td> GAGAGTTCTTCCTGAAATAGTCCGTGA </td></tr><tr><td> ZIKV Conserved 6086Rev. </td><td> CTTGCTTCAAGCCAGTGTGC </td></tr><tr><td> ZIKV Korunmuş 6119For. </td><td> GCCTCATAGCCTCGCTCTATCG </td></tr><tr><td> ZIKV Korunmuş 6721Rev. </td><td> CCATTCCAAAGCCCATCTTCCC </td></tr><tr><td> ZIKV Korunmuş 6769For. </td><td> CCAGCCAGAATTGCATGTGTCC </td></tr><tr><td> ZIKV Conserved 7209Rev. </td><td> ATCATTAGCAGCGGGACTCCAA </td></tr><tr><td> ZIKV Korunan 7343For. </td><td> GTTGTGGATGGAATAGTGGT </td></tr><tr><td> ZIKV Korunan 8243For. </td><td> TGCCCATACACCAGCACTATGA </td></tr><tr><td> ZIKV PRVABC59 8893Rev. </td><td> TGCATTGCTACGAACCTTGTTG </td></tr><tr><td> ZIKV korundu 9133For. </td><td> AGCCCTTGGATTCTTGAACGAGGA </td></tr><tr><td> ZIKV PRVABC59 9673Rev. </td><td> AACGCAATCATCTCCACTGACT </td></tr><tr><td> ZIKV Korunmuş 9686For. </td><td> GATGATAGGTTTGCACATGCC </td></tr><tr><td> ZIKV Conserved 10321Rev. </td><td> GTCCATGTACTTTTCTTCATCACCTAT </td></tr><tr><td> ZIKV Korunmuş 10455For. </td><td> CAGGAGAAGCTGGGAAACC </td></tr><tr><td> ZIKV Conserved 10621Rev. </td><td> CAGATTGAAGGGTGGGGAAGGTC </td></tr></tbody></table> Tablo 1: cDNA klonlarının dizilimi için primerler. Plazmidler listelenen primerler ile sıralanabilir. &quot;Korunan&quot; olarak işaretlenmiş astarlarZIKV&#39;in tüm genotiplerini sıralama / yükseltme olasılıklarının yüksek olduğunu belirtin. &quot;PRVABC59&quot; olarak etiketlenen primerler bu suşa özeldir ancak diğer Asya genotip türleri ve muhtemelen diğer genotipler için de çalışabilir. 3. In Vitro Transkripsiyon RNA Hazırlanması <ol><li> Maxiprep veya RCA hazırlanmış DNA&#39;nın sindirim reaksiyonunu ayarlayın. <ol><li> P1 sindirimi için 10 uL 10x reaksiyon tamponu, 3 uL ApaLI, 3 μL BamHI-HF, 3 uL rSAP veya CIP ve 3,3 μg p1 DNA karıştırın. 100 uL&#39;ye ddH20 ilave edin. </li><li> P2 sindirimi için, 10 uL 10x reaksiyon tamponu, 3 uL ApaLI, 3 uL EcoRI-HF ve 13.3 μg p2 DNA&#39;yı karıştırın. 100 uL&#39;ye ddH20 ilave edin. </li><li> 1-2 saat boyunca 37 ° C&#39;de inkübe edin. </li><li> Ticari bir jel ve PCR temizleme seti kullanarak arındırın (Malzeme Tablosuna bakın). Isıtma bloğunda 70 ° C&#39;ye önceden ısıtılmış 30 uL elüsyon tamponu içinde elute edin (inkübe edinSütun 5 dak.). NOT: Daha sonra bir jel üzerinde çalışmak için 1 uL tutun. </li></ol></li><li> Ligasyon reaksiyonu hazırlayın. <ol><li> 10 uL 10x T4 DNA ligasyon reaksiyon tamponu, 3 μL T4 DNA ligaz (400 U / μL), saflaştırılmış p1 29 uL ve 29 μL saflaştırılmış p2&#39;yi birleştirin. 100 uL&#39;ye ddH20 ilave edin. </li><li> Oda sıcaklığında 2 saat veya gece boyunca 16 ° C&#39;de inkübe edin. </li><li> Ticari bir jel ve PCR temizleme seti kullanarak arındırın (Malzeme Tablosuna bakın). Isıtma bloğunda 70 ° C&#39;ye önceden ısıtılmış 10 uL elüsyon tamponunda elute edin (eğrilmeden önce 5 dakika kuluçka sütunu). NOT: Daha sonra bir jel üzerinde çalışmak için 1 uL tutun. </li></ol></li><li> Sindirilmemiş plasmidleri, sindirilmiş plasmidleri ve bir agaroz jelinde bağlayın. Ligasyon ürününün, ligasyonun başarılı olduğunu gösteren tek başına sindirilmiş plazmitten daha yüksek bir moleküler ağırlık bandına (yaklaşık 11 kb) sahip olması gerekir ( Şekil 2b ).</li><li> T7 in vitro transkripsiyon reaksiyonu oluşturun. <ol><li> 10 uL 2x ARCA / NTP Mix, 2 μL T7 RNA polimeraz karışımı ve 8 μL saf ligasyon reaksiyonu ile 20 uL son bir hacim birleştirin. NOT: Karışıma dahil edilen ARCA, yalnızca doğru yönlendirmeyle birleştirilen bir kap analogudur. Standart kap analogları, transkriptlerin yalnızca ~% 50&#39;sinde doğru oryantasyonda bir başlık oluşturabilir. </li><li> 37 ° C&#39;de 4 saat inkübe edin. </li><li> Bir UV spektrofotometre yardımıyla RNA konsantrasyonunu ölçün. İsteğe bağlı olarak, RNA transkriptinin uzunluğunu teyit etmek için bir denatüre edici agaroz jeli çalıştırın. </li></ol></li></ol> 4. Elektroporasyon ile Bulaşıcı Virüs Kurtarma <ol><li> Elektroporasyondan önceki günlerde, kurtarılacak olan yapı başına 1 T182 şişesiVero hücresi (T150 ile T182 arasında kabul edilebilir; DMEM +% 10 Fetal sığır serumu (FBS) içinde yetiştirilir) hazırlayın. Sahte bir transfeksiyon kontrolü olarak 1 T182&#39;yi ekleyin. CeLl% 70-80 konfluende kullanılmalıdır. </li><li> Hücreler hazır olduğunda, 12 mL / DMEM reaksiyonu +% 15 FBS + 10 mM HEPES&#39;i 37 ° C&#39;ye kadar ısıtılan su banyosuna yerleştirin. </li><li> Standart bir protokol ile