저자는 클론 파생 바이러스의 특성 규명에 도움을 주신 Kristen Bullard-Feibelman, Milena Veselinovic 및 Claudia Rückert에게 감사드립니다. 이 연구는 국립 알레르기 및 전염병 연구소 (NIH)에서 AI114675 (BJG) 및 AI067380 (GDE) 보조금으로 일부 지원되었습니다.

1. 감염성 클론 Plasmid의 형질 전환 및 회수 <ol><li> 상업적 형질 전환 프로토콜 ( 예 : NEB 5 Minute Transformation Protocol)을 사용하여 두 가지 플라스미드 (일부분)를 변형하여 변형시킨다. 두 플라스미드 모두 암피실린 내성을 나타내는 유전자를 포함하고 있으므로 선택시 암피실린이나 카 베니 실린을 사용하십시오. Carbenicillin은보다 안정적이므로 선호됩니다. <ol><li> -80 ° C의 냉동고에서 세포 (물질 표 참조)를 제거하고 5-10 분 동안 얼음 위에서 녹입니다. 37 ℃에서 카파 보이트 억제 (SOC (항생 물질 없음) - 세포와 함께)와 함께 prewarm lysogeny 국물 (LB) (10g / L NaCl 및 25 μg / ML carbenicillin을 포함, LB - carb라는) 접시와 국물. </li><li> 50 μL의 유능한 세포가 들어있는 튜브에 1 μL의 플라스미드 DNA에 100 pg-10 ng을 첨가하십시오. 튜브를 가볍게 흔들어서 가볍게 섞는다. </li><li> 5 분 동안 얼음에 튜브를 품어 라. </li><li> 42 ° C에서 30 초 동안 열 충격 튜브수조에. 열 충격 직후 2 분 동안 얼음으로 되돌아갑니다. </li><li> 각 튜브에 상온 SOC 950 μL를 피펫으로 섞는다. LB - carb 플레이트에 박테리아 혼합물 100 μL를 퍼 뜨리고 37 ° C (대략 12-14 H) 밤새 품어. </li></ol></li><li> 12-14 시간 배양 후 37 ° C 배양기에서 플레이트를 제거하십시오. 식민지가 (약 8-9 시간) 성장을 계속할 수 있도록 실온에서 어두운 서랍에 판을 놓으십시오. </li><li> Terrific broth (TB, TB-carb라고 불리는 25 μg / mL carbenicillin 함유) 5 mL를 사용하여 박테리아 셰이커 (대략 14-16 h)에서 30 ° C 밤새 각 플라스미드에 대해 5 ~ 10 개의 작은 콜로니를 성장시킵니다. 참고 : 작은 콜로니는 플라스미드가 손상되지 않았다는 표시입니다. 결실, 재배치 또는 돌연변이 (본 명세서에서 불안정성 사건이라 칭함)를 포함하는 플라스미드를 갖는 콜로니는보다 빨리 성장할 것이며 따라서 더 커질 것이다. 따라서 플레이트에서 가장 작은 콜로니를 선택해야합니다.가장 큰 식민지를 선택한다. 일부 중간 크기의 콜로니도 완결을 위해 선택 될 수 있습니다. 사용 된 온도가 낮 으면 세포가 자라날 확률이 줄어 듭니다 (OD 600 이 0.6-0.8 이상). 대부분의 연구자가 하룻밤 사이의 성장을 수행하기 때문에 더 많은 제어와과 성장 기회 감소가 가능합니다. </li><li> 탁도 (대략 OD 600 0.6-0.8)에 대한 액체 배양을 점검하십시오. 4 ℃에서 모든 탁한 튜브를 놓고 다른 튜브가 오래 동안 성장하여 탁 해지도록하십시오. 참고 : 플라스미라 불안정성 사건이 발생할 수 있으므로 권장치보다 큰 OD 600 값으로 박테리아를 키우지 마십시오. </li><li> 상업용 플라스미드 miniprep 키트 (재료 표 참조)로 박테리아에서 플라스미드 DNA를 추출합니다. 사전 가열 (가열 블록에서 70 ° C까지) 용리 완충액 15 μL로 용리. 원심 분리 전에 용출 완충액을 컬럼에서 5 분 동안 배양합니다. 주의 사항 :이 시동기 배양액 1 mL 이상을 4 ° C다음 단계에서 더 사용하십시오. </li><li> 배양 중에 플라스미드 불안정성 사건이 발생했는지 평가하기 위해 회수 된 플라스미드 10 μL를 소화합니다. 참고 : pI를 SalI / NheI로, p2를 BamHI / HindIII로 37 ℃에서 1 시간 분해하십시오. 겔 전기 영동으로 소화 한 후 올바른 밴드가 있는지 확인하고 ( 그림 2a ) 2 단계로 진행합니다. 롤링 서클 증폭 (RCA)으로 플라스미드 DNA를 준비하는 경우 miniprep 용리액의 일부를 주형으로 준비하십시오. </li></ol> 2. 라이 게이션을위한 충분한 플라스미드 DNA의 준비 참고 : 연결 및 후속 electroporation은 maxiprep 또는 RCA를 통해 생성되어야합니다 충분한 양의 플라스미드 DNA가 필요합니다. maxiprep은 전통적으로 사용되는 접근법이지만 RCA는 박테리아를 필요로하지 않는 이점을 제공하므로 박테리아에서 플라스미드 유도 독성의 가능성을 제거하여 불안정성을 유발할 수 있습니다. <ol><li><strong&gt; 다음 maxiprep 절차를 수행하십시오. <ol><li> 이전 섹션에서 정확한 제한 효소 소화 패턴을 시연 한 각 플라스미드에 TB-Carb (25 μg / mL carbenicillin) 배지 1 L에 시동기 배양 500 μL를 첨가하고 30 ° C (약 14-16 시간) , 약 0.6-0.8의 OD 600 ). 참고 :이 OD 600 값 이상으로 배양되지 않도록하십시오. 이것은 잠재적으로 플라스미드 내에서 불안정한 결과를 초래할 것이다. </li><li> 박테리아를 수확하고 제조사의 프로토콜에 따라 maxipreps를 수행하십시오 (Materials Table 참조). </li></ol></li><li> 1.6 단계에서 저장된 miniprep을 사용하여 RCA 절차에 대해 다음을 수행하십시오. <ol><li> 샘플 버퍼 50 μL를 포함하는 튜브에 플라스미드 DNA 1 μL를 전송합니다. </li><li> 95 ° C에서 3 분간 열 변성시킨 다음 4 ° C에서 배양하여 사용할 준비가 될 때까지 기다리십시오. </li><li> 상업적 증폭 준비premix ( 재료 표 참조). 얼음에 세트 튜브에 효소 믹스 2 μL와 반응 버퍼 50 μL를 결합하십시오. 참고 : 증폭 프리믹스는 사용할 준비가 될 때까지 얼음에 보관해야합니다. 요구되는 수의 증폭 반응을위한 충분한 시약을 조합하여 마스터 믹스를 준비하는 것이 편리합니다. 사용하지 않은 모든 프리믹스는 폐기해야합니다. </li><li> 준비된 증폭 premix 50 μL를 변성 된 시료에 옮긴다. </li><li> 반응 튜브를 30 ° C에서 18 시간 동안 품어 낸다. </li><li> 튜브를 65 ° C에서 10 분 동안 배양하여 ø29 DNA 중합 효소를 비활성화한다. </li><li> 사용 준비가 끝날 때까지 반응 튜브를 4 ° C 또는 -20 ° C에 보관하십시오. 