Os autores agradecem a Kristen Bullard-Feibelman, Milena Veselinovic e Claudia Rückert por sua assistência na caracterização do vírus derivado de clones. Este trabalho foi apoiado em parte por doações do Instituto Nacional de Alergia e Doenças Infecciosas, NIH sob subsídios AI114675 (BJG) e AI067380 (GDE).

1. Transformação e Recuperação de Plasmídeos de Clone Infecciosos <ol><li> Transforme ambos os plasmídeos (separadamente) usando um protocolo de transformação comercial ( por exemplo , NEB 5 Minute Transformation Protocol) com algumas modificações. Ambos os plasmídeos contêm um gene que codifica a resistência à ampicilina, portanto, use ampicilina ou carbenicilina para seleção. A carbanilhilina é preferida, pois é mais estável. <ol><li> Remova as células (veja a Tabela de Materiais) a partir de um congelador de -80 ° C e descongelar no gelo durante 5-10 min. Caldo de lisogenia de pré-aquecimento (LB) (contendo placas de 10 g / L de NaCl e 25 μg / mL de carbenicilina, chamadas LB-carb) e o caldo com repressão de catabolitos (SOC (sem antibióticos) - chegando com as células) a 37 ° C. </li><li> Adicionar entre 100 pg-10 ng em 1 μL de ADN plasmídico a um tubo contendo 50 μL de células competentes; Misture suavemente acendendo o tubo. </li><li> Incubar tubos em gelo durante 5 min. </li><li> Tubos de choque térmico a 42 ° C durante 30 sEm banho-maria. Retorne ao gelo durante 2 minutos imediatamente após choque térmico. </li><li> Pipetar 950 μL de temperatura ambiente COS em cada tubo e misturar por pipetagem. Distribuir 100 μL da mistura bacteriana sobre uma placa LB-carb e incubar durante a noite a 37 ° C (aproximadamente 12-14 h). </li></ol></li><li> Retire as placas da incubadora a 37 ° C após 12-14 h de incubação. Coloque as placas em uma gaveta escura à temperatura ambiente para permitir que as colônias continuem a crescer (aproximadamente 8-9 h). </li><li> Usando 5 mL de caldo Terrific (TB, contendo 25 μg / mL de carbenicilina, chamado TB-carb), cresça 5-10 pequenas colônias para cada plasmídeo durante a noite a 30 ° C em um agitador bacteriano (aproximadamente 14-16 h). NOTA: As pequenas colônias são um indicador de que o plasmídeo está intacto; Colônias com plasmídeos contendo deleções, rearranjos ou mutações (aqui denominados eventos de instabilidade) crescerão mais rapidamente e, portanto, serão maiores. Portanto, deve-se tentar escolher as colônias mais pequenas na placa, especificamente nãoT selecionando as maiores colônias presentes. Algumas colônias de tamanho médio também podem ser selecionadas para integridade. A menor temperatura utilizada reduz a probabilidade de as células serem superadas (OD 600 acima de 0,6-0,8). Como a maioria dos pesquisadores realiza um crescimento durante a noite, ele permite mais controle e menor chance de crescimento excessivo. </li><li> Verifique as culturas líquidas para turbidez (aproximadamente OD 600 de 0,6-0,8). Coloque os tubos turvos a 4 ° C e permita que outros tubos se tornem turvos crescendo por mais tempo. NOTA: Não produza bactérias para OD 600 valores maiores que o recomendado, pois podem ocorrer eventos de instabilidade plasmídica. </li><li> Extrair DNA de plasmídeo de bactérias com um kit de miniprep de plasmídeo comercial (ver Tabela de Materiais). Eluir em 15 μL de tampão de eluição pré-aquecido (até 70 ° C em um bloco de aquecimento). Permitir que o tampão de eluição incuba na coluna durante 5 minutos antes da centrifugação. NOTA: Preserve pelo menos 1 mL desta cultura inicial a 4 ° C paraMais uma vez na próxima etapa. </li><li> Digerir 10 μL dos plasmídeos recuperados para avaliar se os eventos de instabilidade plasmídica ocorreram durante a cultura. NOTA: digerir p1 com SalI / NheI e p2 com BamHI / HindIII a 37 ° C durante 1 h. Confirme a presença das bandas corretas após a digestão ( Figura 2a ) por eletroforese em gel e avance para o passo 2. Se estiver preparando DNA de plasmídeo por amplificação do círculo de rolamento (RCA), reserve alguns dos eluentes de miniprep para servir como modelo. </li></ol> 2. Preparação de ADN de plasmídeo suficiente para ligadura NOTA: A ligação e a subsequente eletroporação requerem uma quantidade suficiente de DNA plasmídico que deve ser gerado através de maxiprep ou RCA. Embora a maxiprep seja a abordagem tradicionalmente utilizada, a RCA oferece a vantagem de não requerer bactérias, eliminando o potencial de toxicidade induzida por plasmídeos em bactérias que podem resultar em eventos de instabilidade. <ol><li><stRong&gt; Execute o seguinte procedimento de maxiprep. <ol><li> Para cada plasmídeo que demonstrou o padrão de digestão da enzima de restrição correto na seção anterior, adicione 500 μL de cultura de iniciador a 1 L de carbeno de TB-Carb (25 μg / mL) e agite durante a noite a 30 ° C (aproximadamente 14-16 h , Aproximadamente OD 600 de 0,6-0,8). NOTA: Não permita que a cultura cresça sobre este valor OD 600 . Isso irá potencialmente resultar em eventos de instabilidade dentro dos plasmídeos. </li><li> Colhe as bactérias e realize maxipreps por protocolo do fabricante (veja Tabela de Materiais). </li></ol></li><li> Usando o miniprep salvo da etapa 1.6, execute o seguinte para o procedimento RCA. <ol><li> Transferir 1 μL de ADN plasmídico para um tubo contendo 50 μL de tampão de amostra. </li><li> Desnaturar a amostra a 95 ° C durante 3 minutos e depois incubar a 4 ° C até estar pronto para usar. </li><li> Prepare a amplificação comercialPré -mistura (ver tabela de materiais ). Combine 50 μL de tampão de reação com 2 μL de mistura enzimática em um conjunto de tubos em gelo. NOTA: A pré-amplificação