tripsinizasyon ile hücreleri ayırın ve tripsin inaktive etmek için% 10 FBS ile ortamda hücreleri kurtarmak; 4 ° C&#39;de 5 dakika 150 x g&#39;de santrifüj hücreleri. </li><li> 1 x fosfat tamponlu salin (PBS), hücreleri pelet hücreleri 150 xg&#39;de 5 dakika 4 ° C&#39;de yıkayın. Bu adımı toplam üç yıkama için iki kere tekrarlayın. </li><li> Örneklerin sayısı başına 200 mcL RPMI 1640 + 10 mM HEPES (steril) hücreleri tekrar süspansiyon haline getirin. Steril bir tüpe 200 uL hücre süspansiyonu aktarın. Hücreler ~ 0.5 x 107 hücre / mL olmalıdır. </li><li> Adım 3.4&#39;te üretilen 20 μL su (sahte negatif kontrol) veya 20 μL RNA (tercihen 5-10 μg) hücrelerin her setine ekleyin. Tüpü hafifçe oynatarak karıştırın ve tüpün içeriğini 2 mm&#39;lik boşluk elektroporasyon küvetine aktarın. </li><li> Elektrarı ayarlaOporator 170 V LV, omega (direnç) 0 ve 950 μF&#39;de (kabaca 625 V / cm ve diğer makineler için 20 ms zaman sabiti). Mümkün olan en düşük mevcut ayara direnç ayarlayın, varsa 0 veya ∞. </li><li> Pulse bir kez ve hemen adım 4.2&#39;de ısıtılmış DMEM +% 15 FBS + 10 mM HEPES 600 mcL ekleyin. Tüm hücreleri çıkarmak için küvetin içine iyice yıkayın. 10 mL önceden ısıtılmış ortam içeren bir T75 doku kültürü şişesine hücreler ekleyin. Küvette bulunan damlalık kullanarak ilave ortamı küvetlerden çıkarın. Steriliyeti korumaya dikkat edin. </li><li> Ortamı ve hücreleri karıştırmak için 37 ° C inkübatöre yerleştirilen Swirl şişesi. </li><li> Ertesi gün hücre canlılığı olup olmadığını kontrol edin ve her gün bunu% 50-75 hücre ölümüne kadar bekleyin. Alınan elektroporasyonlu kontrol ile karşılaştırıldığında hücre ölümü gözlemlenir. NOT: Vero hücrelerinde ZIKV sitopatik etki (CPE) oldukça belirgindir ve kültür ortamında yüzen hücreleri parçalayıp yuvarlatır. SahibizHasat için ideal olarak 8-10 gün aralığı gözlemledi. </li><li> Konik bir tüp içinde süpernatantı hasat edin ve 4 ° C&#39;de 10 dakika süreyle&gt; 3000 xg&#39;deki hücre döküntülerini gidermek için santrifüjleyin. </li><li> Berraklaştırılmış süpernatanı yeni bir tüple ve% 20 FBS son konsantrasyonuyla takviye edin (% 100 stoktan). Ayrıca, dondurulmuş haldeyken (1 M steril bir stoktan) virüs enfeksiyonunu korumak için bir tamponlayıcı madde olarak 10 mM&#39;lik nihai konsantrasyonda steril HEPES ekleyin. </li><li> Vorteks ve alikot ile vidalı kap şişelerine karıştırın. Gelecekteki kullanım için -80 ° C&#39;de saklayın. </li></ol> 5. Kurtarılan Virüsün Titrasyonu <ol><li> Titrasyonun yapılmasından bir gün önce Vero hücrelerinin uygun sayıdaki 6- veya 12 oyuklu plakalarını tohumlayın. </li><li> Virüsü dondurucudan çıkarın ve tüplerde veya 96 oyuklu plakalarda DMEM +% 2 FBS içinde seri 10 kat dilüsyonlar yapın. NOT: Kurtarılan klonlardan beklenen titre 1 x 10 6 ile 5 x 10 7 PFU / mL arasındadır. </li><li> 200 o ekleSırasıyla bir 12 veya 6 oyuklu plakanın bir çukuruna çiftli olarak her bir seyreltmenin 400 uL&#39;lik bir miktarı. </li><li> 37 ° C inkübatörde plakalar koyun ve her 15 dakikada bir, ~ 1-1.5 saatlik adsorpsiyon periyodu boyunca kaya yerleştirin. </li><li> Viral inokülumu çıkarın ve her göze 1 mL (12-kuyucuklu) veya 2 mL (6-kuyucuklu) DMEM-Tragacanth kaplama ekleyin. NOT: Buraya agaroz, agar, metilselüloz veya diğer kaplama malzemeleri kullanmak mümkündür. </li><li> 5 gün boyunca 37 ° C inkübatöre hücreleri inkübe edin. Uygun plak oluşumunun süresi, kullanılan kaplamaya bağlı olarak değişir. </li><li> Hücreleri düzeltmek için, plakaları inkübatörden çıkarın ve dezenfektana hafifçe dökün. </li><li> Kaplamak ve karıştırmak için girdap yapmak için her oyuğa yeterli% 20 etanol /% 0.1 kristal mor (CV) ekleyin. NOT: Birçok başka fiksatif var ve burada kullanılabilir. Buna ek olarak, bir agaroz veya agar kaplaması kullanılıyorsa, sabitlemesiz plakları görselleştirmek için nötr kırmızı ile birlikte ikinci bir kaplama kullanılabilir. % 20 etanol var olduğu gösterildiÖnceki çalışmalarda zarflı virüslerin inaktivasyonunda etkili; Zarflanmamış virüsler için bu miktarı kullanmayın, aksi halde devre dışı bırakılmaz 19 . </li><li> Plakaları oda sıcaklığında 30-60 dakika inkübe edin (sınıf II biyogüvenlik kabininde); CV&#39;yi atın (yerel yönetmeliklere göre) ve musluk suyuyla yıkayın. </li><li> Plakaların kurumasına izin verin ve plakları manuel olarak sayın. NOT: Referans 20, plak tahlilleri yapmak için ek bir referans olarak kullanılabilir. </li></ol>