참고 :이 시점에서 두 방법을 통해 준비된 플라스미드 DNA는 (260 nm에서의 흡광도를 사용하여) 정량화되어야하며 ZIKV 게놈은 생기지 않은 상태 (삭제 및 재배치)가 발생하지 않았 음을 확인하기 위해 생거 (Sanger) 서열을 완전히 시퀀싱해야합니다. </li></ol></li></ol><table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 입문서 이름 </td><td> 서열 (5 &#39;- 3&#39;) </td></tr><tr><td> ZIKV PRVABC59 1For. </td><td> AGTTGTTGATCTGTGTGAATCAGAC </td></tr><tr><td> ZIKV 보존 된 632For. </td><td> GCCCTATGCTGGATGAGG </td></tr><tr><td> ZIKV 보존 된 692Rev. </td><td> GGTTCCGTACACAACCCAAGTTG </td></tr><tr><td> ZIKV 보존 된 1313Rev. </td><td> CTCCCTTTGCCAAAAAGTCCACA </td></tr><tr><td> ZIKV 보존 된 1201 용. </td><td> CCAACACAAGGTGAAGCCTAC </td></tr><tr><td> ZIKV 보존 된 1663For. </td><td> GCAGACACCGGAACTCCACACT </td></tr><tr><td> 2008 년 보존 된 ZIKV. </td><td> CAGATGGCGGTGGACATGC </td></tr><tr><td> ZIKV는 2350Rev를 보존합니다. </td><td> GTGAGAACCAGGACATTCCTCC </td></tr><tr><td> ZIKV 보존 된 2605For. </td><td> TACAAGTACCATCCTGACTCCC </td></tr><tr><td> ZIKV 보존 된 3499Rev. </td><td>GCCTTATCTCCATTCCATACCA </td></tr><tr><td> ZIKV 보존 3961Rev. </td><td> TTGCCAACCAGGCCAAAG </td></tr><tr><td> ZIKV 보존 4132For. </td><td> CATTTGTCATGGCCCTGG </td></tr><tr><td> ZIKV 보존 된 4561Rev. </td><td> CTATTGGGTTCATGCCACAGAT </td></tr><tr><td> ZIKV 보존 된 4665For. </td><td> GACCACAGATGGAGTGTACAGAGT </td></tr><tr><td> ZIKV 보존 5189Rev. </td><td> AAGACAGTTAGCTGCTTCTTCTTCAG </td></tr><tr><td> ZIKV 보존 5219For. </td><td> GAGAGTTCTTCCTGAAATAGTCCGTGA </td></tr><tr><td> ZIKV 보존 된 6086Rev. </td><td> CTTGCTTCAAGCCAGTGTGC </td></tr><tr><td> ZIKV 보존 된 6119 포. </td><td> GCCTCATAGCCTCGCTCTATCG </td></tr><tr><td> ZIKV 보존 된 6721Rev. </td><td> CCATTCCAAAGCCCATCTTCCC </td></tr><tr><td> ZIKV 보존 된 6769For. </td><td> CCAGCCAGAATTGCATGTGTCC </td></tr><tr><td> ZIKV 보존 된 7209Rev. </td><td> ATCATTAGCAGCGGGACTCCAA </td></tr><tr><td> ZIKV 보존 된 7343For. </td><td> GTTGTGGATGGAATAGTGGT </td></tr><tr><td> ZIKV 보존 8243 용. </td><td> TGCCCATACACCAGCACTATGA </td></tr><tr><td> ZIKV PRVABC59 8893Rev </td><td> TGCATTGCTACGAACCTTGTTG </td></tr><tr><td> ZIKV는 9133For를 보존했습니다. </td><td> AGCCCTTGGATTCTTGAACGAGGA </td></tr><tr><td> ZIKV PRVABC59 9673Rev. </td><td> AACGCAATCATCTCCACTGACT </td></tr><tr><td> ZIKV는 9686을 위해 보존되었습니다. </td><td> GATGATAGGTTGCACATGCC </td></tr><tr><td> ZIKV 보존 된 10321Rev. </td><td> GTCCATGTACTTTTCTTCATCACCTAT </td></tr><tr><td> ZIKV 보존 된 10455For. </td><td> CAGGAGAAGCTGGGAAACC </td></tr><tr><td> ZIKV 보존 된 10621Rev. </td><td> CAGATTGAAGGGTGGGGAAGGTC </td></tr></tbody></table> 표 1 : cDNA 클론을 시퀀싱하기위한 프라이머. 플라스미드는 나열된 프라이머로 완전히 시퀀싱 할 수 있습니다. &quot;conserved&quot;indi로 표시 한 프라이머ZIKV의 모든 유전형을 서열화 / 증폭시킬 가능성이 높다. &quot;PRVABC59&quot;로 표시된 프라이머는이 균주에 특이 적이지만 다른 아시아 유전자형 계통 및 기타 유전자형에도 사용할 수 있습니다. 3. 체외 수정 RNA의 준비 <ol><li> maxiprep 또는 RCA 준비 DNA의 소화 반응을 설정하십시오. <ol><li> p1 소화의 경우, 10x 반응 완충액, 3 μL의 ApaLI, 3 μL의 BamHI-HF, 3 μL의 rSAP 또는 CIP, 및 3.3 μg의 p1 DNA를 혼합한다. 100 μL에 ddH 2 O를 첨가한다. </li><li> p2 소화를 위해서는 10x 반응 완충액 10 μL, ApaLI 3 μL, EcoRI-HF 3 μL 및 p2 DNA 13.3 μg을 섞는다. 100 μL에 ddH 2 O를 첨가한다. </li><li> 1-2 시간 동안 37 ° C에서 배양하십시오. </li><li> 시중에서 판매하는 젤 및 PCR 클린업 키트를 사용하여 정제하십시오 (재료 표 참조). 가열 블록에서 70 ° C로 예열 된 용리 완충액 30 μL로 용리회전하기 전에 5 분 동안 칼럼). 참고 : 1 μL을 나중에 젤에서 실행하십시오. </li></ol></li><li> 라이 게이션 반응을 준비하십시오. <ol><li> 10x T4 DNA 연결 반응 버퍼 10 μL, T4 DNA 리가 아제 (400 U / μL) 3 μL, 정제 p1 29 μL 및 정제 P2 29 μL를 합칩니다. 100 μL에 ddH 2 O를 첨가한다. </li><li> 상온에서 2 시간 또는 16 ° C 밤새 품어 낸다. </li><li> 시중에서 판매하는 젤 및 PCR 클린업 키트를 사용하여 정제하십시오 (재료 표 참조). 가열 블록 (회전하기 전에 5 분 동안 부화 칼럼)에서 70 ° C로 예열 된 용리 완충액 10 μL로 용출시킨다. 