deve ser mantida em gelo até estar pronta para uso. É conveniente preparar uma mistura principal combinando reagentes suficientes para o número necessário de reações de amplificação. Qualquer pré-mistura não utilizada deve ser descartada. </li><li> Transferir 50 μL de pré-mistura de amplificação preparada para a amostra desnaturada. </li><li> Incubar os tubos de reação a 30 ° C durante 18 h. </li><li> Incubar os tubos a 65 ° C durante 10 min para inativar a polimerase de DNA ø29. </li><li> Armazene os tubos de reação a 4 ° C ou -20 ° C até estar pronto para uso. NOTA: Neste ponto, o DNA de plasmídeo preparado através de ambos os métodos deve ser quantificado (usando absorvância a 260 nm) e o genoma de ZIKV deve ser Sanger sequenciado inteiramente para confirmar que não ocorreram eventos de instabilidade (deleções e rearranjos) durante a preparação. </li></ol></li></ol><table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Nome do Primer </td><td> Sequência (5 &#39;- 3&#39;) </td></tr><tr><td> ZIKV PRVABC59 1For. </td><td> AGTTGTTGATCTGTGTGAATCAGAC </td></tr><tr><td> ZIKV Conserved 632For. </td><td> GCCCTATGCTGGATGAGG </td></tr><tr><td> ZIKV Conserved 692Rev. </td><td> GGTTCCGTACACAACcCAAGTTG </td></tr><tr><td> ZIKV Conserved 1313Rev. </td><td> CTCCCTTTGCCAAAAAGTCCACA </td></tr><tr><td> ZIKV Conserved 1201For. </td><td> CCAACACAAGGTGAAGCCTAC </td></tr><tr><td> ZIKV Conserved 1663For. </td><td> GCAGACACCGGAACTCCACACT </td></tr><tr><td> ZIKV Conserved 2008For. </td><td> CAGATGGCGGTGGACATGC </td></tr><tr><td> ZIKV Conserved 2350Rev. </td><td> GTGAGAACCAGGACATTCCTCC </td></tr><tr><td> ZIKV Conserved 2605For. </td><td> TACAAGTACCATCCTGACTCCC </td></tr><tr><td> ZIKV Conserved 3499Rev. </td><td>GCCTTATCTCCATTCCATACCA </td></tr><tr><td> ZIKV Conserved 3961Rev. </td><td> TTGCCAACCAGGCCAAAG </td></tr><tr><td> ZIKV Conserved 4132For. </td><td> CATTTGTCATGGCCCTGG </td></tr><tr><td> ZIKV Conserved 4561Rev. </td><td> CTATTGGGTTCATGCCACAGAT </td></tr><tr><td> ZIKV Conserved 4665For. </td><td> GACCACAGATGGAGTGTACAGAGT </td></tr><tr><td> ZIKV Conserved 5189Rev. </td><td> AAGACAGTTAGCTGCTTCTTCTTCAG </td></tr><tr><td> ZIKV Conserved 5219For. </td><td> GAGAGTTCTTCCTGAAATAGTCCGTGA </td></tr><tr><td> ZIKV Conserved 6086Rev. </td><td> CTTGCTTCAAGCCAGTGTGC </td></tr><tr><td> ZIKV Conserved 6119For. </td><td> GCCTCATAGCCTCGCTCTATCG </td></tr><tr><td> ZIKV Conserved 6721Rev. </td><td> CCATTCCAAAGCCCATCTTCCC </td></tr><tr><td> ZIKV Conserved 6769For. </td><td> CCAGCCAGAATTGCATGTGTCC </td></tr><tr><td> ZIKV Conserved 7209Rev. </td><td> ATCATTAGCAGCGGGACTCCAA </td></tr><tr><td> ZIKV Conservado 7343Para. </td><td> GTTGTGGATGGAATAGTGGT </td></tr><tr><td> ZIKV Conserved 8243For. </td><td> TGCCCATACACCAGCACTATGA </td></tr><tr><td> ZIKV PRVABC59 8893Rev. </td><td> TGCATTGCTACGAACCTTGTTG </td></tr><tr><td> ZIKV conservou 9133Para. </td><td> AGCCCTTGGATTCTTGAACGAGGA </td></tr><tr><td> ZIKV PRVABC59 9673Rev. </td><td> AACGCAATCATCTCCACTGACT </td></tr><tr><td> ZIKV Conserved 9686For. </td><td> GATGATAGGTTTGCACATGCC </td></tr><tr><td> ZIKV Conserved 10321Rev. </td><td> GTCCATGTACTTTTCTTCATCACCTAT </td></tr><tr><td> ZIKV Conserved 10455For. </td><td> CAGGAGAAGCTGGGAAACC </td></tr><tr><td> ZIKV Conserved 10621Rev. </td><td> CAGATTGAAGGGTGGGGAAGGTC </td></tr></tbody></table> Tabela 1: Primers para sequenciação de clones de cDNA. Os plasmídeos podem ser sequenciados inteiramente com os primers listados. Primers marcados como &quot;conservados&quot; indiCate que provavelmente são capazes de seqüenciar / amplificar todos os genótipos de ZIKV. Os primers rotulados como &quot;PRVABC59&quot; são específicos desta cepa, mas também podem funcionar para outras estirpes de genótipos asiáticos e possivelmente outros genótipos. 3. Preparação de ARN transcrito in vitro <ol><li> Configure a reação de digestão de DNA maxiprep ou RCA preparado. <ol><li> Para a digestão com p1, misture 10 μL de tampão de reação 10x, 3 μL de ApaLI, 3 μL de BamHI-HF, 3 μL de rSAP ou CIP e 3,3 μg de DNA p1. Adicione ddH 2 O a 100 μL. </li><li> Para a digestão com p2, misture 10 μL de 10x de tampão de reação, 3 μL de ApaLI, 3 μL de EcoRI-HF e 13,3 μg de DNA de p2. Adicione ddH 2 O a 100 μL. </li><li> Incubar a 37 ° C por 1-2 h. </li><li> Purifique usando um gel comercial e um kit de limpeza de PCR (veja a Tabela de Materiais). Eluir em 30 μL de tampão de eluição pré-aquecido a 70 ° C em um bloco de aquecimento (incubar oColuna por 5 min antes de girar). NOTA: Mantenha 1 μL para funcionar em um gel mais tarde. </li></ol></li><li> Prepare a reação de ligação. <ol><li> Combina 10 μL de tampão de reacção de ligação de ADN T4 10x, 3 μL de T4 DNA ligase (400 U / μL), 29 μL de p1 purificado e 29 μL de p2 purificado. Adicione ddH 2 O a 100 μL. </li><li> Incubar à temperatura ambiente durante 2 h ou 16 ° C durante a noite. </li><li> Purifique usando um gel comercial e um kit de limpeza de PCR (veja a Tabela de Materiais). Eluir em 10 μL de tampão de eluição pré-aquecido a 70 ° C em um bloco de aquecimento (incubar coluna durante 5 minutos antes de girar). NOTA: Mantenha 1 μL para funcionar em um gel mais tarde. </li></ol></li><li> Executar plasmídeos não digeridos, plasmídeos digeridos e ligação em um gel de agarose. O produto de ligação deve ter uma banda de peso molecular mais elevado (cerca de 11 kb) do que o plasmídeo digerido isolado, indicando que a ligação foi bem sucedida ( Figura 2b ).