<ol>
	<li>Kindhauser, M. K., Allen, T., Frank, V., Santhana, R. S., Dye, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika:+the+origin+and+spread+of+a+mosquito-borne+virus.">Zika: the origin and spread of a mosquito-borne virus.</a> Bull World Health Organ. 94 (9), 675C-686C (2016).</li><li>Oehler, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika+virus+infection+complicated+by+Guillain-Barre+syndrome--case+report,+French+Polynesia,+December+2013.">Zika virus infection complicated by Guillain-Barre syndrome--case report, French Polynesia, December 2013.</a> Euro Surveill. 19 (9), (2014).</li><li>Li, D., Aaskov, J., Lott, W. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+cryptic+prokaryotic+promoter+within+the+cDNA+encoding+the+5'+end+of+dengue+virus+RNA+genome.">Identification of a cryptic prokaryotic promoter within the cDNA encoding the 5' end of dengue virus RNA genome.</a> PLoS One. 6 (3), e18197 (2011).</li><li>Pu, S. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+approach+to+propagate+flavivirus+infectious+cDNA+clones+in+bacteria+by+introducing+tandem+repeat+sequences+upstream+of+virus+genome.">A novel approach to propagate flavivirus infectious cDNA clones in bacteria by introducing tandem repeat sequences upstream of virus genome.</a> J Gen Virol. 95 (Pt 7), 1493-1503 (2014).</li><li>Pu, S. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Successful+propagation+of+flavivirus+infectious+cDNAs+by+a+novel+method+to+reduce+the+cryptic+bacterial+promoter+activity+of+virus+genomes.">Successful propagation of flavivirus infectious cDNAs by a novel method to reduce the cryptic bacterial promoter activity of virus genomes.</a> J Virol. 85 (6), 2927-2941 (2011).</li><li>Rice, C. M., Grakoui, A., Galler, R., Chambers, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+of+infectious+yellow+fever+RNA+from+full-length+cDNA+templates+produced+by+in+vitro+ligation.">Transcription of infectious yellow fever RNA from full-length cDNA templates produced by in vitro ligation.</a> New Biol. 1 (3), 285-296 (1989).</li><li>Yun, S. I., Kim, S. Y., Rice, C. M., Lee, Y. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+application+of+a+reverse+genetics+system+for+Japanese+encephalitis+virus.">Development and application of a reverse genetics system for Japanese encephalitis virus.</a> J Virol. 77 (11), 6450-6465 (2003).</li><li>Gualano, R. C., Pryor, M. J., Cauchi, M. R., Wright, P. J., Davidson, A. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+major+determinant+of+mouse+neurovirulence+of+dengue+virus+type+2+using+stably+cloned+genomic-length+cDNA.">Identification of a major determinant of mouse neurovirulence of dengue virus type 2 using stably cloned genomic-length cDNA.</a> J Gen Virol. 79 (Pt 3), 437-446 (1998).</li><li>Johansen, I. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intron+insertion+facilitates+amplification+of+cloned+virus+cDNA+in+Escherichia+coli+while+biological+activity+is+reestablished+after+transcription+in+vivo.">Intron insertion facilitates amplification of cloned virus cDNA in Escherichia coli while biological activity is reestablished after transcription in vivo.</a> Proc Natl Acad Sci U S A. 93 (22), 12400-12405 (1996).</li><li>Shan, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Infectious+cDNA+Clone+of+Zika+Virus+to+Study+Viral+Virulence,+Mosquito+Transmission,+and+Antiviral+Inhibitors.">An Infectious cDNA Clone of Zika Virus to Study Viral Virulence, Mosquito Transmission, and Antiviral Inhibitors.</a> Cell Host Microbe. 19 (6), 891-900 (2016).</li><li>Schwarz, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rescue+of+the+1947+Zika+Virus+Prototype+Strain+with+a+Cytomegalovirus+Promoter-Driven+cDNA+Clone.">Rescue of the 1947 Zika Virus Prototype Strain with a Cytomegalovirus Promoter-Driven cDNA Clone.</a> mSphere. 1 (5), (2016).</li><li>Tsetsarkin, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Full-Length+Infectious+cDNA+Clone+of+Zika+Virus+from+the+2015+Epidemic+in+Brazil+as+a+Genetic+Platform+for+Studies+of+Virus-Host+Interactions+and+Vaccine+Development.">A Full-Length Infectious cDNA Clone of Zika Virus from the 2015 Epidemic in Brazil as a Genetic Platform for Studies of Virus-Host Interactions and Vaccine Development.</a> MBio. 7 (4), (2016).</li><li>Gadea, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+robust+method+for+the+rapid+generation+of+recombinant+Zika+virus+expressing+the+GFP+reporter+gene.">A robust method for the rapid generation of recombinant Zika virus expressing the GFP reporter gene.</a> Virology. 497, 157-162 (2016).</li><li>Kapoor, M., Zhang, L., Mohan, P. M., Padmanabhan, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+and+characterization+of+an+infectious+dengue+virus+type-2+RNA+genome+(New+Guinea+C+strain).">Synthesis and characterization of an infectious dengue virus type-2 RNA genome (New Guinea C strain).</a> Gene. 162 (2), 175-180 (1995).</li><li>Messer, W. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+characterization+of+a+reverse+genetic+system+for+studying+dengue+virus+serotype+3+strain+variation+and+neutralization.">Development and characterization of a reverse genetic system for studying dengue virus serotype 3 strain variation and neutralization.</a> PLoS Negl Trop Dis. 6 (2), e1486 (2012).</li><li>Kinney, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avian+virulence+and+thermostable+replication+of+the+North+American+strain+of+West+Nile+virus.">Avian virulence and thermostable replication of the North American strain of West Nile virus.</a> J Gen Virol. 87 (Pt 12), 3611-3622 (2006).</li><li>Chang, A. C., Cohen, S. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+amplifiable+multicopy+DNA+cloning+vehicles+derived+from+the+P15A+cryptic+miniplasmid.">Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid.</a> J Bacteriol. 134 (3), 1141-1156 (1978).</li><li>Weger-Lucarelli, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+Characterization+of+Recombinant+Virus+Generated+from+a+New+World+Zika+Virus+Infectious+Clone.">Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone.</a> J Virol. 91 (1), (2017).</li><li>Roberts, P. L., Lloyd, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus+inactivation+by+protein+denaturants+used+in+affinity+chromatography.">Virus inactivation by protein denaturants used in affinity chromatography.</a> Biologicals. 35 (4), 343-347 (2007).</li><li>Baer, A., Kehn-Hall, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+concentration+determination+through+plaque+assays:+using+traditional+and+novel+overlay+systems.">Viral concentration determination through plaque assays: using traditional and novel overlay systems.</a> J Vis Exp. (93), e52065 (2014).</li><li>Weger-Lucarelli, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+Characterization+of+Recombinant+Virus+Generated+from+a+New+World+Zika+Virus+Infectious+Clone.">Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone.</a> J Virol. , (2016).</li><li>Grubaugh, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+Drift+during+Systemic+Arbovirus+Infection+of+Mosquito+Vectors+Leads+to+Decreased+Relative+Fitness+during+Host+Switching.">Genetic Drift during Systemic Arbovirus Infection of Mosquito Vectors Leads to Decreased Relative Fitness during Host Switching.</a> Cell Host Microbe. 19 (4), 481-492 (2016).</li></ol>