참고 : 1 μL을 나중에 젤에서 실행하십시오. </li></ol></li><li> 소화되지 않은 플라스미드, 소화 된 플라스미드 및 아가 로스 겔에서의 연결 장치를 작동시킨다. 라이 게이션 제품은 소화 된 플라스미드 단독보다 높은 분자량 밴드 (약 11kb)를 가져야하며, 이는 라이 게이션이 성공적임을 나타냅니다 ( 그림 2b ).</li><li> T7 in vitro 전사 반응을 설정하십시오. <ol><li> 10 μL 2x ARCA / NTP 혼합, 2 μL의 T7 RNA 중합 효소 혼합 및 최종 부피 20 μL를위한 8 μL의 정제 된 연결 반응을 합칩니다. 참고 : 믹스에 포함 된 ARCA는 올바른 방향으로 독점적으로 통합 된 캡 아날로그입니다. 표준 캡 아날로그는 올바른 방향으로 뚜껑이있는 전사 물의 ~ 50 % 만 얻을 수 있습니다. </li><li> 37 ° C에서 4 시간 동안 품어 낸다. </li><li> UV 분광 광도계를 통해 RNA 농도를 측정하십시오. RNA 전 사체의 길이를 확인하기 위해 denaturing agarose gel을 실행하십시오 (선택 사항). </li></ol></li></ol> 4. 일렉트로 포 레이션에 의한 감염 바이러스의 구조 <ol><li> (T150 및 T182 사이의 수용 가능, DMEM + 10 % 태아 소 혈청 (FBS)에서 재배) 1 개의 T182 플라스크를 회수해야한다. mock transfection control으로 1 T182를 포함하십시오. Cells는 70-80 %의 confluency에서 사용해야합니다. </li><li> 세포가 준비되면, 37 ° C로 가열 수 중 욕에서 DMEM + 15 % FBS + 10 MM HEPES의 12 ML / 반응을 놓으십시오. </li><li> 표준 프로토콜과 trypsinization하여 세포를 분리하고 트립신을 비활성화하는 10 % FBS와 미디어에서 세포를 복구, 4 ° C에서 5 분 동안 150 XG에서 세포를 원심 분리하십시오. </li><li> 4 ° C에서 5 분 150 XG에서 세포를 pelleting 1X 인산 버퍼 식염수 (PBS)에서 세포를 씻으십시오. 이 단계를 두 번 반복하여 총 세 번의 세척을하십시오. </li><li> 샘플 당 RPMI 1640 + 10 MM HEPES (멸균) 200 μL에 Resuspend 세포. 멸균 튜브에 세포 현탁액 200 μL를 전송합니다. 세포는 ~ 0.5 x 107 세포 / mL이어야합니다. </li><li> 단계 3.4에서 생성 된 RNA (바람직하게는 5-10 μg) 20 μL를 세포의 각 세트에 첨가한다. 튜브를 가볍게 치고 부드럽게 혼합하고 튜브의 내용물을 2mm 간격의 전기 천공 큐벳으로 옮긴다. </li><li> electr 설정oporator는 170V LV, 오메가 (저항)는 0 및 950μF (약 625V / cm 및 다른 기계의 경우 20ms 시정 수). 사용 가능한 가장 낮은 설정으로 0 또는 ∞로 저항을 설정합니다. </li><li> 1 회 펄스하고 단계 4.2에서 가온 된 DMEM + 15 % FBS + 10 mM HEPES 600 μL를 즉시 첨가한다. 모든 세포를 제거하기 위해 큐벳의 내부를 철저히 씻어 내십시오. 사전 예열 매체 10 ML을 포함 T75 조직 배양 플라스크에 세포를 추가합니다. 큐벳에 포함 된 드로퍼를 사용하여 큐벳에서 추가 미디어를 제거합니다. 불임을 유지하도록주의하십시오. </li><li> 미디어와 세포를 혼합하고 37 ° C 배양기에 넣으십시오. </li><li> 다음날 세포 생존 가능성을 확인하고, 50-75 % 세포 사멸이 관찰 될 때까지 매일 그렇게하십시오. 세포 사멸은 모의 electroporated 컨트롤과 비교하여 관찰됩니다. 참고 : ZIKV 세포 병리학 적 효과 (CPE)는 Vero 세포에서 아주 분명하게 나타나 세포 배양액을 분리하여 부유시킵니다. 우리는 가지고있다.수확에 이상적인 것으로 8-10 일의 범위를 관찰했다. </li><li> 원뿔 튜브와 원심 분리기에있는 상층 액을 수확하여 4 ℃에서 10 분 이상&gt; 3000 xg에서 세포 파편을 제거합니다. </li><li> 깨끗한 상청액을 새 튜브에 옮기고 20 % FBS (100 % 주식)의 최종 농도로 보충합니다. 또한, 동결 상태 (1 M 멸균 주식)에서 바이러스 감염성을 보존하기 위해 완충제로 10 mM의 최종 농도에서 무균 HEPES를 첨가하십시오. </li><li> vortexing과 나누어 냄으로써 스크류 캡 바이알에 바이러스를 혼합합니다. 나중에 사용할 수 있도록 -80 ° C에서 보관하십시오. </li></ol> 5. 회복 된 바이러스의 적정 <ol><li> 적정하기 전날 Vero 세포의 6- 또는 12- 웰 플레이트의 적절한 수를 씨닝하십시오. </li><li> 냉동실에서 바이러스를 제거하고 튜브 또는 96 - 웰 플레이트에있는 DMEM + 2 % FBS에서 연속 10 배 희석합니다. 참고 : 회수 된 클론의 예상 역가는 1 x 106 ~ 5 x 107 PFU / mL입니다. </li><li> 200 o 추가400μL 씩 각 희석액을 12 또는 6 웰 플레이트의 웰에 각각 복제한다. </li><li> 37 ° C 배양기 및 암석을 매 15 분마다 놓아서 총 1-1.5 시간의 흡착 기간을 거친다. </li><li> 바이러스 접종원을 제거하고 각 잘 1 ML (12 - 웰) 또는 2 ML (6 - 잘) DMEM - Tragacanth 오버레이를 추가합니다. 참고 : 여기에는 아가로 오스, 한천, 메틸 셀룰로오스 또는 기타 오버레이 미디어를 사용할 수 있습니다. </li><li> 5 일 동안 37 ° C 배양기에서 세포를 품어. 적절한 플라크 형성 시간은 사용되는 오버레이에 따라 다릅니다. </li><li> 세포를 고정시키기 위해 인큐베이터에서 플레이트를 제거하고 오버레이를 부드럽게 소독제에 버립니다. </li><li> 커버와 소용돌이가 혼합되도록 각 우물에 충분한 20 % 에탄올 /0.1 % 크리스탈 바이올렛 (CV)을 추가합니다. 참고 : 많은 다른 정착액이 존재하며 여기에서 사용할 수 있습니다. 또한 아가로 오스 또는 한천 오버레이를 사용하는 경우 중성 색과 함께 두 번째 오버레이를 사용하여 고정하지 않고 플라크를 시각화 할 수 있습니다. 20 % 에탄올은이전 연구에서 외피 바이러스를 비활성화시키는 데 효과적입니다. 봉투되지 않은 바이러스는 비활성화되지 않으므로이 금액을 사용하지 마십시오 19 . </li><li> 플레이트를 상온에서 30-60 분 동안 배양하십시오 (클래스 II 바이오 안전성 캐비닛에서). CV (지역 규정에 따라)를 버리고 수돗물로 접시를 씻으십시오. </li><li> 접시를 건조시키고 플라크를 수동으로 계산하십시오. 참고 : 참조 번호 20은 플라크 분석을 수행하기위한 추가 참조 자료로 사용할 수 있습니다. </li></ol>