</li><li> Configure a reação de transcrição in vitro T7. <ol><li> Combine 10 μL de mistura ARCA / NTP 2x, 2 μL de mistura de ARN polimerase T7 e 8 μL de reação de ligação purificada para um volume final de 20 μL. NOTA: O ARCA incluído na mistura é um sensor analógico que é incorporado exclusivamente na orientação correta. Os análogos da capa padrão podem resultar em apenas ~ 50% dos transcritos com uma tampa na orientação correta. </li><li> Incubar durante 4 h a 37 ° C. </li><li> Medir a concentração de ARN através de um espectrofotômetro UV. Opcionalmente, execute um gel de agarose desnaturante para confirmar o comprimento da transcrição de RNA. </li></ol></li></ol> 4. Resgate de vírus infeccioso por eletroporação <ol><li> Dias antes da eletroporação, preparar 1 balão T182 de células Vero (entre T150 e T182 é aceitável, cultivado em DMEM + 10% de soro fetal bovino (FBS)) por construção a ser recuperada. Inclua 1 T182 como um controle de transfecção simulada. CeLls devem ser utilizados em uma confluência de 70-80%. </li><li> Quando as células estão prontas, coloque 12 mL / reação de DMEM + 15% de FBS + 10 mM de HEPES em um banho de água aquecido a 37 ° C. </li><li> Descarte as células por tripsinização com um protocolo padrão e recupera as células na mídia com FBS a 10% para inativar a tripsina; Centrifugação de células a 150 xg durante 5 min a 4 ° C. </li><li> Lavar células em 1x solução salina tamponada com fosfato (PBS), células de sedimentação a 150 xg durante 5 min a 4 ° C. Repita este passo duas vezes para um total de três lavagens. </li><li> Ressuspender células em 200 μL de RPMI 1640 + HEPES 10 mM (estéril) por número de amostras. Transfira 200 μL de suspensão celular para um tubo estéril. As células devem ser ~ 0,5 x 10 7 células / mL. </li><li> Adicionar 20 μL de água (mock neg control) ou 20 μL de RNA (de preferência 5-10 μg) produzido no passo 3.4 para cada conjunto de células. Misture suavemente puxando o tubo e transfira o conteúdo do tubo para uma cubeta de eletroporação de intervalo de 2 mm. </li><li> Defina um elétronOporador para 170 V LV, omega (resistência) a 0 e 950 μF (aproximadamente a 625 V / cm e 20 ms constante para outras máquinas). Configure a resistência à configuração mais baixa disponível, seja 0 ou ∞ se disponível. </li><li> Pulso uma vez e imediatamente adicionar 600 μL de DMEM + 15% FBS + 10 mM HEPES que foi aquecido no passo 4.2. Enxágue dentro da cuvete cuidadosamente para remover todas as células. Adicionar células a um balão de cultura de tecido T75 contendo 10 mL de meio pré aquecido. Remova a mídia adicional da cuvete usando o conta-gotas que acompanha a cuvete. Tenha cuidado para manter a esterilidade. </li><li> Balão de redemoinho para misturar meios e células e colocar em uma incubadora de 37 ° C. </li><li> Verifique no dia seguinte a viabilidade celular e faça-o todos os dias até 50-75% de morte celular. A morte celular é observada comparando-se ao mock controle eletroporado. NOTA: O efeito citopático ZIKV (CPE) é bastante pronunciado nas células Vero, resultando em células arredondadas que se destacam e flutuam no meio de cultura. Nós temosObservou uma faixa de 8-10 dias como ideal para a colheita. </li><li> Coloque o sobrenadante em um tubo cônico e centrifugue para remover detritos celulares a&gt; 3,000 xg durante 10 min a 4 ° C. </li><li> Remova o sobrenadante esclarecido para um novo tubo e adicione-o com uma concentração final de FBS a 20% (de 100% de estoque). Adicionalmente, adicione HEPES estéril a uma concentração final de 10 mM como agente tampão para preservar a infecciosidade do vírus enquanto está congelado (a partir de um estoque esterilizado de 1 M). </li><li> Misture o vírus por vórtice e alíquota em frascos de tampa roscada. Armazene a -80 ° C para uso futuro. </li></ol> 5. Titulação do vírus recuperado <ol><li> Seed o número apropriado de placas de 6 ou 12 poços de células Vero no dia anterior à titulação. </li><li> Remova o vírus do congelador e faça diluições em série de 10 vezes em DMEM + 2% de FBS em tubos ou placas de 96 poços. NOTA: O título esperado dos clones recuperados é entre 1 x 10 6 e 5 x 10 7 PFU / mL. </li><li> Adicione 200 oR 400 μL de cada diluição em duplicado para um poço de uma placa de 12 ou 6 poços, respectivamente. </li><li> Coloque as placas em uma incubadora a 37 ° C e roote a cada 15 minutos, para um período total de ~ 1-1,5 h de adsorção. </li><li> Remova o inóculo viral e adicione 1 mL de (12 poços) ou 2 mL (6 poços) de aderência DMGM-Tragacanto a cada poço. NOTA: É possível usar agarose, ágar, metilcelulose ou outro meio de sobreposição aqui. </li><li> Incubar células em incubadora a 37 ° C durante 5 dias. O tempo para a formação adequada da placa irá variar dependendo da sobreposição utilizada. </li><li> Para consertar células, remova as placas da incubadora e decanta a sobreposição suavemente em desinfetante. </li><li> Adicione suficiente 20% de etanol / 0,1% de violeta de cristal (CV) a cada poço para cobrir e girar para misturar. NOTA: Muitos outros fixadores existem e podem ser usados ​​aqui. Além disso, se estiver usando uma sobreposição de agarose ou ágar, uma segunda sobreposição pode ser usada em conjunto com vermelho neutro para visualizar placas sem fixação. 20% de etanol mostrou-se serEficaz na inativação de vírus envolvidos em estudos anteriores; Não use esse valor para vírus não envolvidos, pois não serão inativados 19 . </li><li> Incube as placas durante 30-60 minutos à temperatura ambiente (num gabinete de biossegurança de classe II); Descarte CV (por regulação local) e lave as placas com água da torneira. </li><li> Deixe as placas secar e contamine as placas manualmente. NOTA: Referência 20 pode ser usado como uma referência adicional para realizar ensaios de placa. </li></ol>