Yazarların açıklayacak bir şeyi yok.

Here we describe a method for the recovery of a bipartite infectious cDNA clone system for ZIKV. Previously described clones for ZIKV suffer from either attenuation or require the addition of introns, making plasmids larger and preventing rescue in insect cells. Infectious virus can be recovered using the two-plasmid clone system in either mammalian or insect cells (data not shown). In addition, virus recovered from this system behaves similarly to wild-type virus in several cell lines, in an immunocompromised mouse mode...

Zika virüsü (ZIKV; Aile Flaviviridae : Genus Flavivirus ), 2013-14 yılları arasında Brezilya&#39;ya gelen sivrisinek taşıyan bir flavivirüs olup, daha sonra Amerika Birleşik Devletleri&#39;nde yaygınlaşan ateşli bir hastalık patlamasıyla ilişkilendirilmiştir 1 . Buna ek olarak, ZIKV, yetişkinlerde Guillain-Barré sendromu ve fetüsler ve yenidoğanlarda mikrocefali gibi ağır hastalık sonuçlarıyla bağlantılıdır2. Batı yarımkürede hızla yayılmadan önce ZIKV hakkında pek az şey biliniyordu. Bu, moleküler araçların eksikliğini içeriyordu, bu yüzden mekanistik araştırmayı engelledi. Bulaşıcı cDNA klonları gibi virüsler için moleküler araçlar aşı ve antiviral terapötik gelişmeyi kolaylaştırır ve farklı viral patogenez, bağışıklık yanıtı ve viral evrim ile ilgili viral genetik faktörlerin değerlendirilmesine izin verir. Flavivirüs bulaşıcı klonların bakterilerde cr nedeniyle oldukça kararsız olduğu bilinmektedirGenomlarında bulunan yptik prokaryotik hızlandırıcılar 3 . Bu sorunu hafifletmek için çeşitli yaklaşımlar kullanılmıştır; Virütik dizilerin 4 üst akışında tandem tekrarların yerleştirilmesi, varsayılan prokaryotik promoter dizilerinin 5 mutasyonu, genomun birden çok plazmid 6&#39;ya bölünmesi, düşük kopya sayı vektörleri (bakteri yapay kromozomlar dahil) 7,8 ve viral genomda intronların sokulması da dahil olmak üzere 9 . ZIKV için modifikasyonsuz bir tam uzunluklu sistem tanımlanmıştır; Bununla birlikte, bu klonun hücre kültüründe ve farelerde zayıfladığı görülmüştür. Diğer gruplar ZIKV genomuna intronlar tasarladılar ve in vitro memeliler hücrelerinde enfeksiyöz virüsün üretilmesi için eklenebilen bakterilerdeki istikrarsız dizilerin bozulmasına izin verdi 11, 12 . Ek olarak, ZIKV 13&#39;ün prototip MR766 suşunu kurtarmak için İnfeksiyöz-Subgenomik-Amplikon başlıklı bir PCR tabanlı sistem başarıyla kullanılmıştır. Burada açıklanan yaklaşım, yabancı sekanslara ihtiyaç duymamakta, daha önce sarı humma 6 , dang 14 , 15 ve Batı Nil virüsleri 16 ile başarıyla kullanılan çok sayıda plazmid kullanarak yüksek instabilite bölgesinde genomu bozmaktadır. Dahası, viral genomik uçtaki hepatit D ribozim dizisinin eklenmesi, bir doğrusallaştırma bölgesi eklenmesine gerek kalmadan otantik bir 3 &#39;ucunun oluşturulmasını kolaylaştırır. Buna ek olarak, her iki plazmid, herhangi bir artık toksisite 17 azaltmak için düşük kopya sayısı vektör (pACYC177, hücre başına ~ 15 kopya) inşa edilmiştir. Geri kazanılan virüs,Hem anne hem de böceklerden türeyen çeşitli hücre tiplerini içeren 8 hücre hattındaki in vitro büyüme eğrilerinde ebeveyn virüs bulaştırdı ve farelerde aynı patojenik profilleri, sivrisineklerde enfeksiyon, yayılım ve iletim oranlarını sergiledi. Burada, bulaşıcı klon plasmidlerin büyümesini , in vitro olarak tam uzunlukta viral RNA (viral genom) üretmek ve hücre kültüründe bulaşıcı virüsün nasıl toplanacağını açıklayan bir protokol açıklanmaktadır. İlk olarak bakterilerdeki plazmidlerin çoğalmasını veya yuvarlanan daire amplifikasyonunu (RCA) kullanarak bakteri içermeyen amplifikasyonunu anlatacağız. Sonra, iki plazmitin nasıl sindirildiğini ve ardından tam uzunlukta virüs üretmek için birlikte bağlandığını gösteriyoruz. Son olarak, transkripsiyon RNA üretimini ve daha sonra Vero hücrelerine elektroporasyonunu, ardından geri kazanılan virüs titrasyonunu tarif ediyoruz ( Şekil 1 ). Açıklanan yaklaşım hızlıdır,Enfeksiyonlu virüs stoklarının 1-2 hafta içinde toparlanması.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>NEB Stable CompetentE. coli</td>
			<td>New England BioLabs</td>
			<td>C3040H</td>
			<td></td>
		</tr>
		<tr>
			<td>Carbenicillin, Disodium Salt</td>
			<td>various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Zyppy Plasmid Miniprep Kit</td>