<ol>
	<li>Kindhauser, M. K., Allen, T., Frank, V., Santhana, R. S., Dye, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika:+the+origin+and+spread+of+a+mosquito-borne+virus.">Zika: the origin and spread of a mosquito-borne virus.</a> Bull World Health Organ. 94 (9), 675C-686C (2016).</li><li>Oehler, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika+virus+infection+complicated+by+Guillain-Barre+syndrome--case+report,+French+Polynesia,+December+2013.">Zika virus infection complicated by Guillain-Barre syndrome--case report, French Polynesia, December 2013.</a> Euro Surveill. 19 (9), (2014).</li><li>Li, D., Aaskov, J., Lott, W. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+cryptic+prokaryotic+promoter+within+the+cDNA+encoding+the+5'+end+of+dengue+virus+RNA+genome.">Identification of a cryptic prokaryotic promoter within the cDNA encoding the 5' end of dengue virus RNA genome.</a> PLoS One. 6 (3), e18197 (2011).</li><li>Pu, S. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+approach+to+propagate+flavivirus+infectious+cDNA+clones+in+bacteria+by+introducing+tandem+repeat+sequences+upstream+of+virus+genome.">A novel approach to propagate flavivirus infectious cDNA clones in bacteria by introducing tandem repeat sequences upstream of virus genome.</a> J Gen Virol. 95 (Pt 7), 1493-1503 (2014).</li><li>Pu, S. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Successful+propagation+of+flavivirus+infectious+cDNAs+by+a+novel+method+to+reduce+the+cryptic+bacterial+promoter+activity+of+virus+genomes.">Successful propagation of flavivirus infectious cDNAs by a novel method to reduce the cryptic bacterial promoter activity of virus genomes.</a> J Virol. 85 (6), 2927-2941 (2011).</li><li>Rice, C. M., Grakoui, A., Galler, R., Chambers, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+of+infectious+yellow+fever+RNA+from+full-length+cDNA+templates+produced+by+in+vitro+ligation.">Transcription of infectious yellow fever RNA from full-length cDNA templates produced by in vitro ligation.</a> New Biol. 1 (3), 285-296 (1989).</li><li>Yun, S. I., Kim, S. Y., Rice, C. M., Lee, Y. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+application+of+a+reverse+genetics+system+for+Japanese+encephalitis+virus.">Development and application of a reverse genetics system for Japanese encephalitis virus.</a> J Virol. 77 (11), 6450-6465 (2003).</li><li>Gualano, R. C., Pryor, M. J., Cauchi, M. R., Wright, P. J., Davidson, A. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+major+determinant+of+mouse+neurovirulence+of+dengue+virus+type+2+using+stably+cloned+genomic-length+cDNA.">Identification of a major determinant of mouse neurovirulence of dengue virus type 2 using stably cloned genomic-length cDNA.</a> J Gen Virol. 79 (Pt 3), 437-446 (1998).</li><li>Johansen, I. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intron+insertion+facilitates+amplification+of+cloned+virus+cDNA+in+Escherichia+coli+while+biological+activity+is+reestablished+after+transcription+in+vivo.">Intron insertion facilitates amplification of cloned virus cDNA in Escherichia coli while biological activity is reestablished after transcription in vivo.</a> Proc Natl Acad Sci U S A. 93 (22), 12400-12405 (1996).</li><li>Shan, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Infectious+cDNA+Clone+of+Zika+Virus+to+Study+Viral+Virulence,+Mosquito+Transmission,+and+Antiviral+Inhibitors.">An Infectious cDNA Clone of Zika Virus to Study Viral Virulence, Mosquito Transmission, and Antiviral Inhibitors.</a> Cell Host Microbe. 19 (6), 891-900 (2016).</li><li>Schwarz, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rescue+of+the+1947+Zika+Virus+Prototype+Strain+with+a+Cytomegalovirus+Promoter-Driven+cDNA+Clone.">Rescue of the 1947 Zika Virus Prototype Strain with a Cytomegalovirus Promoter-Driven cDNA Clone.</a> mSphere. 1 (5), (2016).</li><li>Tsetsarkin, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Full-Length+Infectious+cDNA+Clone+of+Zika+Virus+from+the+2015+Epidemic+in+Brazil+as+a+Genetic+Platform+for+Studies+of+Virus-Host+Interactions+and+Vaccine+Development.">A Full-Length Infectious cDNA Clone of Zika Virus from the 2015 Epidemic in Brazil as a Genetic Platform for Studies of Virus-Host Interactions and Vaccine Development.</a> MBio. 7 (4), (2016).</li><li>Gadea, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+robust+method+for+the+rapid+generation+of+recombinant+Zika+virus+expressing+the+GFP+reporter+gene.">A robust method for the rapid generation of recombinant Zika virus expressing the GFP reporter gene.</a> Virology. 497, 157-162 (2016).</li><li>Kapoor, M., Zhang, L., Mohan, P. M., Padmanabhan, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+and+characterization+of+an+infectious+dengue+virus+type-2+RNA+genome+(New+Guinea+C+strain).">Synthesis and characterization of an infectious dengue virus type-2 RNA genome (New Guinea C strain).</a> Gene. 162 (2), 175-180 (1995).</li><li>Messer, W. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+characterization+of+a+reverse+genetic+system+for+studying+dengue+virus+serotype+3+strain+variation+and+neutralization.">Development and characterization of a reverse genetic system for studying dengue virus serotype 3 strain variation and neutralization.</a> PLoS Negl Trop Dis. 6 (2), e1486 (2012).</li><li>Kinney, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avian+virulence+and+thermostable+replication+of+the+North+American+strain+of+West+Nile+virus.">Avian virulence and thermostable replication of the North American strain of West Nile virus.</a> J Gen Virol. 87 (Pt 12), 3611-3622 (2006).</li><li>Chang, A. C., Cohen, S. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+amplifiable+multicopy+DNA+cloning+vehicles+derived+from+the+P15A+cryptic+miniplasmid.">Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid.</a> J Bacteriol. 134 (3), 1141-1156 (1978).</li><li>Weger-Lucarelli, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+Characterization+of+Recombinant+Virus+Generated+from+a+New+World+Zika+Virus+Infectious+Clone.">Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone.</a> J Virol. 91 (1), (2017).</li><li>Roberts, P. L., Lloyd, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus+inactivation+by+protein+denaturants+used+in+affinity+chromatography.">Virus inactivation by protein denaturants used in affinity chromatography.</a> Biologicals. 35 (4), 343-347 (2007).</li><li>Baer, A., Kehn-Hall, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+concentration+determination+through+plaque+assays:+using+traditional+and+novel+overlay+systems.">Viral concentration determination through plaque assays: using traditional and novel overlay systems.</a> J Vis Exp. (93), e52065 (2014).</li><li>Weger-Lucarelli, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+Characterization+of+Recombinant+Virus+Generated+from+a+New+World+Zika+Virus+Infectious+Clone.">Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone.</a> J Virol. , (2016).</li><li>Grubaugh, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+Drift+during+Systemic+Arbovirus+Infection+of+Mosquito+Vectors+Leads+to+Decreased+Relative+Fitness+during+Host+Switching.">Genetic Drift during Systemic Arbovirus Infection of Mosquito Vectors Leads to Decreased Relative Fitness during Host Switching.</a> Cell Host Microbe. 19 (4), 481-492 (2016).</li></ol>