<ol>
	<li>Kindhauser, M. K., Allen, T., Frank, V., Santhana, R. S., Dye, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika:+the+origin+and+spread+of+a+mosquito-borne+virus.">Zika: the origin and spread of a mosquito-borne virus.</a> Bull World Health Organ. 94 (9), 675C-686C (2016).</li><li>Oehler, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika+virus+infection+complicated+by+Guillain-Barre+syndrome--case+report,+French+Polynesia,+December+2013.">Zika virus infection complicated by Guillain-Barre syndrome--case report, French Polynesia, December 2013.</a> Euro Surveill. 19 (9), (2014).</li><li>Li, D., Aaskov, J., Lott, W. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+cryptic+prokaryotic+promoter+within+the+cDNA+encoding+the+5'+end+of+dengue+virus+RNA+genome.">Identification of a cryptic prokaryotic promoter within the cDNA encoding the 5' end of dengue virus RNA genome.</a> PLoS One. 6 (3), e18197 (2011).</li><li>Pu, S. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+approach+to+propagate+flavivirus+infectious+cDNA+clones+in+bacteria+by+introducing+tandem+repeat+sequences+upstream+of+virus+genome.">A novel approach to propagate flavivirus infectious cDNA clones in bacteria by introducing tandem repeat sequences upstream of virus genome.</a> J Gen Virol. 95 (Pt 7), 1493-1503 (2014).</li><li>Pu, S. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Successful+propagation+of+flavivirus+infectious+cDNAs+by+a+novel+method+to+reduce+the+cryptic+bacterial+promoter+activity+of+virus+genomes.">Successful propagation of flavivirus infectious cDNAs by a novel method to reduce the cryptic bacterial promoter activity of virus genomes.</a> J Virol. 85 (6), 2927-2941 (2011).</li><li>Rice, C. M., Grakoui, A., Galler, R., Chambers, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+of+infectious+yellow+fever+RNA+from+full-length+cDNA+templates+produced+by+in+vitro+ligation.">Transcription of infectious yellow fever RNA from full-length cDNA templates produced by in vitro ligation.</a> New Biol. 1 (3), 285-296 (1989).</li><li>Yun, S. I., Kim, S. Y., Rice, C. M., Lee, Y. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+application+of+a+reverse+genetics+system+for+Japanese+encephalitis+virus.">Development and application of a reverse genetics system for Japanese encephalitis virus.</a> J Virol. 77 (11), 6450-6465 (2003).</li><li>Gualano, R. C., Pryor, M. J., Cauchi, M. R., Wright, P. J., Davidson, A. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+major+determinant+of+mouse+neurovirulence+of+dengue+virus+type+2+using+stably+cloned+genomic-length+cDNA.">Identification of a major determinant of mouse neurovirulence of dengue virus type 2 using stably cloned genomic-length cDNA.</a> J Gen Virol. 79 (Pt 3), 437-446 (1998).</li><li>Johansen, I. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intron+insertion+facilitates+amplification+of+cloned+virus+cDNA+in+Escherichia+coli+while+biological+activity+is+reestablished+after+transcription+in+vivo.">Intron insertion facilitates amplification of cloned virus cDNA in Escherichia coli while biological activity is reestablished after transcription in vivo.</a> Proc Natl Acad Sci U S A. 93 (22), 12400-12405 (1996).</li><li>Shan, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Infectious+cDNA+Clone+of+Zika+Virus+to+Study+Viral+Virulence,+Mosquito+Transmission,+and+Antiviral+Inhibitors.">An Infectious cDNA Clone of Zika Virus to Study Viral Virulence, Mosquito Transmission, and Antiviral Inhibitors.</a> Cell Host Microbe. 19 (6), 891-900 (2016).</li><li>Schwarz, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rescue+of+the+1947+Zika+Virus+Prototype+Strain+with+a+Cytomegalovirus+Promoter-Driven+cDNA+Clone.">Rescue of the 1947 Zika Virus Prototype Strain with a Cytomegalovirus Promoter-Driven cDNA Clone.</a> mSphere. 1 (5), (2016).</li><li>Tsetsarkin, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Full-Length+Infectious+cDNA+Clone+of+Zika+Virus+from+the+2015+Epidemic+in+Brazil+as+a+Genetic+Platform+for+Studies+of+Virus-Host+Interactions+and+Vaccine+Development.">A Full-Length Infectious cDNA Clone of Zika Virus from the 2015 Epidemic in Brazil as a Genetic Platform for Studies of Virus-Host Interactions and Vaccine Development.</a> MBio. 7 (4), (2016).</li><li>Gadea, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+robust+method+for+the+rapid+generation+of+recombinant+Zika+virus+expressing+the+GFP+reporter+gene.">A robust method for the rapid generation of recombinant Zika virus expressing the GFP reporter gene.</a> Virology. 497, 157-162 (2016).</li><li>Kapoor, M., Zhang, L., Mohan, P. M., Padmanabhan, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+and+characterization+of+an+infectious+dengue+virus+type-2+RNA+genome+(New+Guinea+C+strain).">Synthesis and characterization of an infectious dengue virus type-2 RNA genome (New Guinea C strain).</a> Gene. 162 (2), 175-180 (1995).</li><li>Messer, W. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+characterization+of+a+reverse+genetic+system+for+studying+dengue+virus+serotype+3+strain+variation+and+neutralization.">Development and characterization of a reverse genetic system for studying dengue virus serotype 3 strain variation and neutralization.</a> PLoS Negl Trop Dis. 6 (2), e1486 (2012).</li><li>Kinney, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avian+virulence+and+thermostable+replication+of+the+North+American+strain+of+West+Nile+virus.">Avian virulence and thermostable replication of the North American strain of West Nile virus.</a> J Gen Virol. 87 (Pt 12), 3611-3622 (2006).</li><li>Chang, A. C., Cohen, S. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+amplifiable+multicopy+DNA+cloning+vehicles+derived+from+the+P15A+cryptic+miniplasmid.">Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid.</a> J Bacteriol. 134 (3), 1141-1156 (1978).</li><li>Weger-Lucarelli, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+Characterization+of+Recombinant+Virus+Generated+from+a+New+World+Zika+Virus+Infectious+Clone.">Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone.</a> J Virol. 91 (1), (2017).</li><li>Roberts, P. L., Lloyd, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus+inactivation+by+protein+denaturants+used+in+affinity+chromatography.">Virus inactivation by protein denaturants used in affinity chromatography.</a> Biologicals. 35 (4), 343-347 (2007).</li><li>Baer, A., Kehn-Hall, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+concentration+determination+through+plaque+assays:+using+traditional+and+novel+overlay+systems.">Viral concentration determination through plaque assays: using traditional and novel overlay systems.</a> J Vis Exp. (93), e52065 (2014).</li><li>Weger-Lucarelli, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+Characterization+of+Recombinant+Virus+Generated+from+a+New+World+Zika+Virus+Infectious+Clone.">Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone.</a> J Virol. , (2016).</li><li>Grubaugh, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+Drift+during+Systemic+Arbovirus+Infection+of+Mosquito+Vectors+Leads+to+Decreased+Relative+Fitness+during+Host+Switching.">Genetic Drift during Systemic Arbovirus Infection of Mosquito Vectors Leads to Decreased Relative Fitness during Host Switching.</a> Cell Host Microbe. 19 (4), 481-492 (2016).</li></ol>