			<td>Zymo Research</td>
			<td>D4036</td>
			<td></td>
		</tr>
		<tr>
			<td>ZymoPURE Plasmid Maxiprep Kit</td>
			<td>Zymo Research</td>
			<td>D4202</td>
			<td></td>
		</tr>
		<tr>
			<td>SalI-HF</td>
			<td>New England BioLabs</td>
			<td>R3138S</td>
			<td>20,000 units/ml</td>
		</tr>
		<tr>
			<td>NheI-HF</td>
			<td>New England BioLabs</td>
			<td>R3131S</td>
			<td>20,000 units/ml</td>
		</tr>
		<tr>
			<td>ApaLI</td>
			<td>New England BioLabs</td>
			<td>R0507S</td>
			<td>10,000 units/ml</td>
		</tr>
		<tr>
			<td>EcoRI-HF</td>
			<td>New England BioLabs</td>
			<td>R3101S</td>
			<td>20,000 units/ml</td>
		</tr>
		<tr>
			<td>BamHI-HF</td>
			<td>New England BioLabs</td>
			<td>R3136S</td>
			<td>20,000 units/ml</td>
		</tr>
		<tr>
			<td>HindIII-HF</td>
			<td>New England BioLabs</td>
			<td>R3104S</td>
			<td>20,000 units/ml</td>
		</tr>
		<tr>
			<td>illustra TempliPhi 100 Amplification Kit</td>
			<td>GE Healthcare Life Sciences</td>
			<td>25640010</td>
			<td></td>
		</tr>
		<tr>
			<td>NucleoSpin Gel and PCR Clean-up</td>
			<td>Macherey-Nagel</td>
			<td>740609.5</td>
			<td></td>
		</tr>
		<tr>
			<td>Shrimp Alkaline Phosphatase (rSAP)</td>
			<td>New England BioLabs</td>
			<td>M0371S</td>
			<td>1,000 units/ml</td>
		</tr>
		<tr>
			<td>Alkaline Phosphatase, Calf Intestinal (CIP)</td>
			<td>New England BioLabs</td>
			<td>M0290S</td>
			<td>10,000 units/ml</td>
		</tr>
		<tr>
			<td>T4 DNA Ligase</td>
			<td>New England BioLabs</td>
			<td>M0202S</td>
			<td>400,000units/mL</td>
		</tr>
		<tr>
			<td>HiScribe T7 ARCA mRNA Kit</td>
			<td>New England BioLabs</td>
			<td>E2065S</td>
			<td></td>
		</tr>
		<tr>
			<td>Vero cells</td>
			<td>ATCC</td>
			<td>CCL-81</td>
			<td></td>
		</tr>
		<tr>
			<td>ECM 630 High Throughput Electroporation System</td>
			<td>BTX</td>
			<td>45-0423</td>
			<td>Other machines are acceptable.</td>
		</tr>
		<tr>
			<td>LB Broth with agar (Miller)</td>
			<td>Sigma</td>
			<td>L3147</td>
			<td>Can be homemade as well.</td>
		</tr>
		<tr>
			<td>Terrific Broth</td>
			<td>Sigma</td>
			<td>T0918</td>
			<td>Can be homemade as well.</td>
		</tr>
		<tr>
			<td>Petri Dish</td>
			<td>Celltreat</td>
			<td>229693</td>
			<td></td>
		</tr>
		<tr>
			<td>Culture Tubes</td>
			<td>VWR International</td>
			<td>60818-576</td>
			<td></td>
		</tr>
		<tr>
			<td>T75 flasks</td>
			<td>Celltreat</td>
			<td>229340</td>
			<td></td>
		</tr>
		<tr>
			<td>T182 flasks</td>
			<td>Celltreat</td>
			<td>229350</td>
			<td></td>
		</tr>
		<tr>
			<td>1x PBS</td>
			<td>Corning</td>
			<td>21-040-CV</td>
			<td></td>
		</tr>
		<tr>
			<td>RPMI 1640 with L-glutamine</td>
			<td>Corning</td>
			<td>10-040-CV</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM with L-glutamine and 4.5 g/L glucose</td>
			<td>Corning</td>
			<td>10-017-CV</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>Atlas Biologicals</td>
			<td>FP-0500-A</td>
			<td></td>
		</tr>
		<tr>
			<td>Tragacanth Powder</td>
			<td>MP Bio</td>
			<td>MP 104792</td>
			<td></td>
		</tr>
		<tr>
			<td>Crystal Violet</td>
			<td>Amresco</td>
			<td>0528-1006</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol Denatured</td>
			<td>VWR International</td>
			<td>BDH1156-1LP</td>
			<td></td>
		</tr>
		<tr>
			<td>6 well plate</td>
			<td>Celltreat</td>
			<td>229106</td>
			<td></td>
		</tr>
		<tr>
			<td>12 well plate</td>
			<td>Celltreat</td>
			<td>229111</td>
			<td></td>
		</tr>
		<tr>
			<td>Sequencing Oligos</td>
			<td>IDT</td>
			<td>see table 1</td>
			<td></td>
		</tr>
		<tr>
			<td>Qubit 3.0</td>
			<td>ThermoFisher</td>
			<td>Qubit 3.0</td>
			<td>other methods are acceptable.</td>
		</tr>
		<tr>
			<td>Qubit dsDNA BR Assay Kit</td>
			<td>ThermoFisher</td>
			<td>Q32850</td>
			<td>other methods are acceptable.</td>
		</tr>
		<tr>
			<td>Qubit RNA HS Assay Kit</td>
			<td>ThermoFisher</td>
			<td>Q32852</td>
			<td>other methods are acceptable.</td>
		</tr>
		<tr>
			<td>Class II Biosafety Cabinet</td>
			<td>Varies</td>
			<td>N/A</td>
			<td>This is necessary for live-virus work.</td>
		</tr>
	</tbody>
</table>

rescue and characterization of recombinant virus from a new world zika virus infectious clone