저자는 공개 할 것이 없습니다.

Here we describe a method for the recovery of a bipartite infectious cDNA clone system for ZIKV. Previously described clones for ZIKV suffer from either attenuation or require the addition of introns, making plasmids larger and preventing rescue in insect cells. Infectious virus can be recovered using the two-plasmid clone system in either mammalian or insect cells (data not shown). In addition, virus recovered from this system behaves similarly to wild-type virus in several cell lines, in an immunocompromised mouse mode...

Zika 바이러스 (ZIKV, Family Flaviviridae : Flavivirus 속)는 2013-14 년 브라질에 도착한 모기에 의한 플라 비 바이러스로 이후 미주 전역에 퍼져 있던 열병의 대규모 발생과 관련이 있습니다 1 . 또한, ZIKV는 성인의 길랑 발레 증후군 및 태아 및 신생아의 소두증과 같은 심각한 질병 결과와 관련되어 있습니다 2 . 서반구에서 급속하게 확산되기 전에 ZIKV에 대해 알려진 것이 거의 없다. 여기에는 분자 도구가 없어 기계 론적 연구가 어려웠습니다. 감염성 cDNA 클론과 같은 바이러스의 분자 도구는 백신 및 항 바이러스 치료 개발을 촉진하고 차별적 인 바이러스 병인, 면역 반응 및 바이러스 성 진화와 관련된 바이러스 유전 인자의 평가를 허용합니다. 플라 비 바이러스 전염성 클론은 cr 때문에 박테리아에서 매우 불안정한 것으로 알려져있다그들의 게놈에 존재하는 유익한 원핵 생물 프로모터 3 . 이 문제를 개선하기 위해 몇 가지 접근법이 사용되었습니다. 바이러스 서열 4의 상류 중계 반복의 삽입, 추정 원핵 생물 프로모터 서열 5의 돌연변이, 게놈을 다중 플라스미드 6 으로 분할, 저 복사 수 벡터 (박테리아 인공 염색체 포함) 7 및 바이러스 게놈에서의 인트론 삽입 9 . 수정하지 않은 하나의 전장 시스템이 ZIKV에 대해 설명되었습니다. 그러나,이 클론은 세포 배양 및 마우스에서 약화 된 것으로 보였다. 다른 그룹은 인트론을 ZIKV 게놈으로 조작하여 감염성 바이러스 11 의 생산을 위해 포유류 세포 에서 시험관 내 에서 접합 될 수있는 박테리아의 불안정한 서열을 파괴 할 수 있도록했습니다, 12 . 또한, 전염성 - 서브 게놈 - 앰플리 콘이라는 제목의 PCR 기반 시스템이 ZIKV 13 의 원형 MR766을 구제하는데 성공적으로 사용되었습니다. 여기에 설명 된 접근 방식은 외래 서열을 필요로하지 않고 황열병 6 , 뎅기열 14 , 15 및 웨스트 나일 바이러스 16에서 성공적으로 사용 된 여러 플라스미드를 사용하여 불안정성이 높은 지역의 게놈을 파괴합니다. 또한 바이러스 게놈 말단에 D 형 간염 리보 자임 서열을 추가하면 선형화 부위를 추가 할 필요없이 진정한 3 &#39;말단을 만들 수 있습니다. 또한 두 플라스미드는 잔류 독성을 완화하기 위해 낮은 카피 수 벡터 (pACYC177, 세포 당 ~ 15 카피)로 구성된다. 복구 된 바이러스는포유류와 곤충 둘 다에서 파생 된 다양한 세포 유형을 포함하는 8 개의 세포주 에서 체외 성장 곡선에서 부모 바이러스. 모기에서 마우스와 감염, 보급 및 전염 속도에서 동일한 병원성 프로파일을 나타냈다. 여기서, 우리는 감염성 클론 플라스미드를 성장시키고, 체외에서 전장 바이러스 성 RNA (바이러스 성 게놈) 를 생성하고 , 세포 배양에서 감염성 바이러스를 회수하는 방법을 기술 한 프로토콜을 상세히 설명한다. 첫째, 우리는 박테리아에서 플라스미드의 번식 또는 롤링 서클 증폭 (RCA)을 이용한 박테리아없는 증폭을 기술한다. 다음으로, 우리는 두 플라스미드가 어떻게 소화되는지를 보여 주며,이어서 전체 길이의 바이러스를 생성하기 위해 함께 연결됩니다. 마지막으로, 우리는 전사 RNA의 생산과 Vero 세포로의 전기 천공을 기술하고, 회수 된 바이러스의 적정을 기술한다 ( 그림 1 ). 설명 된 접근법은 빠르며, fo1 ~ 2 주 안에 전염성 바이러스 주식을 회수.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>NEB Stable CompetentE. coli</td>
			<td>New England BioLabs</td>
			<td>C3040H</td>
			<td></td>
		</tr>
		<tr>
			<td>Carbenicillin, Disodium Salt</td>
			<td>various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Zyppy Plasmid Miniprep Kit</td>
			<td>Zymo Research</td>
			<td>D4036</td>
			<td></td>
		</tr>
		<tr>
			<td>ZymoPURE Plasmid Maxiprep Kit</td>
			<td>Zymo Research</td>
			<td>D4202</td>
			<td></td>
		</tr>
		<tr>
			<td>SalI-HF</td>
			<td>New England BioLabs</td>
			<td>R3138S</td>
			<td>20,000 units/ml</td>
		</tr>
		<tr>
			<td>NheI-HF</td>
			<td>New England BioLabs</td>
			<td>R3131S</td>
			<td>20,000 units/ml</td>
		</tr>
		<tr>
			<td>ApaLI</td>
			<td>New England BioLabs</td>
			<td>R0507S</td>
			<td>10,000 units/ml</td>
		</tr>
		<tr>
			<td>EcoRI-HF</td>
			<td>New England BioLabs</td>
			<td>R3101S</td>
			<td>20,000 units/ml</td>
		</tr>
		<tr>
			<td>BamHI-HF</td>
			<td>New England BioLabs</td>
			<td>R3136S</td>
			<td>20,000 units/ml</td>
		</tr>
		<tr>
			<td>HindIII-HF</td>
			<td>New England BioLabs</td>
			<td>R3104S</td>
			<td>20,000 units/ml</td>
		</tr>
		<tr>
			<td>illustra TempliPhi 100 Amplification Kit</td>
			<td>GE Healthcare Life Sciences</td>
			<td>25640010</td>
			<td></td>
		</tr>
		<tr>
			<td>NucleoSpin Gel and PCR Clean-up</td>
			<td>Macherey-Nagel</td>
			<td>740609.5</td>
			<td></td>
		</tr>
		<tr>
			<td>Shrimp Alkaline Phosphatase (rSAP)</td>
			<td>New England BioLabs</td>
			<td>M0371S</td>
			<td>1,000 units/ml</td>
		</tr>
		<tr>
			<td>Alkaline Phosphatase, Calf Intestinal (CIP)</td>
			<td>New England BioLabs</td>
			<td>M0290S</td>
			<td>10,000 units/ml</td>
		</tr>
		<tr>
			<td>T4 DNA Ligase</td>
			<td>New England BioLabs</td>
			<td>M0202S</td>
			<td>400,000units/mL</td>
		</tr>
		<tr>
			<td>HiScribe T7 ARCA mRNA Kit</td>
			<td>New England BioLabs</td>
			<td>E2065S</td>
			<td></td>
		</tr>
		<tr>
			<td>Vero cells</td>
			<td>ATCC</td>
			<td>CCL-81</td>
			<td></td>
		</tr>
		<tr>
			<td>ECM 630 High Throughput Electroporation System</td>
			<td>BTX</td>
			<td>45-0423</td>
			<td>Other machines are acceptable.</td>
		</tr>
		<tr>
			<td>LB Broth with agar (Miller)</td>
			<td>Sigma</td>
			<td>L3147</td>
			<td>Can be homemade as well.</td>
		</tr>
		<tr>
			<td>Terrific Broth</td>
			<td>Sigma</td>
			<td>T0918</td>
			<td>Can be homemade as well.</td>
		</tr>
		<tr>
			<td>Petri Dish</td>
			<td>Celltreat</td>
			<td>229693</td>
			<td></td>
		</tr>
		<tr>
			<td>Culture Tubes</td>
			<td>VWR International</td>
			<td>60818-576</td>
			<td></td>
		</tr>
		<tr>
			<td>T75 flasks</td>
			<td>Celltreat</td>
			<td>229340</td>
			<td></td>
		</tr>
		<tr>
			<td>T182 flasks</td>
			<td>Celltreat</td>
			<td>229350</td>
			<td></td>
		</tr>
		<tr>
			<td>1x PBS</td>
			<td>Corning</td>
			<td>21-040-CV</td>
			<td></td>
		</tr>
		<tr>
			<td>RPMI 1640 with L-glutamine</td>
			<td>Corning</td>
			<td>10-040-CV</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM with L-glutamine and 4.5 g/L glucose</td>
			<td>Corning</td>
			<td>10-017-CV</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>Atlas Biologicals</td>
			<td>FP-0500-A</td>
			<td></td>
		</tr>
		<tr>
			<td>Tragacanth Powder</td>
			<td>MP Bio</td>
			<td>MP 104792</td>
			<td></td>
		</tr>
		<tr>
			<td>Crystal Violet</td>
			<td>Amresco</td>
			<td>0528-1006</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol Denatured</td>
			<td>VWR International</td>
			<td>BDH1156-1LP</td>
			<td></td>
		</tr>
		<tr>
			<td>6 well plate</td>
			<td>Celltreat</td>
			<td>229106</td>
			<td></td>
		</tr>
		<tr>
			<td>12 well plate</td>
			<td>Celltreat</td>
			<td>229111</td>
			<td></td>
		</tr>
		<tr>
			<td>Sequencing Oligos</td>
			<td>IDT</td>
			<td>see table 1</td>
			<td></td>
		</tr>
		<tr>
			<td>Qubit 3.0</td>
			<td>ThermoFisher</td>
			<td>Qubit 3.0</td>
			<td>other methods are acceptable.</td>
		</tr>
		<tr>
			<td>Qubit dsDNA BR Assay Kit</td>
			<td>ThermoFisher</td>
			<td>Q32850</td>
			<td>other methods are acceptable.</td>
		</tr>
		<tr>
			<td>Qubit RNA HS Assay Kit</td>
			<td>ThermoFisher</td>
			<td>Q32852</td>
			<td>other methods are acceptable.</td>
		</tr>
		<tr>
			<td>Class II Biosafety Cabinet</td>
			<td>Varies</td>
			<td>N/A</td>
			<td>This is necessary for live-virus work.</td>
		</tr>
	</tbody>
</table>