Os autores não têm nada a revelar.

Here we describe a method for the recovery of a bipartite infectious cDNA clone system for ZIKV. Previously described clones for ZIKV suffer from either attenuation or require the addition of introns, making plasmids larger and preventing rescue in insect cells. Infectious virus can be recovered using the two-plasmid clone system in either mammalian or insect cells (data not shown). In addition, virus recovered from this system behaves similarly to wild-type virus in several cell lines, in an immunocompromised mouse mode...

O vírus Zika (ZIKV; Família Flaviviridae : Gênero Flavivírus ) é um flavivírus transmitido por mosquito que chegou ao Brasil em 2013-14 e posteriormente foi associado a um surto maciço de doença febril que se espalhou pelas Américas 1 . Além disso, o ZIKV tem sido associado a desfechos graves da doença, como a síndrome de Guillain-Barré em adultos e microcefalia em fetos e neonatos 2 . Pouco se sabia sobre ZIKV antes da sua rápida propagação no hemisfério ocidental. Isso incluiu a falta de ferramentas moleculares, dificultando assim a pesquisa mecanicista. Ferramentas moleculares para vírus, tais como clones de cDNA infecciosos, facilitam a vacina e o desenvolvimento terapêutico antiviral e permitem a avaliação de fatores genéticos virais relacionados à patogênese viral diferencial, resposta imune e evolução viral. Os clones infecciosos de Flavivirus são conhecidos por serem altamente instáveis ​​em bactérias devido a crPromotores procarióticos ypticos presentes em seus genomas 3 . Várias abordagens têm sido usadas para melhorar esse problema; Incluindo a inserção de repetições em tandem a montante das sequências virais 4 , mutação das seqüências promotoras procarióticas putativas 5 , dividindo o genoma em múltiplos plasmídeos 6 , vetores numéricos de baixa cópia (incluindo cromossomos artificiais bacterianos) 7 , 8 e inserção de intrões no genoma viral 9 . Um sistema completo sem modificações foi descrito para ZIKV; No entanto, este clone pareceu ser atenuado na cultura celular e em camundongos 10 . Outros grupos criaram intrões no genoma de ZIKV, permitindo a interrupção de seqüências instáveis ​​em bactérias que podem ser empalmadas em células de mamíferos in vitro para a produção de vírus infecciosos 11, 12 . Além disso, um sistema baseado em PCR, intitulado Infectious-Subgenomic-Amplicons, foi utilizado com sucesso para resgatar o protótipo MR766 de ZIKV 13 . A abordagem descrita aqui não requer seqüências estranhas, mas sim interrompe o genoma na região de alta instabilidade usando múltiplos plasmídeos, que já foram utilizados com sucesso com vírus da febre amarela 6 , dengue 14 , 15 e do Nilo Ocidental 16 . Além disso, a adição da sequência de ribozima da hepatite D no terminal genômico viral facilita a criação de um autêntico final 3 &#39;sem a necessidade de adicionar um site de linearização. Além disso, ambos os plasmídeos são construídos em um vetor de números de baixa cópia (pACYC177, ~ 15 cópias por célula) para mitigar qualquer toxicidade residual 17 . O vírus recuperado exibe um perfil de crescimento comparável aoVírus parental em curvas de crescimento in vitro em 8 linhas celulares compreendendo uma variedade de tipos de células derivadas de mamíferos e insetos e exibiu perfis patogênicos idênticos em camundongos e taxas de infecção, disseminação e transmissão em mosquitos 18 . Aqui, detalhamos um protocolo descrevendo como cultivar os plasmídeos de clones infecciosos, gerar RNA viral completo (o genoma viral) in vitro e recuperar vírus infecciosos em cultura celular. Primeiro, descrevemos a propagação de plasmídeos em bactérias ou amplificação sem bactérias usando amplificação do círculo circulante (RCA). Em seguida, mostramos como os dois plasmídeos são digeridos e subsequentemente ligados em conjunto para gerar vírus de comprimento total. Finalmente, descrevemos a produção de ARN transcrito e sua subsequente eletroporação em células Vero, seguidas de titulação de vírus recuperado ( Figura 1 ). A abordagem descrita é rápida, permitindo queR recuperação de stocks de vírus infecciosos em 1-2 semanas.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>NEB Stable CompetentE. coli</td>
			<td>New England BioLabs</td>
			<td>C3040H</td>
			<td></td>
		</tr>
		<tr>
			<td>Carbenicillin, Disodium Salt</td>
			<td>various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Zyppy Plasmid Miniprep Kit</td>
			<td>Zymo Research</td>
			<td>D4036</td>
			<td></td>
		</tr>
		<tr>
			<td>ZymoPURE Plasmid Maxiprep Kit</td>
			<td>Zymo Research</td>
			<td>D4202</td>
			<td></td>
		</tr>
		<tr>
			<td>SalI-HF</td>
			<td>New England BioLabs</td>
			<td>R3138S</td>
			<td>20,000 units/ml</td>
		</tr>
		<tr>
			<td>NheI-HF</td>
			<td>New England BioLabs</td>
			<td>R3131S</td>
			<td>20,000 units/ml</td>
		</tr>
		<tr>
			<td>ApaLI</td>
			<td>New England BioLabs</td>
			<td>R0507S</td>
			<td>10,000 units/ml</td>
		</tr>
		<tr>
			<td>EcoRI-HF</td>
			<td>New England BioLabs</td>
			<td>R3101S</td>
			<td>20,000 units/ml</td>
		</tr>
		<tr>
			<td>BamHI-HF</td>
			<td>New England BioLabs</td>
			<td>R3136S</td>
			<td>20,000 units/ml</td>
		</tr>
		<tr>
			<td>HindIII-HF</td>
			<td>New England BioLabs</td>
			<td>R3104S</td>
			<td>20,000 units/ml</td>
		</tr>
		<tr>
			<td>illustra TempliPhi 100 Amplification Kit</td>
			<td>GE Healthcare Life Sciences</td>
			<td>25640010</td>
			<td></td>
		</tr>
		<tr>
			<td>NucleoSpin Gel and PCR Clean-up</td>
			<td>Macherey-Nagel</td>
			<td>740609.5</td>
			<td></td>
		</tr>
		<tr>
			<td>Shrimp Alkaline Phosphatase (rSAP)</td>
			<td>New England BioLabs</td>
			<td>M0371S</td>
			<td>1,000 units/ml</td>
		</tr>
		<tr>
			<td>Alkaline Phosphatase, Calf Intestinal (CIP)</td>
			<td>New England BioLabs</td>
			<td>M0290S</td>
			<td>10,000 units/ml</td>
		</tr>
		<tr>
			<td>T4 DNA Ligase</td>
			<td>New England BioLabs</td>
			<td>M0202S</td>
			<td>400,000units/mL</td>
		</tr>
		<tr>
			<td>HiScribe T7 ARCA mRNA Kit</td>
			<td>New England BioLabs</td>
			<td>E2065S</td>
			<td></td>
		</tr>
		<tr>
			<td>Vero cells</td>
			<td>ATCC</td>
			<td>CCL-81</td>
			<td></td>
		</tr>
		<tr>
			<td>ECM 630 High Throughput Electroporation System</td>
			<td>BTX</td>
			<td>45-0423</td>
			<td>Other machines are acceptable.</td>
		</tr>
		<tr>
			<td>LB Broth with agar (Miller)</td>
			<td>Sigma</td>
			<td>L3147</td>
			<td>Can be homemade as well.</td>
		</tr>
		<tr>
			<td>Terrific Broth</td>
			<td>Sigma</td>
			<td>T0918</td>
			<td>Can be homemade as well.</td>
		</tr>
		<tr>
			<td>Petri Dish</td>
			<td>Celltreat</td>
			<td>229693</td>
			<td></td>
		</tr>
		<tr>
			<td>Culture Tubes</td>
			<td>VWR International</td>
			<td>60818-576</td>
			<td></td>
		</tr>
		<tr>
			<td>T75 flasks</td>
			<td>Celltreat</td>
			<td>229340</td>
			<td></td>
		</tr>
		<tr>
			<td>T182 flasks</td>
			<td>Celltreat</td>
			<td>229350</td>
			<td></td>
		</tr>
		<tr>
			<td>1x PBS</td>
			<td>Corning</td>
			<td>21-040-CV</td>
			<td></td>
		</tr>
		<tr>
			<td>RPMI 1640 with L-glutamine</td>
			<td>Corning</td>
			<td>10-040-CV</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM with L-glutamine and 4.5 g/L glucose</td>
			<td>Corning</td>
			<td>10-017-CV</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>Atlas Biologicals</td>
			<td>FP-0500-A</td>
			<td></td>
		</tr>
		<tr>
			<td>Tragacanth Powder</td>
			<td>MP Bio</td>
			<td>MP 104792</td>
			<td></td>
		</tr>
		<tr>
			<td>Crystal Violet</td>
			<td>Amresco</td>
			<td>0528-1006</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol Denatured</td>
			<td>VWR International</td>
			<td>BDH1156-1LP</td>
			<td></td>
		</tr>
		<tr>
			<td>6 well plate</td>
			<td>Celltreat</td>
			<td>229106</td>
			<td></td>
		</tr>
		<tr>
			<td>12 well plate</td>
			<td>Celltreat</td>
			<td>229111</td>
			<td></td>
		</tr>
		<tr>
			<td>Sequencing Oligos</td>
			<td>IDT</td>
			<td>see table 1</td>
			<td></td>
		</tr>
		<tr>
			<td>Qubit 3.0</td>
			<td>ThermoFisher</td>
			<td>Qubit 3.0</td>
			<td>other methods are acceptable.</td>
		</tr>
		<tr>
			<td>Qubit dsDNA BR Assay Kit</td>
			<td>ThermoFisher</td>
			<td>Q32850</td>
			<td>other methods are acceptable.</td>
		</tr>
		<tr>
			<td>Qubit RNA HS Assay Kit</td>
			<td>ThermoFisher</td>
			<td>Q32852</td>
			<td>other methods are acceptable.</td>
		</tr>
		<tr>
			<td>Class II Biosafety Cabinet</td>
			<td>Varies</td>
			<td>N/A</td>
			<td>This is necessary for live-virus work.</td>
		</tr>
	</tbody>
</table>