Enfeksiyöz cDNA klonları bir virüsün genetik manipülasyonuna izin verir, böylece aşılar üzerinde çalışma, patogenez, replikasyon, bulaşma ve viral evrimi kolaylaştırır. Burada Zika virüsü (ZIKV) için şu anda Amerika&#39;da patlayıcı bir salgına neden olan bulaşıcı bir klonun yapımını anlatıyoruz. Flavivirüs kaynaklı plazmidlerle sıkça görülen bakterilere toksisiteyi önlemek için genomu NS1 geninde ayıran ve mutasyonsuz başarıyla kurtarılamayan tam uzunluktaki yapılardan daha kararlı olan iki plazmid sistemi ürettik. İki parçaya katılmak için sindirim ve ligasyondan sonra, T7 RNA polimeraz ile in vitro transkripsiyon ile tam uzunluktaki viral RNA üretilebilir. Transkribe RNA&#39;nın hücrelere elektroporasyonundan sonra sırasıyla farelerde ve sivrisineklerde benzer in vitro büyüme kinetikleri ve in vivo virülans ve enfeksiyon fenotiplerini sergileyen virüs bulunmuştur.

Burada açıklanan protokol, bulaşıcı klon türevi Zika virüsünün iyileşmesine izin verir. İki plazmid bulaşıcı klon sisteminin manipülasyonu, son derece dengesiz olan tam uzunluktaki versiyonlara kıyasla (bakınız veriler gösterilmemiştir), özen gösterildiğinde açıktır. Sindirimden ve iki ayrı parçanın bağlanmasından sonra, T7 polimeraz ile in vitro transkripsiyon kullanılarak kapaklı RNA üretilir ve daha sonra Vero hücrelerine elektroporasyon yap...

Watch this Scientific Journal Video about Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone at JoVE.com

Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Bu protokol, iki-plazmid bulaşıcı bir cDNA klonundan bulaşıcı Zika virüsünün iyileşmesini tanımlıyor.

Yeni Bir Dünyadan Rekombinant Virüsün Kurtarılması ve Karakterizasyonu Zika Virüsü Bulaşıcı Klon

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral ...

rescue-characterization-recombinant-virus-from-new-world-zika-virus

Research

JoVE Journal

Immunology and Infection

9.6K Görüntüleme.  Colorado State University.  Bu protokol, iki-plazmid bulaşıcı bir cDNA klonundan bulaşıcı Zika virüsünün iyileşmesini tanımlıyor. 

Video: Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Generation of Recombinant Influenza Virus from Plasmid DNA

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally established in 1999 1,2 plasmid-based reverse genetic techniques to generate recombinant viruses have revolutionized the influenza research field because specific questions have been answered by genetically engineered, infectious, recombinant influenza viruses. Such studies include virus replication, function of viral proteins, the contribution of specific mutations in viral proteins in viral replication and/or pathogenesis and, also, viral vectors using recombinant influenza viruses expressing foreign proteins 3.

Rescue of influenza A viruses from plasmid DNA is a basic and essential experimental technique that allows influenza researchers to generate recombinant viruses to study multiple aspects in the biology of influenza virus, and to be used as potential vectors or vaccines.

Plazmid DNA Rekombinant Grip Virüsü Üretimi

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally ...

İmmünoloji ve Enfeksiyon

Detection of Infectious Virus from Field-collected Mosquitoes by Vero Cell Culture Assay

Mosquitoes transmit a number of distinct viruses including important human pathogens such as West Nile virus, dengue virus, and chickungunya virus. Many of these viruses have intensified in their endemic ranges and expanded to new territories, necessitating effective surveillance and control programs to respond to these threats. One strategy to monitor virus activity involves collecting large numbers of mosquitoes from endemic sites and testing them for viral infection. In this article, we describe how to handle, process, and screen field-collected mosquitoes for infectious virus by Vero cell culture assay. Mosquitoes are sorted by trap location and species, and grouped into pools containing &le;50 individuals. Pooled specimens are homogenized in buffered saline using a mixer-mill and the aqueous phase is inoculated onto confluent Vero cell cultures (Clone E6). Cell cultures are monitored for cytopathic effect from days 3-7 post-inoculation and any viruses grown in cell culture are identified by the appropriate diagnostic assays. By utilizing this approach, we have isolated 9 different viruses from mosquitoes collected in Connecticut, USA, and among these, 5 are known to cause human disease. Three of these viruses (West Nile virus, Potosi virus, and La Crosse virus) represent new records for North America or the New England region since 1999. The ability to detect a wide diversity of viruses is critical to monitoring both established and newly emerging viruses in the mosquito population.

We describe a method to process and screen field-collected mosquitoes for a diversity of viruses by Vero cell culture assay. By employing this technique, we have detected 9 different viruses from 4 taxonomic families in mosquitoes collected in Connecticut.

Vero Hücre Kültür Testi ile Alan toplanan Sivrisinekler Enfeksiyon Virüs Algılama

Mosquitoes transmit a number of distinct viruses including important human pathogens such as West Nile virus, dengue virus, and chickungunya virus. Many ...

Visualizing Dengue Virus through Alexa Fluor Labeling

The early events in the interaction between virus and cell can have profound influence on the outcome of infection. Determining the factors 
that influence this interaction could lead to improved understanding of disease pathogenesis and thus influence vaccine or therapeutic design. Hence, the development 
of methods to probe this interaction would be useful. Recent advancements in fluorophores development1-3 and imaging technology4 can be exploited to 
improve our current knowledge on dengue pathogenesis and thus pave the way to reduce the millions of dengue infections occurring annually.