rescue and characterization of recombinant virus from a new world zika virus infectious clone

전염성 cDNA 클론은 바이러스의 유전자 조작을 허용하여 백신, 병인 발생, 복제, 전달 및 바이러스 진화에 대한 작업을 용이하게합니다. 여기에서는 Zika 바이러스 (ZIKV)에 대한 전염성 클론의 구축에 대해 설명합니다. ZIKV는 현재 미국에서 폭발적인 발병을 일으키고 있습니다. 플라 비 바이러스 유래 플라스미드에서 흔히 볼 수있는 박테리아에 대한 독성을 막기 위해 우리는 NS1 유전자에서 게놈을 분리하는 2 플라스미드 시스템을 만들었으며 돌연변이없이 성공적으로 복구 할 수 없었던 완전한 길이의 구조물보다 더 안정적이었다. 두 조각을 연결하기위한 소화 및 결합 후, 전장 바이러스 RNA는 T7 RNA 폴리머 라제로 시험 관내 전사에 의해 생성 될 수있다. 전사 된 RNA가 세포 내로 전기 천공 된 후 바이러스와 유사한 생체 내 성장 동역학 및 생체 내 독성 및 감염 표현형이 마우스 및 모기에서 각각 나타났다.

여기에 설명 된 프로토콜은 전염성 클론 파생 Zika 바이러스의 복구를 허용합니다. 2 플라스미드 감염 복제 시스템을 조작하는 것은 매우 불안정한 전장 버전 (데이터는 표시되지 않음)과 비교하여 신중하게 수행하면 간단합니다. 두 개의 개별 조각의 소화 및 연결 후, 봉쇄 된 RNA는 Vero 세포 ( 그림 1 )로 electroporated 다음 T7 중합 효소와 시험 관내</em...

Watch this Scientific Journal Video about Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone at JoVE.com

Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

이 프로토콜은 두 개의 플라스미드 감염성 cDNA 클론으로부터 감염성 Zika 바이러스의 회수를 설명합니다.

새로운 세계 Zika 바이러스 전염성 클론으로부터 재조합 바이러스의 구조 및 특성 규명

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral ...

rescue-characterization-recombinant-virus-from-new-world-zika-virus

Research

JoVE Journal

Immunology and Infection

9.6K 조회수.  Colorado State University.  이 프로토콜은 두 개의 플라스미드 감염성 cDNA 클론으로부터 감염성 Zika 바이러스의 회수를 설명합니다. 

비디오: Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Generation of Recombinant Influenza Virus from Plasmid DNA

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally established in 1999 1,2 plasmid-based reverse genetic techniques to generate recombinant viruses have revolutionized the influenza research field because specific questions have been answered by genetically engineered, infectious, recombinant influenza viruses. Such studies include virus replication, function of viral proteins, the contribution of specific mutations in viral proteins in viral replication and/or pathogenesis and, also, viral vectors using recombinant influenza viruses expressing foreign proteins 3.

Rescue of influenza A viruses from plasmid DNA is a basic and essential experimental technique that allows influenza researchers to generate recombinant viruses to study multiple aspects in the biology of influenza virus, and to be used as potential vectors or vaccines.

플라스미드 DNA의 재조합 독감 바이러스의 생성

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally ...

연구

면역학 및 감염병학

Detection of Infectious Virus from Field-collected Mosquitoes by Vero Cell Culture Assay

Mosquitoes transmit a number of distinct viruses including important human pathogens such as West Nile virus, dengue virus, and chickungunya virus. Many of these viruses have intensified in their endemic ranges and expanded to new territories, necessitating effective surveillance and control programs to respond to these threats. One strategy to monitor virus activity involves collecting large numbers of mosquitoes from endemic sites and testing them for viral infection. In this article, we describe how to handle, process, and screen field-collected mosquitoes for infectious virus by Vero cell culture assay. Mosquitoes are sorted by trap location and species, and grouped into pools containing &le;50 individuals. Pooled specimens are homogenized in buffered saline using a mixer-mill and the aqueous phase is inoculated onto confluent Vero cell cultures (Clone E6). Cell cultures are monitored for cytopathic effect from days 3-7 post-inoculation and any viruses grown in cell culture are identified by the appropriate diagnostic assays. By utilizing this approach, we have isolated 9 different viruses from mosquitoes collected in Connecticut, USA, and among these, 5 are known to cause human disease. Three of these viruses (West Nile virus, Potosi virus, and La Crosse virus) represent new records for North America or the New England region since 1999. The ability to detect a wide diversity of viruses is critical to monitoring both established and newly emerging viruses in the mosquito population.

We describe a method to process and screen field-collected mosquitoes for a diversity of viruses by Vero cell culture assay. By employing this technique, we have detected 9 different viruses from 4 taxonomic families in mosquitoes collected in Connecticut.

베로 세포 배양 분석하여 필드 수집 모기에서 감염성 바이러스의 검출

Mosquitoes transmit a number of distinct viruses including important human pathogens such as West Nile virus, dengue virus, and chickungunya virus. Many ...

Visualizing Dengue Virus through Alexa Fluor Labeling

The early events in the interaction between virus and cell can have profound influence on the outcome of infection. Determining the factors 
that influence this interaction could lead to improved understanding of disease pathogenesis and thus influence vaccine or therapeutic design. Hence, the development 
of methods to probe this interaction would be useful. Recent advancements in fluorophores development1-3 and imaging technology4 can be exploited to 
improve our current knowledge on dengue pathogenesis and thus pave the way to reduce the millions of dengue infections occurring annually.

The enveloped dengue virus has an external scaffold consisting of 90 envelope glycoprotein (E) dimers protecting the nucleocapsid shell, 
which contains a single positive strand RNA genome5. The identical protein subunits on the virus surface can thus be labeled with an amine reactive dye and visualized 
through immunofluorescent microscopy. Here, we present a simple method of labeling of dengue virus with Alexa Fluor succinimidyl ester dye dissolved directly in a sodium 
bicarbonate buffer that yielded highly viable virus after labeling. There is no standardized procedure for the labeling of live virus and existing manufacturer&#x2019;s protocol 
for protein labeling usually requires the reconstitution of dye in dimethyl sulfoxide. The presence of dimethyl sulfoxide, even in minute quantities, can block 
productive infection of virus and also induce cell cytotoxicity6. The exclusion of the use of dimethyl sulfoxide in this protocol thus reduced this possibility. 
Alexa Fluor dyes have superior photostability and are less pH-sensitive than the common dyes, such as fluorescein and rhodamine2, making them ideal for 
studies on cellular uptake and endosomal transport of the virus. The conjugation of Alexa Fluor dye did not affect the recognition of labeled dengue 
virus by virus-specific antibody and its putative receptors in host cells7. This method could have useful applications in virological studies.

Taking advantage of the advancements in fluorophore development and imaging technology, a simple method of Alexa Fluor labeling of dengue virus was devised to visualize the early interactions between virus and cell.

알렉사 플루어 라벨링을 통해 뎅그열 바이러스를 떠올리

The early events in the interaction between virus and cell can have profound influence on the outcome of infection. Determining the factors 
that ...

Propagating and Detecting an Infectious Molecular Clone of Maedi-visna Virus that Expresses Green Fluorescent Protein

Maedi-visna virus (MVV) is a lentivirus of sheep, causing slowly progressive interstitial pneumonia and encephalitis1. The primary target cells of MVV in vivo are considered to be of the monocyte lineage2. Certain strains of MVV can replicate in other cell types, however3,4. The green fluorescent protein is a commonly used marker for studying lentiviruses in living cells. We have inserted the egfp gene into the gene for dUTPase of MVV. The dUTPase gene is well conserved in most lentivirus strains of sheep and goats and has been shown to be important in replication of CAEV5. However, dUTPase has been shown to be dispensable for replication of the molecular clone of MVV used in this study both in vitro and in vivo6. MVV replication is strictly confined to cells of sheep or goat origin. We use a primary cell line from the choroid plexus of sheep (SCP cells) for transfection and propagation of the virus7. The fluorescent MVV is fully infectious and EGFP expression is stable over at least 6 passages8. There is good correlation between measurements of TCID50 and EGFP. This virus should therefore be useful for rapid detection of infected cells in studies of cell tropism and pathogenicity in vitro and in vivo8.

We describe a molecular clone of maedi-visna virus that expresses GFP and is fully infectious. Replication of this virus can be detected by using fluorescence microscopy and flow cytometry.

전파와 녹색 형광 단백질을 표현 Maedi - visna 바이러스의 감염성 분자 클론을 검출

Maedi-visna virus (MVV) is a lentivirus of sheep, causing slowly progressive interstitial pneumonia and encephalitis1. The primary target cells of MVV in ...

Rescue of Recombinant Newcastle Disease Virus from cDNA

Newcastle disease virus (NDV), the prototype member of the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented, negative-sense, single-stranded, enveloped RNA virus (Figure 1) with potential applications as a vector for vaccination and treatment of human diseases. In-depth exploration of these applications has only become possible after the establishment of reverse genetics techniques to rescue recombinant viruses from plasmids encoding their complete genomes as cDNA2-5. Viral cDNA can be conveniently modified in vitro by using standard cloning procedures to alter the genotype of the virus and/or to include new transcriptional units. Rescue of such genetically modified viruses provides a valuable tool to understand factors affecting multiple stages of infection, as well as allows for the development and improvement of vectors for the expression and delivery of antigens for vaccination and therapy. Here we describe a protocol for the rescue of recombinant NDVs.

Newcastle disease virus (NDV) has been extensively studied in the last few years in order to develop new vectors for vaccination and therapy, among others. These studies have been possible due to techniques to rescue recombinant virus from cDNA, such as those we describe here.

의 cDNA에서 재조합 뉴캐슬 질병 바이러스의 구조

Newcastle disease virus (NDV), the prototype member of  the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented,  negative-sense, ...

Neutrophil Isolation and Analysis to Determine their Role in Lymphoma Cell Sensitivity to Therapeutic Agents

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of inflammation. They are key players in the innate immune system and play major roles in cancer biology. Neutrophils have been proposed as key mediators of malignant transformation, tumor progression, angiogenesis and in the modulation of the antitumor immunity; through their release of soluble factors or their interaction with tumor cells. To characterize the specific functions of neutrophils, a fast and reliable method is coveted for in vitro isolation of neutrophils from human blood. Here, a density gradient separation method is demonstrated to isolate neutrophils as well as mononuclear cells from the blood. The procedure consists of layering the density gradient solution such as Ficoll carefully above the diluted blood obtained from patients diagnosed with chronic lymphocytic leukemia (CLL), followed by centrifugation, isolation of mononuclear layer, separation of neutrophils from RBCsby dextran then lysis of residual erythrocytes. This method has been shown to isolate neutrophils &#8805; 90 % pure. To mimic the tumor microenvironment, 3-dimensional (3D) experiments were performed using basement membrane matrix such as Matrigel. Given the short half-life of neutrophils in vitro, 3D experiments with fresh human neutrophils cannot be performed. For this reason promyelocytic HL60 cells are differentiated along the granulocytic pathway using the differentiation inducers dimethyl sulfoxide (DMSO) and retinoic acid (RA). The aim of our experiments is to study the role of neutrophils on the sensitivity of lymphoma cells to anti-lymphoma agents. However these methods can be generalized to study the interactions of neutrophils or neutrophil-like cells with a large range of cell types in different situations.

Neutrophils are the most abundant type of white blood cells. The isolation of neutrophils from human blood by density gradient separation method and the differentiation of human promyelocytic (HL60) cells along the granulocytic pathway are described here; to test their role on sensitivity of lymphoma cells to anti-lymphoma agents.

호중구의 분리 및 분석 치료제에 림프종 세포 감도에서 자신의 역할을 확인하는 방법

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of ...

Zika Virus Infectious Cell Culture System and the In Vitro Prophylactic Effect of Interferons

Zika Virus (ZIKV) is an emerging pathogen that is linked to fetal developmental abnormalities such as microcephaly, eye defects, and impaired growth. ZIKV is an RNA virus of the Flaviviridae family. ZIKV is mainly transmitted by mosquitoes, but can also be spread by maternal to fetal vertical transmission as well as sexual contact. To date, there are no reliable treatment or vaccine options available to protect those infected by the virus. The development of a reproducible, effective Zika virus infectious cell culture system is critical for studying the molecular mechanisms of ZIKV replication as well as drug and vaccine development. In this regard, a protocol describing a mammalian cell-based in vitro Zika virus culture system for viral production and growth analysis is reported here. Details on the formation of plaques by Zika virus on a cell monolayer and plaque assay for measuring viral titer are presented. Viral genome replication kinetics and double-stranded RNA genome replicatory intermediates are determined. This culture platform was utilized to screen against a library of a small set of cytokines resulting in the identification of interferon-&#945; (IFN-&#945;), IFN-&#946; and IFN-&#947; as potent inhibitors of Zika viral growth. In summary, an in vitro infectious Zika viral culture system and various virological assays are demonstrated in this study, which has the potential to greatly benefit the research community in elucidating further the mechanisms of viral pathogenesis and the evolution of viral virulence. Antiviral IFN-alpha can further be evaluated as a prophylactic, post-exposure prophylactic, and treatment option for Zika virus infections in high-risk populations, including infected pregnant women.

Zika Virus Infectious Cell Culture System and the In Vitro Prophylactic Effect of Interferons

Zika Virus (ZIKV), an emerging pathogen, is linked to fetal developmental abnormalities and microcephaly. The establishment of an effective infectious cell culture system is crucial for studies of ZIKV replication as well as vaccine and drug development. In this study, various virological assays pertaining to ZIKV are illustrated and discussed.

Zika 바이러스 감염 세포 배양 시스템과<em&gt; 체외</em인터페론의&gt; 예방 효과

Zika Virus (ZIKV) is an emerging pathogen that is linked to fetal developmental abnormalities such as microcephaly, eye defects, and impaired growth. ZIKV ...

Zika Virus Specific Diagnostic Epitope Discovery

High-density peptide microarrays allow screening of more than six thousand peptides on a single standard microscopy slide. This method can be applied for drug discovery, therapeutic target identification, and developing of diagnostics. Here, we present a protocol to discover specific Zika virus (ZIKV) diagnostic peptides using a high-density peptide microarray. A human serum sample validated for ZIKV infection was incubated with a high-density peptide microarray containing the entire ZIKV protein translated into 3,423 unique 15 linear amino acid (aa) residues with a 14-aa residue overlap printed in duplicate. Staining with different secondary antibodies within the same array, we detected peptides that bind to Immunoglobulin M (IgM) and Immunoglobulin G (IgG) antibodies present in serum. These peptides were selected for further validation experiments. In this protocol, we describe the strategy followed to design, process, and analyze a high-density peptide microarray.

In this protocol, we describe a technique to discover Zika virus specific diagnostic peptides using a high-density peptide microarray. This protocol can readly be adapted for other emerging infectious diseases.

Zika 바이러스 특정 진단 Epitope 발견

High-density peptide microarrays allow screening of more than six thousand peptides on a single standard microscopy slide. This method can be applied for ...

Rapid, Safe, and Simple Manual Bedside Nucleic Acid Extraction for the Detection of Virus in Whole Blood Samples

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for the rapid bedside inactivation of the Ebola virus during blood sampling for safe nucleic acid (NA) tests by adding a commercial lysis/binding buffer directly into the vacuum blood collection tubes. Using this bedside inactivation approach, we have developed a safe, rapid, and simplified bedside NA extraction method for the subsequent detection of a virus in lysis/binding buffer-inactivated whole blood. The NA extraction is directly performed in the blood collection tubes and requires no equipment or electricity. 
After the blood is collected into the lysis/binding buffer, the contents are mixed by flipping the tube by hand, and the mixture is incubated for 20 min at room temperature. Magnetic glass particles (MGPs) are added to the tube, and the contents are mixed by flipping the collection tube by hand. The MGPs are then collected on the side of the blood collection tube using a magnetic holder or a magnet and a rubber band. The MGPs are washed three times, and after the addition of elution buffer directly into the collection tube, the NAs are ready for NA tests, such as qPCR or isothermal loop amplification (LAMP), without the removal of the MGPs from the reaction. The NA extraction method is not dependent on any laboratory facilities and can easily be used anywhere (e.g., in field hospitals and hospital isolation wards). When this NA extraction method is combined with LAMP and a portable instrument, a diagnosis can be obtained within 40 min of the blood collection.

Here, we present a protocol for the rapid virus nucleic acid extraction from the virus-inactivated whole blood. The extraction is performed directly in the blood collection tubes and requires no equipment or electricity. The method is not dependent on laboratory facilities and can be used anywhere (e.g., in field hospitals).

전체 혈액 샘플에서 바이러스의 검출, 안전, 신속 하 고 간단한 수동 침대 핵 산 추출

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for ...

Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells

The recent emergence of the flavivirus Zika and neurological complications, such as Guillain-Barr&#233; syndrome and microcephaly in infants, has brought serious public safety concerns. Among the risk factors, antibody-dependent enhancement (ADE) poses the most significant threat, as the recent re-emergence of the Zika virus (ZIKV) is primarily in areas where the population has been exposed and is in a state of pre-immunity to other closely related flaviviruses, especially dengue virus (DENV). Here, we describe a protocol for quantifying the effect of human serum antibodies against DENV on ZIKV infection in primary human cells or cell lines.

We describe a method to evaluate the effect of pre-existing immunity against dengue virus on the Zika virus infection by using human serum, primary human cells, and infection quantification by quantitative real-time polymerase chain reaction.

기본 인간 세포에서 Zika 바이러스의 항 체 의존 향상의 정량화

The recent emergence of the flavivirus Zika and neurological complications, such as Guillain-Barr&#233; syndrome and microcephaly in infants, has brought ...