rescue and characterization of recombinant virus from a new world zika virus infectious clone

Os clones de cDNA infecciosos permitem a manipulação genética de um vírus, facilitando assim o trabalho em vacinas, patogênese, replicação, transmissão e evolução viral. Aqui descrevemos a construção de um clone infeccioso para o vírus Zika (ZIKV), que atualmente está causando um surto explosivo nas Américas. Para evitar a toxicidade para bactérias comumente observadas com plasmídeos derivados de flavivírus, geramos um sistema de dois plasmídeos que separa o genoma no gene NS1 e é mais estável que as construções de comprimento total que não puderam ser recuperadas com sucesso sem mutações. Após a digestão e a ligação para unir os dois fragmentos, o ARN viral completo pode ser gerado por transcrição in vitro com polimerase de ARN T7. Após a eletroporação do ARN transcrito nas células, recuperou-se o vírus que apresentava cinética de crescimento in vitro semelhante e fenótipos de virulência e infecção in vivo em camundongos e mosquitos, respectivamente.

O protocolo aqui descrito permite a recuperação do vírus Zika infeccioso derivado de clones. Manipular o sistema de clones infecciosos de dois plasmídeos é direto quando realizado com cuidado, em comparação com versões completas que são altamente instáveis ​​(dados não mostrados). Após a digestão e a ligação das duas peças distintas, o ARN tampado é produzido usando transcrição in vitro com polimerase T7 que é então eletroporada em células Vero ( <stron...

Watch this Scientific Journal Video about Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone at JoVE.com

Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Este protocolo descreve a recuperação do vírus Zika infeccioso a partir de um clone de cDNA infeccioso com dois plasmídeos.

Salvamento e Caracterização do Vírus Recombinante de um Clone Infeccioso do Vírus do Novo Mundo Zika

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral ...

rescue-characterization-recombinant-virus-from-new-world-zika-virus

Research

JoVE Journal

Immunology and Infection

9.6K visualizações.  Colorado State University.  Este protocolo descreve a recuperação do vírus Zika infeccioso a partir de um clone de cDNA infeccioso com dois plasmídeos. 

Vídeo: Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Generation of Recombinant Influenza Virus from Plasmid DNA

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally established in 1999 1,2 plasmid-based reverse genetic techniques to generate recombinant viruses have revolutionized the influenza research field because specific questions have been answered by genetically engineered, infectious, recombinant influenza viruses. Such studies include virus replication, function of viral proteins, the contribution of specific mutations in viral proteins in viral replication and/or pathogenesis and, also, viral vectors using recombinant influenza viruses expressing foreign proteins 3.

Rescue of influenza A viruses from plasmid DNA is a basic and essential experimental technique that allows influenza researchers to generate recombinant viruses to study multiple aspects in the biology of influenza virus, and to be used as potential vectors or vaccines.

Geração de recombinante do vírus Influenza de DNA plasmidial

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally ...

Imunologia e Infecção

Detection of Infectious Virus from Field-collected Mosquitoes by Vero Cell Culture Assay

Mosquitoes transmit a number of distinct viruses including important human pathogens such as West Nile virus, dengue virus, and chickungunya virus. Many of these viruses have intensified in their endemic ranges and expanded to new territories, necessitating effective surveillance and control programs to respond to these threats. One strategy to monitor virus activity involves collecting large numbers of mosquitoes from endemic sites and testing them for viral infection. In this article, we describe how to handle, process, and screen field-collected mosquitoes for infectious virus by Vero cell culture assay. Mosquitoes are sorted by trap location and species, and grouped into pools containing &le;50 individuals. Pooled specimens are homogenized in buffered saline using a mixer-mill and the aqueous phase is inoculated onto confluent Vero cell cultures (Clone E6). Cell cultures are monitored for cytopathic effect from days 3-7 post-inoculation and any viruses grown in cell culture are identified by the appropriate diagnostic assays. By utilizing this approach, we have isolated 9 different viruses from mosquitoes collected in Connecticut, USA, and among these, 5 are known to cause human disease. Three of these viruses (West Nile virus, Potosi virus, and La Crosse virus) represent new records for North America or the New England region since 1999. The ability to detect a wide diversity of viruses is critical to monitoring both established and newly emerging viruses in the mosquito population.