The enveloped dengue virus has an external scaffold consisting of 90 envelope glycoprotein (E) dimers protecting the nucleocapsid shell, 
which contains a single positive strand RNA genome5. The identical protein subunits on the virus surface can thus be labeled with an amine reactive dye and visualized 
through immunofluorescent microscopy. Here, we present a simple method of labeling of dengue virus with Alexa Fluor succinimidyl ester dye dissolved directly in a sodium 
bicarbonate buffer that yielded highly viable virus after labeling. There is no standardized procedure for the labeling of live virus and existing manufacturer&#x2019;s protocol 
for protein labeling usually requires the reconstitution of dye in dimethyl sulfoxide. The presence of dimethyl sulfoxide, even in minute quantities, can block 
productive infection of virus and also induce cell cytotoxicity6. The exclusion of the use of dimethyl sulfoxide in this protocol thus reduced this possibility. 
Alexa Fluor dyes have superior photostability and are less pH-sensitive than the common dyes, such as fluorescein and rhodamine2, making them ideal for 
studies on cellular uptake and endosomal transport of the virus. The conjugation of Alexa Fluor dye did not affect the recognition of labeled dengue 
virus by virus-specific antibody and its putative receptors in host cells7. This method could have useful applications in virological studies.

Taking advantage of the advancements in fluorophore development and imaging technology, a simple method of Alexa Fluor labeling of dengue virus was devised to visualize the early interactions between virus and cell.

Alexa Fluor Etiketleme Dang Virüs görselleştirme

The early events in the interaction between virus and cell can have profound influence on the outcome of infection. Determining the factors 
that ...

Propagating and Detecting an Infectious Molecular Clone of Maedi-visna Virus that Expresses Green Fluorescent Protein

Maedi-visna virus (MVV) is a lentivirus of sheep, causing slowly progressive interstitial pneumonia and encephalitis1. The primary target cells of MVV in vivo are considered to be of the monocyte lineage2. Certain strains of MVV can replicate in other cell types, however3,4. The green fluorescent protein is a commonly used marker for studying lentiviruses in living cells. We have inserted the egfp gene into the gene for dUTPase of MVV. The dUTPase gene is well conserved in most lentivirus strains of sheep and goats and has been shown to be important in replication of CAEV5. However, dUTPase has been shown to be dispensable for replication of the molecular clone of MVV used in this study both in vitro and in vivo6. MVV replication is strictly confined to cells of sheep or goat origin. We use a primary cell line from the choroid plexus of sheep (SCP cells) for transfection and propagation of the virus7. The fluorescent MVV is fully infectious and EGFP expression is stable over at least 6 passages8. There is good correlation between measurements of TCID50 and EGFP. This virus should therefore be useful for rapid detection of infected cells in studies of cell tropism and pathogenicity in vitro and in vivo8.

We describe a molecular clone of maedi-visna virus that expresses GFP and is fully infectious. Replication of this virus can be detected by using fluorescence microscopy and flow cytometry.

Çoğaltım ve Yeşil floresan proteini ifade Maedi-visna Virüs bir Enfeksiyöz Moleküler Clone algılama

Maedi-visna virus (MVV) is a lentivirus of sheep, causing slowly progressive interstitial pneumonia and encephalitis1. The primary target cells of MVV in ...

Rescue of Recombinant Newcastle Disease Virus from cDNA

Newcastle disease virus (NDV), the prototype member of the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented, negative-sense, single-stranded, enveloped RNA virus (Figure 1) with potential applications as a vector for vaccination and treatment of human diseases. In-depth exploration of these applications has only become possible after the establishment of reverse genetics techniques to rescue recombinant viruses from plasmids encoding their complete genomes as cDNA2-5. Viral cDNA can be conveniently modified in vitro by using standard cloning procedures to alter the genotype of the virus and/or to include new transcriptional units. Rescue of such genetically modified viruses provides a valuable tool to understand factors affecting multiple stages of infection, as well as allows for the development and improvement of vectors for the expression and delivery of antigens for vaccination and therapy. Here we describe a protocol for the rescue of recombinant NDVs.

Newcastle disease virus (NDV) has been extensively studied in the last few years in order to develop new vectors for vaccination and therapy, among others. These studies have been possible due to techniques to rescue recombinant virus from cDNA, such as those we describe here.

CDNA&#39;dan rekombinant Newcastle Hastalığı Virüsü Rescue

Newcastle disease virus (NDV), the prototype member of  the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented,  negative-sense, ...

Neutrophil Isolation and Analysis to Determine their Role in Lymphoma Cell Sensitivity to Therapeutic Agents

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of inflammation. They are key players in the innate immune system and play major roles in cancer biology. Neutrophils have been proposed as key mediators of malignant transformation, tumor progression, angiogenesis and in the modulation of the antitumor immunity; through their release of soluble factors or their interaction with tumor cells. To characterize the specific functions of neutrophils, a fast and reliable method is coveted for in vitro isolation of neutrophils from human blood. Here, a density gradient separation method is demonstrated to isolate neutrophils as well as mononuclear cells from the blood. The procedure consists of layering the density gradient solution such as Ficoll carefully above the diluted blood obtained from patients diagnosed with chronic lymphocytic leukemia (CLL), followed by centrifugation, isolation of mononuclear layer, separation of neutrophils from RBCsby dextran then lysis of residual erythrocytes. This method has been shown to isolate neutrophils &#8805; 90 % pure. To mimic the tumor microenvironment, 3-dimensional (3D) experiments were performed using basement membrane matrix such as Matrigel. Given the short half-life of neutrophils in vitro, 3D experiments with fresh human neutrophils cannot be performed. For this reason promyelocytic HL60 cells are differentiated along the granulocytic pathway using the differentiation inducers dimethyl sulfoxide (DMSO) and retinoic acid (RA). The aim of our experiments is to study the role of neutrophils on the sensitivity of lymphoma cells to anti-lymphoma agents. However these methods can be generalized to study the interactions of neutrophils or neutrophil-like cells with a large range of cell types in different situations.

Neutrophils are the most abundant type of white blood cells. The isolation of neutrophils from human blood by density gradient separation method and the differentiation of human promyelocytic (HL60) cells along the granulocytic pathway are described here; to test their role on sensitivity of lymphoma cells to anti-lymphoma agents.

Nötrofil İzolasyon ve Analiz Terapötik Ajanların için Lenfoma Hücre Duyarlılık kendi Rolü belirleme

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of ...