We describe a method to process and screen field-collected mosquitoes for a diversity of viruses by Vero cell culture assay. By employing this technique, we have detected 9 different viruses from 4 taxonomic families in mosquitoes collected in Connecticut.

Detecção de vírus infecciosos de Campo mosquitos coletados por Vero Ensaio Cultura de Células

Mosquitoes transmit a number of distinct viruses including important human pathogens such as West Nile virus, dengue virus, and chickungunya virus. Many ...

Visualizing Dengue Virus through Alexa Fluor Labeling

The early events in the interaction between virus and cell can have profound influence on the outcome of infection. Determining the factors 
that influence this interaction could lead to improved understanding of disease pathogenesis and thus influence vaccine or therapeutic design. Hence, the development 
of methods to probe this interaction would be useful. Recent advancements in fluorophores development1-3 and imaging technology4 can be exploited to 
improve our current knowledge on dengue pathogenesis and thus pave the way to reduce the millions of dengue infections occurring annually.

The enveloped dengue virus has an external scaffold consisting of 90 envelope glycoprotein (E) dimers protecting the nucleocapsid shell, 
which contains a single positive strand RNA genome5. The identical protein subunits on the virus surface can thus be labeled with an amine reactive dye and visualized 
through immunofluorescent microscopy. Here, we present a simple method of labeling of dengue virus with Alexa Fluor succinimidyl ester dye dissolved directly in a sodium 
bicarbonate buffer that yielded highly viable virus after labeling. There is no standardized procedure for the labeling of live virus and existing manufacturer&#x2019;s protocol 
for protein labeling usually requires the reconstitution of dye in dimethyl sulfoxide. The presence of dimethyl sulfoxide, even in minute quantities, can block 
productive infection of virus and also induce cell cytotoxicity6. The exclusion of the use of dimethyl sulfoxide in this protocol thus reduced this possibility. 
Alexa Fluor dyes have superior photostability and are less pH-sensitive than the common dyes, such as fluorescein and rhodamine2, making them ideal for 
studies on cellular uptake and endosomal transport of the virus. The conjugation of Alexa Fluor dye did not affect the recognition of labeled dengue 
virus by virus-specific antibody and its putative receptors in host cells7. This method could have useful applications in virological studies.

Taking advantage of the advancements in fluorophore development and imaging technology, a simple method of Alexa Fluor labeling of dengue virus was devised to visualize the early interactions between virus and cell.

Visualizando Vírus da Dengue por meio Alexa Fluor Labeling

The early events in the interaction between virus and cell can have profound influence on the outcome of infection. Determining the factors 
that ...

Propagating and Detecting an Infectious Molecular Clone of Maedi-visna Virus that Expresses Green Fluorescent Protein

Maedi-visna virus (MVV) is a lentivirus of sheep, causing slowly progressive interstitial pneumonia and encephalitis1. The primary target cells of MVV in vivo are considered to be of the monocyte lineage2. Certain strains of MVV can replicate in other cell types, however3,4. The green fluorescent protein is a commonly used marker for studying lentiviruses in living cells. We have inserted the egfp gene into the gene for dUTPase of MVV. The dUTPase gene is well conserved in most lentivirus strains of sheep and goats and has been shown to be important in replication of CAEV5. However, dUTPase has been shown to be dispensable for replication of the molecular clone of MVV used in this study both in vitro and in vivo6. MVV replication is strictly confined to cells of sheep or goat origin. We use a primary cell line from the choroid plexus of sheep (SCP cells) for transfection and propagation of the virus7. The fluorescent MVV is fully infectious and EGFP expression is stable over at least 6 passages8. There is good correlation between measurements of TCID50 and EGFP. This virus should therefore be useful for rapid detection of infected cells in studies of cell tropism and pathogenicity in vitro and in vivo8.

We describe a molecular clone of maedi-visna virus that expresses GFP and is fully infectious. Replication of this virus can be detected by using fluorescence microscopy and flow cytometry.

Propagação e detecção de um Clone Infecciosas Molecular da Maedi-visna vírus que expressa a proteína fluorescente verde

Maedi-visna virus (MVV) is a lentivirus of sheep, causing slowly progressive interstitial pneumonia and encephalitis1. The primary target cells of MVV in ...

Rescue of Recombinant Newcastle Disease Virus from cDNA

Newcastle disease virus (NDV), the prototype member of the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented, negative-sense, single-stranded, enveloped RNA virus (Figure 1) with potential applications as a vector for vaccination and treatment of human diseases. In-depth exploration of these applications has only become possible after the establishment of reverse genetics techniques to rescue recombinant viruses from plasmids encoding their complete genomes as cDNA2-5. Viral cDNA can be conveniently modified in vitro by using standard cloning procedures to alter the genotype of the virus and/or to include new transcriptional units. Rescue of such genetically modified viruses provides a valuable tool to understand factors affecting multiple stages of infection, as well as allows for the development and improvement of vectors for the expression and delivery of antigens for vaccination and therapy. Here we describe a protocol for the rescue of recombinant NDVs.

Newcastle disease virus (NDV) has been extensively studied in the last few years in order to develop new vectors for vaccination and therapy, among others. These studies have been possible due to techniques to rescue recombinant virus from cDNA, such as those we describe here.

Resgate de Vírus da Doença de Newcastle recombinante de cDNA

Newcastle disease virus (NDV), the prototype member of  the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented,  negative-sense, ...

Neutrophil Isolation and Analysis to Determine their Role in Lymphoma Cell Sensitivity to Therapeutic Agents

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of inflammation. They are key players in the innate immune system and play major roles in cancer biology. Neutrophils have been proposed as key mediators of malignant transformation, tumor progression, angiogenesis and in the modulation of the antitumor immunity; through their release of soluble factors or their interaction with tumor cells. To characterize the specific functions of neutrophils, a fast and reliable method is coveted for in vitro isolation of neutrophils from human blood. Here, a density gradient separation method is demonstrated to isolate neutrophils as well as mononuclear cells from the blood. The procedure consists of layering the density gradient solution such as Ficoll carefully above the diluted blood obtained from patients diagnosed with chronic lymphocytic leukemia (CLL), followed by centrifugation, isolation of mononuclear layer, separation of neutrophils from RBCsby dextran then lysis of residual erythrocytes. This method has been shown to isolate neutrophils &#8805; 90 % pure. To mimic the tumor microenvironment, 3-dimensional (3D) experiments were performed using basement membrane matrix such as Matrigel. Given the short half-life of neutrophils in vitro, 3D experiments with fresh human neutrophils cannot be performed. For this reason promyelocytic HL60 cells are differentiated along the granulocytic pathway using the differentiation inducers dimethyl sulfoxide (DMSO) and retinoic acid (RA). The aim of our experiments is to study the role of neutrophils on the sensitivity of lymphoma cells to anti-lymphoma agents. However these methods can be generalized to study the interactions of neutrophils or neutrophil-like cells with a large range of cell types in different situations.

Neutrophils are the most abundant type of white blood cells. The isolation of neutrophils from human blood by density gradient separation method and the differentiation of human promyelocytic (HL60) cells along the granulocytic pathway are described here; to test their role on sensitivity of lymphoma cells to anti-lymphoma agents.

Isolamento de neutrófilos e análise para determinar seu papel na linfoma sensibilidade das células a agentes terapêuticos

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of ...

Zika Virus Infectious Cell Culture System and the In Vitro Prophylactic Effect of Interferons

Zika Virus (ZIKV) is an emerging pathogen that is linked to fetal developmental abnormalities such as microcephaly, eye defects, and impaired growth. ZIKV is an RNA virus of the Flaviviridae family. ZIKV is mainly transmitted by mosquitoes, but can also be spread by maternal to fetal vertical transmission as well as sexual contact. To date, there are no reliable treatment or vaccine options available to protect those infected by the virus. The development of a reproducible, effective Zika virus infectious cell culture system is critical for studying the molecular mechanisms of ZIKV replication as well as drug and vaccine development. In this regard, a protocol describing a mammalian cell-based in vitro Zika virus culture system for viral production and growth analysis is reported here. Details on the formation of plaques by Zika virus on a cell monolayer and plaque assay for measuring viral titer are presented. Viral genome replication kinetics and double-stranded RNA genome replicatory intermediates are determined. This culture platform was utilized to screen against a library of a small set of cytokines resulting in the identification of interferon-&#945; (IFN-&#945;), IFN-&#946; and IFN-&#947; as potent inhibitors of Zika viral growth. In summary, an in vitro infectious Zika viral culture system and various virological assays are demonstrated in this study, which has the potential to greatly benefit the research community in elucidating further the mechanisms of viral pathogenesis and the evolution of viral virulence. Antiviral IFN-alpha can further be evaluated as a prophylactic, post-exposure prophylactic, and treatment option for Zika virus infections in high-risk populations, including infected pregnant women.

Zika Virus Infectious Cell Culture System and the In Vitro Prophylactic Effect of Interferons

Zika Virus (ZIKV), an emerging pathogen, is linked to fetal developmental abnormalities and microcephaly. The establishment of an effective infectious cell culture system is crucial for studies of ZIKV replication as well as vaccine and drug development. In this study, various virological assays pertaining to ZIKV are illustrated and discussed.

Virus Zika sistema de cultura celular Infecciosas e do<em&gt; In Vitro</em&gt; Efeito profilático de interferões

Zika Virus (ZIKV) is an emerging pathogen that is linked to fetal developmental abnormalities such as microcephaly, eye defects, and impaired growth. ZIKV ...

Zika Virus Specific Diagnostic Epitope Discovery

High-density peptide microarrays allow screening of more than six thousand peptides on a single standard microscopy slide. This method can be applied for drug discovery, therapeutic target identification, and developing of diagnostics. Here, we present a protocol to discover specific Zika virus (ZIKV) diagnostic peptides using a high-density peptide microarray. A human serum sample validated for ZIKV infection was incubated with a high-density peptide microarray containing the entire ZIKV protein translated into 3,423 unique 15 linear amino acid (aa) residues with a 14-aa residue overlap printed in duplicate. Staining with different secondary antibodies within the same array, we detected peptides that bind to Immunoglobulin M (IgM) and Immunoglobulin G (IgG) antibodies present in serum. These peptides were selected for further validation experiments. In this protocol, we describe the strategy followed to design, process, and analyze a high-density peptide microarray.

In this protocol, we describe a technique to discover Zika virus specific diagnostic peptides using a high-density peptide microarray. This protocol can readly be adapted for other emerging infectious diseases.

Zika vírus específico diagnóstico Epitope Discovery

High-density peptide microarrays allow screening of more than six thousand peptides on a single standard microscopy slide. This method can be applied for ...

Rapid, Safe, and Simple Manual Bedside Nucleic Acid Extraction for the Detection of Virus in Whole Blood Samples

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for the rapid bedside inactivation of the Ebola virus during blood sampling for safe nucleic acid (NA) tests by adding a commercial lysis/binding buffer directly into the vacuum blood collection tubes. Using this bedside inactivation approach, we have developed a safe, rapid, and simplified bedside NA extraction method for the subsequent detection of a virus in lysis/binding buffer-inactivated whole blood. The NA extraction is directly performed in the blood collection tubes and requires no equipment or electricity. 
After the blood is collected into the lysis/binding buffer, the contents are mixed by flipping the tube by hand, and the mixture is incubated for 20 min at room temperature. Magnetic glass particles (MGPs) are added to the tube, and the contents are mixed by flipping the collection tube by hand. The MGPs are then collected on the side of the blood collection tube using a magnetic holder or a magnet and a rubber band. The MGPs are washed three times, and after the addition of elution buffer directly into the collection tube, the NAs are ready for NA tests, such as qPCR or isothermal loop amplification (LAMP), without the removal of the MGPs from the reaction. The NA extraction method is not dependent on any laboratory facilities and can easily be used anywhere (e.g., in field hospitals and hospital isolation wards). When this NA extraction method is combined with LAMP and a portable instrument, a diagnosis can be obtained within 40 min of the blood collection.

Here, we present a protocol for the rapid virus nucleic acid extraction from the virus-inactivated whole blood. The extraction is performed directly in the blood collection tubes and requires no equipment or electricity. The method is not dependent on laboratory facilities and can be used anywhere (e.g., in field hospitals).

Extração rápida, segura e simples Manual cabeceira de ácidos nucleicos para a detecção de vírus em amostras de sangue total

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for ...

Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells

The recent emergence of the flavivirus Zika and neurological complications, such as Guillain-Barr&#233; syndrome and microcephaly in infants, has brought serious public safety concerns. Among the risk factors, antibody-dependent enhancement (ADE) poses the most significant threat, as the recent re-emergence of the Zika virus (ZIKV) is primarily in areas where the population has been exposed and is in a state of pre-immunity to other closely related flaviviruses, especially dengue virus (DENV). Here, we describe a protocol for quantifying the effect of human serum antibodies against DENV on ZIKV infection in primary human cells or cell lines.

We describe a method to evaluate the effect of pre-existing immunity against dengue virus on the Zika virus infection by using human serum, primary human cells, and infection quantification by quantitative real-time polymerase chain reaction.

Quantificação de realce dependente de anticorpo do vírus nas células humanas primárias Zika

The recent emergence of the flavivirus Zika and neurological complications, such as Guillain-Barr&#233; syndrome and microcephaly in infants, has brought ...