Zika Virus Infectious Cell Culture System and the In Vitro Prophylactic Effect of Interferons

Zika Virus (ZIKV) is an emerging pathogen that is linked to fetal developmental abnormalities such as microcephaly, eye defects, and impaired growth. ZIKV is an RNA virus of the Flaviviridae family. ZIKV is mainly transmitted by mosquitoes, but can also be spread by maternal to fetal vertical transmission as well as sexual contact. To date, there are no reliable treatment or vaccine options available to protect those infected by the virus. The development of a reproducible, effective Zika virus infectious cell culture system is critical for studying the molecular mechanisms of ZIKV replication as well as drug and vaccine development. In this regard, a protocol describing a mammalian cell-based in vitro Zika virus culture system for viral production and growth analysis is reported here. Details on the formation of plaques by Zika virus on a cell monolayer and plaque assay for measuring viral titer are presented. Viral genome replication kinetics and double-stranded RNA genome replicatory intermediates are determined. This culture platform was utilized to screen against a library of a small set of cytokines resulting in the identification of interferon-&#945; (IFN-&#945;), IFN-&#946; and IFN-&#947; as potent inhibitors of Zika viral growth. In summary, an in vitro infectious Zika viral culture system and various virological assays are demonstrated in this study, which has the potential to greatly benefit the research community in elucidating further the mechanisms of viral pathogenesis and the evolution of viral virulence. Antiviral IFN-alpha can further be evaluated as a prophylactic, post-exposure prophylactic, and treatment option for Zika virus infections in high-risk populations, including infected pregnant women.

Zika Virus Infectious Cell Culture System and the In Vitro Prophylactic Effect of Interferons

Zika Virus (ZIKV), an emerging pathogen, is linked to fetal developmental abnormalities and microcephaly. The establishment of an effective infectious cell culture system is crucial for studies of ZIKV replication as well as vaccine and drug development. In this study, various virological assays pertaining to ZIKV are illustrated and discussed.

Zika Virüs Bulaşıcı hücre kültürü sistemine ve<em&gt; İn Vitro</emİnterferonların&gt; profilaktik etkisi

Zika Virus (ZIKV) is an emerging pathogen that is linked to fetal developmental abnormalities such as microcephaly, eye defects, and impaired growth. ZIKV ...

Zika Virus Specific Diagnostic Epitope Discovery

High-density peptide microarrays allow screening of more than six thousand peptides on a single standard microscopy slide. This method can be applied for drug discovery, therapeutic target identification, and developing of diagnostics. Here, we present a protocol to discover specific Zika virus (ZIKV) diagnostic peptides using a high-density peptide microarray. A human serum sample validated for ZIKV infection was incubated with a high-density peptide microarray containing the entire ZIKV protein translated into 3,423 unique 15 linear amino acid (aa) residues with a 14-aa residue overlap printed in duplicate. Staining with different secondary antibodies within the same array, we detected peptides that bind to Immunoglobulin M (IgM) and Immunoglobulin G (IgG) antibodies present in serum. These peptides were selected for further validation experiments. In this protocol, we describe the strategy followed to design, process, and analyze a high-density peptide microarray.

In this protocol, we describe a technique to discover Zika virus specific diagnostic peptides using a high-density peptide microarray. This protocol can readly be adapted for other emerging infectious diseases.

Zika virüs belirli tanılama Epitope bulma

High-density peptide microarrays allow screening of more than six thousand peptides on a single standard microscopy slide. This method can be applied for ...

Rapid, Safe, and Simple Manual Bedside Nucleic Acid Extraction for the Detection of Virus in Whole Blood Samples

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for the rapid bedside inactivation of the Ebola virus during blood sampling for safe nucleic acid (NA) tests by adding a commercial lysis/binding buffer directly into the vacuum blood collection tubes. Using this bedside inactivation approach, we have developed a safe, rapid, and simplified bedside NA extraction method for the subsequent detection of a virus in lysis/binding buffer-inactivated whole blood. The NA extraction is directly performed in the blood collection tubes and requires no equipment or electricity. 
After the blood is collected into the lysis/binding buffer, the contents are mixed by flipping the tube by hand, and the mixture is incubated for 20 min at room temperature. Magnetic glass particles (MGPs) are added to the tube, and the contents are mixed by flipping the collection tube by hand. The MGPs are then collected on the side of the blood collection tube using a magnetic holder or a magnet and a rubber band. The MGPs are washed three times, and after the addition of elution buffer directly into the collection tube, the NAs are ready for NA tests, such as qPCR or isothermal loop amplification (LAMP), without the removal of the MGPs from the reaction. The NA extraction method is not dependent on any laboratory facilities and can easily be used anywhere (e.g., in field hospitals and hospital isolation wards). When this NA extraction method is combined with LAMP and a portable instrument, a diagnosis can be obtained within 40 min of the blood collection.

Here, we present a protocol for the rapid virus nucleic acid extraction from the virus-inactivated whole blood. The extraction is performed directly in the blood collection tubes and requires no equipment or electricity. The method is not dependent on laboratory facilities and can be used anywhere (e.g., in field hospitals).

Tam kan örneklerinde virüs tespiti için hızlı, güvenli ve basit el ile başucu nükleik asit çıkarma

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for ...

Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells

The recent emergence of the flavivirus Zika and neurological complications, such as Guillain-Barr&#233; syndrome and microcephaly in infants, has brought serious public safety concerns. Among the risk factors, antibody-dependent enhancement (ADE) poses the most significant threat, as the recent re-emergence of the Zika virus (ZIKV) is primarily in areas where the population has been exposed and is in a state of pre-immunity to other closely related flaviviruses, especially dengue virus (DENV). Here, we describe a protocol for quantifying the effect of human serum antibodies against DENV on ZIKV infection in primary human cells or cell lines.

We describe a method to evaluate the effect of pre-existing immunity against dengue virus on the Zika virus infection by using human serum, primary human cells, and infection quantification by quantitative real-time polymerase chain reaction.

Antikor-bağımlı donanýmýn birincil insan hücrelerinde Zika şunun miktar

The recent emergence of the flavivirus Zika and neurological complications, such as Guillain-Barr&#233; syndrome and microcephaly in infants, has brought ...

Yeni Bir Dünyadan Rekombinant Virüsün Kurtarılması ve Karakterizasyonu Zika Virüsü Bulaşıcı Klon

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler