Bu eser NoroCORE proje ile tarım ve gıda araştırma girişimi rekabetçi Grant No 2011-68003-30395 ABD Tarım Bakanlığı, Ulusal Enstitüsü gıda ve tarım tarafından desteklenmiştir. Açık erişim ücret karşılığında fon ABD Tarım Bakanlığı tarafından sağlandı. Robert Atmar (Baylor College of Medicine, Houston, TX) lütfen bizi saf capsids ve Valerie Lapham TEM görüntülerle yardımını sağlamak için teşekkür etmek istiyorum. Ayrıca Frank N. Barry bize sunulan deneyler başlatmak yardımcı olduğunuz için teşekkür etmek istiyorum.

1. plaka tabanlı bağlama tahlil değerlendirilmesi kaybı daha yüksek sipariş Norovirus kapsid yapısı için Not: Burada sunulan bir çok benzer bir ELASA iletişim kuralına Yayınlanan 29, oldu ve benzer ELASA deneyleri daha önce araştırmanın bir parçası başka bir yerde 17 , 18 , 22 makaleler gibi bildirilmiştir.
<ol><li>İnsan norovirus GII.4 Sydney capsids ısıl <ol><li>almak arıtılmış insan norovirus büyük kapsid protein (VP1) GII.4 Sidney (Katılım: JX459908) capsids içinde toplandı. 
		Not: Çalışmada Capsids R. Atmar nezaket (Baylor College of Medicine, Houston, TX) elde edildi.</li>
		<li>Dilute capsids 1 fosfat tamponlu tuz (PBS, pH 7.2) maksimum hacmi 15 µL birey için x 50 µg/ml PCR tüpleri şapkalı. Tüp en az 600 içerdiğinden emin olun kapsid ng. 600 olması tedavi-ligand birleşimi başına kapsid ng.</li>
		<li>Onceden istenen ısıl işlem için termal cycler. 
		Not: Bu protokol, 68 ° C'de tedavisinde farklı zamanlarda amaçlar için (0 - 25 dk) seçildi.</li>
		<li>Ek bir termal cycler hemen soğutma için 4 ° c Onceden. Tüpler kapsid çözüm ile termal cycler istenen süre ekleyin. Hemen önceden soğutulmuş 4 ° C cycler 5 min için Isıtma sonra aktarın.
		<ol><li>Ekle 95 ° C 5 min için tedavi denatüre kapsid kontrol olarak. Tedavi edilmemiş (23 ° C) kapsid çözüm olumlu bir denetim içerir. Ek bir negatif denetim olarak hiçbir kapsid ile PBS içerir.</li>
		</ol></li> <li>Kısa bir süre içinde bütün damlacıklar tüp altına almak ve PBS tedavi kapsid çözümlerinde 3 µg/ml seyreltik bir santrifüj aşağı spin. En az 200 µL seyreltilmiş, tedavi kapsid (100 µL/de) olduğundan emin olun.</li>
	</ol></li> <li>Geçerli 100 µL kapsid çözüm tedavi başına en az iki kuyu sağlayarak her şey için. Ayrıca, 100 µL PBS her ligand için 2 kontrol Wells'le şunlardır; Bu testin arka plan Absorbans sağlar. Bir kapak ile plaka kapak, parafin ile kenarları buharlaşma azaltmak için film ve bırakın mühür gecede 4 ° C'de veya oda sıcaklığında 2 h için titreyen bir kuluçka makinesi üzerinde.</li>
	<li>İle % 0.05 PBS içinde %5 yağsız süt Katıların (w/v) yaparak engelleme arabellek hazırlamak ara 20 (PBST).</li>
	<li>Tedavi kapsid çözümleri plaka kaldırın. 200 µL/iyi engelleme arabelleği ekleyin. Oda sıcaklığında 2 h için kuluçkaya veya gecede, saat 4'te mühürlü ° C.</li>
	<li>Biotinylated aptamer M6-2 18 , 29 için çözümler ve biotinylated sentetik HBGA kan tip A veya biotinylated tipi H. hazırla ligand bağlayıcı
	<ol><li>Dilute nükleaz ücretsiz su 1 µM için biotinylated aptamer. Her tedavi için toplam 200 µL için yeterli bir çözüm olduğundan emin olun. 30 µg/ml engelleme arabellekte seçilen biotinylated HBGA oranında seyreltin. Her tedavi için 200 µL toplam birim için yeterli bir çözüm olduğundan emin olun. 
		Not: daha az HBGA kullanmak için 10 µg/mL HBGA % 0.25 yağsız süt-PBST içinde yedek olabilir. Konsantrasyonları biotinylated M6-2 ve HBGA edilmiş daha önce en iyi duruma getirilmiş ve bildirdi.</li>
	</ol></li> <li>Engelleme arabellek kaldırmak ve plakaları 3 kez 200 µL/iyi PBST ile yıkayın. Plaka üzerinde baş aşağı steril kağıt havlu kalan nemi kuru pat.</li>
	<li>Ekle 100 µL/kuyu ligand ciltleme çözümleri, ısıl işlem-ligand birleşimi başına 2 kuyu sağlama. Oda sıcaklığında 1 h için bir orbital Çalkalayıcı-60 rpm'de üzerinde bir kapak ile örtülü plaka kuluçkaya. 
	Not: 2 kuyu her işlenmemiş capsids ve tamamen denatüre capsids her ligand için sırasıyla pozitif ve negatif denetimleri eklediğinizden emin olun. Ayrıca, 2 içerir &#34; yok kapsid &#34; wells her ligand olarak plaka için arka plan denetimi.</li>
	<li>Ligand çözümleri kaldırmak ve wells 3 kez 200 µL/iyi PBST ile yıkayın. Plaka baş aşağı steril kağıt havlu üzerinde kalan nemi kuru pat.</li>
	<li>Ekle 100 µL/iyi 0.2 lik µg/mL streptavidin horseradish peroksidaz PBS içinde. Nazik bir orbital Çalkalayıcı sallayarak ile oda sıcaklığında 15 dk için kuluçkaya. 
	Not: Farklı streptavidin-horseradish peroksidaz conjugates farklı konsantrasyonlarda olacaktır. Kullanıcı danışın &#39; konsantrasyonları enzim ELISA uygulamalar için ideal aralığı için s el ve en uygun olduğundan emin olun.</li>
	<li>Eşlenik çözüm kaldırın. 3 kez 200 µL ile/iyi PBST yıkayın. Plaka baş aşağı steril kağıt havlu üzerinde kalan nemi kuru pat.</li>
	<li>Ekle 100 µL/iyi 3,3 &#39;, 5,5 &#39;-tetramethylbenzidine (TMB) substrat ve 5-15 dk. gözlemlemek negatif kontrol wells herhangi için renk ve sürekli Çoğalt plakalar arasında aynı kez geliştirmek emin olun için geliştirmek renk izin. De kullanılan plaka okuyucu Absorbans dizi unutmayın. 
	Not: Gelişmekte olan kez kullanılan ligandlar/reaktifler kalitesine göre farklı olabilir.</li>
	<li>Reaksiyon 100 µL/iyi 1 M fosforik asit ile gelişimini durdurmak. Hemen okumak plaka 450 nm. Verileri kaydetmek. 
	Not: Asit getirilmesi genellikle tepki büyük ölçüde yavaşlatır ama tamamen bitmiyor. Durdurulan plaka Absorbans okumadan önce uzun bir süre için terk etmeyin.</li>
</ol> 2. Plaka tabanlı tahlil sonuçlarının analizi <ol><li>bir elektronik tablo programında ham Absorbans verileri kaydetmek. Ortalama absorbances spesifik tedavi ve ligand ile iyi çifti üretmek. Bu ortalamalar için tüm sonraki analizleri kullanın. 
	Not: hiçbir çiftleri Wells önemli ölçüde farklı değerlere sahip emin olmak için her iki iyi absorbances karşılaştırır.</li>
	Mutlak kapsid bütünlüğü (tüm bağlama) analiz etmek, ham Absorbans, çıkarma <li>&#34; yok kapsid &#34; diğer her örnek Absorbans değeri denetimden. 
	Not: Alternatif olarak, bağlama nedeniyle daha yüksek sipariş (ikincil, üçüncül, Kuvaterner) yapısı kaybı kaybı doğrudan çözümlenebilir. Negatif (kapsid) denetim Absorbans çıkarılarak yerine, tamamen denatüre kapsid denetiminin değerini çıkarın. Tüm bağlama sinyal spesifik olmayan cihazlar için bağlayıcı yanı sıra nedeniyle kapsid sıralı bağlama nedeniyle bu kaldırır. Her iki yöntem benzer sonuçlar üretir böylece HBGA ve aptamer M6-2 küçük bağlama tamamen denatüre kapsid için görüntüler. Nonspesifik aptamer bağlamaya atfedilen yanlış olumlu sinyal kullanmak için hangi analiz seçerken dikkate gerekir.</li>
	<li>Negatif veya denatüre denetim-düzeltilir absorbances ile 100 ile tedavi absorbances onların anılan sıraya göre pozitif (tedavi) tarafından kontrol absorbances ve çarpma bölme. Bu sinyal tedavi edilmezse denetime göre tedavi kapsid yüzdesi sağlar.</li>
	Bağlama sinyal her ligand kapsid dizisine atfedilebilecek için derecesi tahmin etmek için <li>çıkarma &#34; yok kapsid &#34; olumsuz ilk absorbances denetiminden ve denatüre kapsid ayarlanan Absorbans al. Bu pozitif kontrol sinyalini ayarlanan Absorbans tarafından bölmek ve 100 ile çarpmak. Bu sinyal denatüre kapsid/kapsid diziye ligand taşıması nedeniyle belirgin yüzdesini verir.</li>
</ol> 3. DLS virüs toplama ısıl işlem sonra tespit için Not: Belgili tanımlık merdiven aşağı-ebilmek var olmak belgili tanımlık bilgisayar yazılımı için belirli ve enstrüman kullanılan, ama olabilir uyarlanmış ve benzer cihazlara uygulanan.
<ol><li>Oluştur yeni bir boyutu SOP DLS enstrüman yazılımı kullanarak: malzeme Protein, Dispersant = PBS, sıcaklık = = 25 ° C de denge zaman = 0 sn, hücre tipi tek kullanımlık küvet (küçük hacimli, ZEN0040), ölçüm açısı = 173 ° Backscatter, = Ölçüm süresi = otomatik, ölçümleri sayısı = 3, ölçümler arasındaki gecikme = 0 sn, veri işleme: analiz modeli genel amaçlı (normal çözünürlük) =. Tüm diğer parametreler için varsayılan ayarları kullanın.</li>
	<li>Yazılım içinde yeşil çalışma ok seçin ve örnek adı.</li>
	<li>Adımları 1.1.1 VIP ısı tedavisi için 1.1.4 aracılığıyla izleyin.</li>
	<li>Dilute ısı VIP 1:10 1 x PBS 5 µg/mL nihai bir konsantrasyon için tedavi. (İsteğe bağlı) Örnek 1 µm gözenek boyutu toz parçacıkları kaldırmak için filtre; Çok daha fazla ışık küçük parçacıklar daha büyük partiküller dağılım gibi DLS toza, çok hassas.</li>
	<li>İçine küçük hacimli tek kullanımlık seyreltilmiş VIP transfer 50 µL küvet. Araç örnek odasına küvet ekle.</li>
	<li>Çalıştır başlatma ve kullanma &#39; Correlogram &#39;, &#39; Cumulants uygun &#39;, ve &#39; uzman tavsiye &#39; veri kalitesini değerlendirmek için sekmeleri.
	<ol><li>Polydispersity dizin değeri 0.3 Kalite Ölçüm. içinde temsil eden, daha az olduğunu çalışma sırasında kontrol &#8216; çok görünüm &#8217; sekmesinde, korelasyon katsayısı sabit ve kapatmak için ama değil daha--dan 1, kısa bir süre olduğundan emin olun ve damla kapalı bir süre sonra parçacık boyutu karakteristik 0 keskin. Kullanım &#8216; uzman tavsiye &#8217; veri kalitesi ölçümleri sırasında geri bildirimler sekmesini.</li>
		Ölçüm işlemi tamamlandıktan sonra <li>tekrar polydispersity dizin değeri 0.3 daha az olduğunu kontrol. Cumulants satır aşağıdaki veri noktaları yakından buna uygun emin olun &#8216; Cumulants uygun &#8217; sekmesini</li>
	</ol></li> <li>Z-ortalama parçacık çapı ortalama her örnek olarak partikül büyüklüğü her ölçüm için rapor almak. Nm ° c sıcaklığında vs ile çap arsa</li>
</ol> 4. DLS gerçek zamanlı virüs toplama işlemi tespit Not: belgili tanımlık merdiven aşağı-ebilmek var olmak belgili tanımlık bilgisayar yazılımı için belirli ve enstrüman kullanılan, ama olabilir uyarlanmış ve benzer cihazlara uygulanan.
<ol><li>Oluştur yeni bir boyutu SOP DLS enstrüman yazılımı kullanarak: malzeme Protein, Dispersant = PBS, sıcaklık = = istenen, denge zaman = 0 sn, hücre tipi kuvars küvet, ölçüm açısı = 173 ° Backscatter, = ölçüm süresi otomatik, = Ölçümler sayısı = 50, (artan veya azalan bağlı olarak toplama oranı olabilir) ölçümleri arasında gecikme = 0 sn, veri işleme: analiz modeli birden çok dar modları (yüksek çözünürlük) =. Tüm diğer parametreler için varsayılan ayarları kullanın.</li>
	<li>Açın ve yeni bir örnek adı için belgili tanımlık bilgisayar yazılımı içinde çalışma ok seçin ve sıcaklık denge ulaşmak araç izin.</li>
	<li>Bir microcentrifuge tüp 5 µg/mL ve bir birim arasında 200-500 µL. konsantrasyon, 1 X PBS VIP askıya girdap süspansiyon.</li>
	<li>VIP süspansiyon için 5-10 s de-gaz için masa üstü bir santrifüj içinde aşağı spin. Bu boyut ölçümleri ile müdahale ısıl işlem sırasında kabarcık oluşumu önlemeye yardımcı olur.</li>
	<li>Transfer VIP süspansiyon için küçük hacimli kuvars küvet-kabarcıklar kaçının ve yavaş yavaş küvet duvara pipet. Araç sıcaklık denge ulaştığında, örnek odasına küvet ekle.</li>
	<li>Bekle 10 s equilibrate örnek sıcaklık için Çalıştır başlatın. Çalışmanın başında bir süreölçer başlatın. İlk ölçüm sonunda sayacý durdurmak. Bu zaman ilk zaman noktası olarak alır. Yazılım tarafından kaydedilen ölçüm döneminden sonraki zaman puan almak.</li>
	<li>Çalıştır başlatın ve correlogram, uygun dağıtım ve veri kalitesini değerlendirmek için uzman tavsiyesi izlemek. 
	Not: PDI mutlaka 0,3 numune olarak bu ölçümler için daha az polydisperse sırasında toplama olması bekleniyor olamaz.
	<ol><li>Korelasyon katsayısı sabit ve kapatmak için ama fazla 1 kısa sürede ve keskin bir veya daha fazla daha sonraki zamanlarda, parçacık boyutu karakteristik kapalı damla emin olun.</li>
		<li>Dağıtım hattı aşağıdaki veri noktaları yakından uygun olduğundan emin olun.</li>
	</ol></li> <li>Boyutu veri analiz.
	Her ölçü ve başlangıç zaman noktası arasındaki zaman farkı <ol><li>karar vermek her zaman noktasından. Ölçüm süreleri hepsi tam olarak aynı değildir.</li>
		<li>Bir yoğunluk dağıtım kullanarak kayıt boyutu her ölçüm/saat noktası için en büyük alanları ile doruklarına.</li>
		<li>Vs zaman dak nm pik çapları arsa</li>
	</ol></li></ol> 5. TEM numune hazırlama TEM için tasarlanmış <ol><li>elde karbon destek film (nikel) Izgaralar. 
	Not: önerilen reaktifler ve kullandıklarında daha kullanmak için çekirdek tesis tesis mikroskop ile başvurun. Izgaralar kurutucu ya da neme maruz en aza indirmek için bir vakum odası içeren bir kutuda saklayın.</li>
	<li>Ailesini yaklaşık 5 cm x 5 cm parçalarına filtre kağıt. Cam Petri yemekler elde etmek ve kendi kendine uygun kapanış ters mikroskobu kullanılmak üzere tasarlanmış cımbız.</li>
	<li>Parafin film yaklaşık 2.5 cm x 5 cm parçası kesti. Yer benchtop.</li>
	<li>Isıl norovirus GII.4 Sydney capsids <ol><li>tam adımları 1.1.1 - 1.1.5 dışında yukarıda açıklandığı gibi ısıl işlem yordamı izleyin: 10 mM HEPES (pH 7,4) tedavi yerine PBS için kullanın ve daha da capsids sulandırmak değil sonra tedavi (tutun çözüm 50 µg/mL). Tedavi kapsid çözüm parafin film üzerine tüm ~ 15 µL damla pipette.</li>
	</ol></li> <li>Cımbız, onları kılavuz, tutmak için kenarında kapatmak izin ile kılavuz kenar kapmak ve kılavuz karbon-yan-aşağı tedavi çözüm damla üstüne yerleştirin. Kapsid kılavuza takmak izin vermek 10 min için kuluçkaya izin.
	<ol><li>Sonra tedavi kapsid damlacık sıraya yerleştirilmiş 10-15 µL damlacıklar şeklinde gerekirse yıkar 10 mM HEPES çözümün kapsid hazırlık saflık bağlı olarak ekleyin.</li>
		<li>Sonra 10 dk, damlacık kılavuzla al. Uzakta fitil damlacığı için bir yer neredeyse bir filtre kağıt parçası için dikey kılavuz. 10-15 µL HEPES tampon damlacık kılavuzla eline alıp, yıkama için başka bir parça filtre ile 30 s sonra fitil uzak dur</li>
	</ol></li> <li>% 2 uranyl asetat çözüm 15 µL damlacık boş bir alanı parafin filmde yerleştirin.
	<ol><li>Uranyl asetat kılavuzuna damlacık almak ve en-in belgili tanımlık eriyik kaldırdığınızdan emin olmak uranyl asetat 45 s. fitil uzakta tutun. Kılavuz karbon-yan bir kağıda filtre kılavuz değil dikkatli olmak, orayı &#34; sopa &#34; cımbız üzerinde nem için. Filtre kağıdı ile ızgara üzerinde açık bir cam Petri kabına yerleştirin. 
		Not: kılavuzlar ve onların Elektrostatik ilgisini olacak kalmış olur plastik Petri yemekler, kullanmayın çanak.</li>
	</ol></li> <li>Tüm tedaviler için yineleyin. Izgaralar ile Petri kabına yarıya indirir TEM ile gözlemleyerek önce kuru bir desiccator gecede yerleştirin.</li>
	<li>Danışın ilgili kurum mikroskobu tesisinde hazırlanan Izgaralar gözlemleyerek ile ilgili olarak. Bazı İmkanlar tesislerini operasyonunda eğitilmek için kullanıcının izin vermek &#39; s alet. Kurulum ve gözlem belirli bir mikroskop ile ilgili belirli ayrıntıları olduğunu beyond bu makalenin kapsamı.</li>
</ol>

<ol>
	<li>Kirk, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=World+Health+Organization+estimates+of+the+global+and+regional+disease+burden+of+11+foodborne+bacterial,+protozoal,+and+viral+diseases,+2010:+A+data+synthesis.">World Health Organization estimates of the global and regional disease burden of 11 foodborne bacterial, protozoal, and viral diseases, 2010: A data synthesis.</a> PLOS Med. 12 (12), e1001920 (2015).</li><li>Scharff, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Economic+burden+from+health+losses+due+to+foodborne+illness+in+the+United+States.">Economic burden from health losses due to foodborne illness in the United States.</a> J. Food Prot. 75 (1), 123-131 (2012).</li><li>Lee, B. Y., Mcglone, S. M., Bailey, R. R., Zachary, S., Umscheid, C. A., Muder, R. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Economic+impact+of+outbreaks+of+norovirus+infection+in+hospitals.">Economic impact of outbreaks of norovirus infection in hospitals.</a> Infect. Control Hosp. Epidemiol. 32 (2), 191-193 (2011).</li><li>Law, J. W. -. F., Ab Mutalib, N. -. S., Chan, K. -. G., Lee, L. -. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+methods+for+the+detection+of+foodborne+bacterial+pathogens:+principles,+applications,+advantages+and+limitations.">Rapid methods for the detection of foodborne bacterial pathogens: principles, applications, advantages and limitations.</a> Front. Microbiol. 5, 770 (2015).</li><li>Jones, M. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enteric+bacteria+promote+human+and+mouse+norovirus+infection+of+B+cells.">Enteric bacteria promote human and mouse norovirus infection of B cells.</a> Science. 346 (6210), 755-759 (2014).</li><li>Ettayebi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication+of+human+noroviruses+in+stem+cell+-+derived+human+enteroids.">Replication of human noroviruses in stem cell - derived human enteroids.</a> Science. 5211, (2016).</li><li>Moore, M. D., Goulter, R. M., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+as+a+foodborne+pathogen:+challenges+and+developments.">Human norovirus as a foodborne pathogen: challenges and developments.</a> Annu. Rev. Food Sci. Technol. 6 (1), 411-433 (2015).</li><li>Miura, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histo-blood+group+antigen-like+substances+of+human+enteric+bacteria+as+specific+adsorbents+for+human+noroviruses.">Histo-blood group antigen-like substances of human enteric bacteria as specific adsorbents for human noroviruses.</a> J. Virol. 87 (17), 9441-9451 (2013).</li><li>Almand, E. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+binding+to+select+bacteria+representative+of+the+human+gut+microbiota.">Human norovirus binding to select bacteria representative of the human gut microbiota.</a> Plos One. 12 (3), e0173124 (2017).</li><li>Rubio-del-Campo, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Noroviral+P-Particles+as+an+in+vitro+model+to+assess+the+interactions+of+noroviruses+with+probiotics.">Noroviral P-Particles as an in vitro model to assess the interactions of noroviruses with probiotics.</a> PLoS ONE. 9 (2), e89586 (2014).</li><li>Hirneisen, K. A., Kniel, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+ELISA+attachment+and+infectivity+assays+for+murine+norovirus.">Comparison of ELISA attachment and infectivity assays for murine norovirus.</a> J. Virol. Methods. 186 (1-2), 14-20 (2012).</li><li>Dancho, B. A., Chen, H., Kingsley, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discrimination+between+infectious+and+non-infectious+human+norovirus+using+porcine+gastric+mucin.">Discrimination between infectious and non-infectious human norovirus using porcine gastric mucin.</a> Int. J. Food Microbiol. 155 (3), 222-226 (2012).</li><li>Li, X., Chen, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+the+porcine+gastric+mucin+binding+assay+for+high-pressure-inactivation+studies+using+murine+norovirus+and+Tulane+virus.">Evaluation of the porcine gastric mucin binding assay for high-pressure-inactivation studies using murine norovirus and Tulane virus.</a> Appl. Environ. Microbiol. 81 (2), 515-521 (2015).</li><li>Lou, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-pressure+inactivation+of+human+norovirus+virus-like+particles+provides+evidence+that+the+capsid+of+human+norovirus+is+highly+pressure+resistant.">High-pressure inactivation of human norovirus virus-like particles provides evidence that the capsid of human norovirus is highly pressure resistant.</a> Appl. Environ. Microbiol. 78 (15), 5320-5327 (2012).</li><li>Wang, D., Tian, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+conditions+for+human+norovirus+measured+by+an+in+situ+capture-qRT-PCR+method.">Inactivation conditions for human norovirus measured by an in situ capture-qRT-PCR method.</a> Int. J. Food Microbiol. 172, 76-82 (2014).</li><li>Wang, D., Xu, S., Yang, D., Young, G. M., Tian, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+in+situ+capture+quantitative+(real-time)+reverse+transcription-PCR+method+as+an+alternative+approach+for+determining+inactivation+of+Tulane+virus.">New in situ capture quantitative (real-time) reverse transcription-PCR method as an alternative approach for determining inactivation of Tulane virus.</a> Appl. Environ. Microbiol. 80 (7), 2120-2124 (2014).</li><li>Moore, M. D., Bobay, B. G., Mertens, B., Jaykus, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+aptamer+exhibits+high+degree+of+target+conformation-dependent+binding+similar+to+that+of+receptors+and+discriminates+particle+functionality.">Human norovirus aptamer exhibits high degree of target conformation-dependent binding similar to that of receptors and discriminates particle functionality.</a> mSphere. 1 (6), e00298-e00216 (2016).</li><li>Moore, M. D., Escudero-Abarca, B. I., Suh, S. H., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+and+characterization+of+nucleic+acid+aptamers+targeting+the+capsid+P+domain+of+a+human+norovirus+GII.4+strain.">Generation and characterization of nucleic acid aptamers targeting the capsid P domain of a human norovirus GII.4 strain.</a> J. Biotechnol. 209, 41-49 (2015).</li><li>Kitamoto, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cross-Reactivity+among+Several+Recombinant+Calicivirus+Virus-Like+Particles+(VLPs)+with+Monoclonal+Antibodies+Obtained+from+Mice+Immunized+Orally+with+One+Type+of+VLP.">Cross-Reactivity among Several Recombinant Calicivirus Virus-Like Particles (VLPs) with Monoclonal Antibodies Obtained from Mice Immunized Orally with One Type of VLP.</a> J. Clin. Microbiol. 40 (7), 2459-2465 (2002).</li><li>Giamberardino, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrasensitive+norovirus+detection+using+DNA+aptasensor+technology.">Ultrasensitive norovirus detection using DNA aptasensor technology.</a> PloS one. 8 (11), e79087 (2013).</li><li>Beier, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+of+a+DNA+aptamer+against+norovirus+capsid+protein+VP1.">Selection of a DNA aptamer against norovirus capsid protein VP1.</a> FEMS Microbiol. Lett. 351 (2), 162-169 (2014).</li><li>Escudero-Abarca, B. I., Suh, S. H., Moore, M. D., Dwivedi, H. P., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection,+characterization+and+application+of+nucleic+acid+aptamers+for+the+capture+and+detection+of+human+norovirus+strains.">Selection, characterization and application of nucleic acid aptamers for the capture and detection of human norovirus strains.</a> PloS one. 9 (9), e106805 (2014).</li><li>Bhattacharjee, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DLS+and+zeta+potential+-+What+they+are+and+what+they+are+not?.">DLS and zeta potential - What they are and what they are not?.</a> Journal Control. Release. 235, 337-351 (2016).</li><li>Khodabandehloo, A., Chen, D. D. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Particle+sizing+methods+for+the+detection+of+protein+aggregates+in+biopharmaceuticals.">Particle sizing methods for the detection of protein aggregates in biopharmaceuticals.</a> Bioanalysis. 9 (3), 313-326 (2017).</li><li>Mattle, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+virus+aggregation+on+inactivation+by+peracetic+acid+and+implications+for+other+disinfectants.">Impact of virus aggregation on inactivation by peracetic acid and implications for other disinfectants.</a> Environ. Sci. Technol. 45, 7710-7717 (2011).</li><li>Samandoulgou, I., Fliss, I., Jean, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zeta+potential+and+aggregation+of+virus-like+particle+of+human+norovirus+and+feline+calicivirus+under+different+physicochemical+conditions.">Zeta potential and aggregation of virus-like particle of human norovirus and feline calicivirus under different physicochemical conditions.</a> Food Environ. Virol. 7 (3), 249-260 (2015).</li><li>Mertens, B. S., Velev, O. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Soft+matter+norovirus+interactions.">Soft matter norovirus interactions.</a> Soft Matter. 11, 8621-8631 (2015).</li><li>Panyukov, Y., Yudin, I., Drachev, V., Dobrov, E., Kurganov, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+study+of+amorphous+aggregation+of+tobacco+mosaic+virus+coat+protein+by+dynamic+light+scattering.">The study of amorphous aggregation of tobacco mosaic virus coat protein by dynamic light scattering.</a> Biophys. Chem. 127 (1-2), 9-18 (2007).</li><li>Moore, M. D., Escudero-Abarca, B. I., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Enzyme-Linked+Aptamer+Sorbent+Assay+to+Evaluate+Aptamer+Binding.">An Enzyme-Linked Aptamer Sorbent Assay to Evaluate Aptamer Binding.</a> Methods in Molecular Biology. 1575, 291-302 (2017).</li><li>Langlet, J., Gaboriaud, F., Gantzer, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+pH+on+plaque+forming+unit+counts+and+aggregation+of+MS2+bacteriophage.">Effects of pH on plaque forming unit counts and aggregation of MS2 bacteriophage.</a> J. Appl. Microbiol. 103, 1632-1638 (2007).</li><li>Manuel, C. S., Moore, M. D., Jaykus, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Destruction+of+the+Capsid+and+Genome+of+GII.4+Human+Norovirus+Occurs+during+Exposure+to+Metal+Alloys+Containing+Copper.">Destruction of the Capsid and Genome of GII.4 Human Norovirus Occurs during Exposure to Metal Alloys Containing Copper.</a> Appl. Environ. Microbiol. 81 (15), 4940-4946 (2015).</li><li>Warnes, S. L., Summersgill, E. N., Keevil, C. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+murine+norovirus+on+a+range+of+copper+alloy+surfaces+is+accompanied+by+loss+of+capsid+integrity.">Inactivation of murine norovirus on a range of copper alloy surfaces is accompanied by loss of capsid integrity.</a> Appl. Environ. Microbiol. , (2014).</li><li>Manuel, C., Moore, M. D., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficacy+of+a+disinfectant+containing+silver+dihydrogen+citrate+against+GI.6+and+GII.4+human+norovirus.">Efficacy of a disinfectant containing silver dihydrogen citrate against GI.6 and GII.4 human norovirus.</a> J. Appl. Microbiol. 122 (1), 78-86 (2017).</li><li>Green, N. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avidin+and+streptavidin.">Avidin and streptavidin.</a> Methods Enzymol. 184, 51-67 (1990).</li><li>Kingsley, D. H., Vincent, E. M., Meade, G. K., Watson, C. L., Fan, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+human+norovirus+using+chemical+sanitizers.">Inactivation of human norovirus using chemical sanitizers.</a> Int. J. Food Microbiol. 171, 94-99 (2014).</li><li>Tian, P., Yang, D., Quigley, C., Chou, M., Jiang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+the+Tulane+virus,+a+novel+surrogate+for+the+human+norovirus.">Inactivation of the Tulane virus, a novel surrogate for the human norovirus.</a> J. Food Prot. 76 (4), 712-718 (2013).</li><li>Li, D., Baert, L., Van Coillie, E., Uyttendaele, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Critical+studies+on+binding-based+RT-PCR+detection+of+infectious+noroviruses.">Critical studies on binding-based RT-PCR detection of infectious noroviruses.</a> J. Virol. Methods. 177 (2), 153-159 (2011).</li></ol>

Yazarlar ifşa gerek yok.

İletişim kuralı ve burada açıklanan teknikleri insan norovirus kapsid bütünlüğü/işlevleri değerlendirmek için bir yol sağlar. Bu yöntemler mekanik kavrama içine belgili tanımlık virüs karşı inactivation tedavi etkileri elde etmek için kullanılabilir ve potansiyel olarak daha geleneksel inactivation değerlendirme yöntemleri gibi RT-qPCR veya plak tahlil destekleyebilirsiniz. Örneğin, kimyasal veya fiziksel inactivation plak tahlil yalnız tarafından değerlendirilmesi virüs inactivation derece...

İnsan norovirus sorumludur için önemli halk sağlığı yük genel olarak, 685 milyon hastalıklar ve 212,000 ölüm neden her yıl1, dolar2,3milyarlarca bir maliyetle. Bugün, norovirus algılama ve miktar genom amplifikasyon ve/veya ligand tabanlı platformlar içerir. Daha duyarlıdır, nicel bilgi sağlar ve yanlış pozitif sonuçlar4genellikle düşük riski vardır eski genellikle tercih edilir. En yaygın norovirus algılama ve miktar genom amplifikasyon tekniği transkriptaz nicel Polimeraz zincir reaksiyonu (RT-qPCR) olduğunu. Çünkü bu hedefler ve insan norovirus genom küçük bir parçasını güçlendirir, RT-qPCR yalnız arasında ayrımcılık bulaşıcı yeteneğine sahip değildir ve bulaşıcı olmayan parçacıklar, ücretsiz genomik RNA genleri içeren capsids ve capsids ile ölümcül zarar genleri mutasyona uğramış/kesildi hala RT-qPCR tarafından çoğaltılabilir. İki yeni vitro yetiştirme teknikleri insan norovirus5,6 için son zamanlarda bildirilmiştir, her ikisi de hala RT-qPCR üzerinde virüs miktar için itimat ve henüz rutin klinik/çevre için uygun yöntemleri değildir insan noroviruses için test. Böylece, RT-qPCR klinik/çevre testleri için altın standart kalır.
Diğer vitro yöntemleri bir çaba daha iyi norovirus parçacıklar infektivite durumunu tahmin etmek için geliştirilmiştir. Bu yöntemler genellikle norovirus kapsid bütünlüğünü gidermek ve genom bütünlük değerlendirilmesi kategorize edilebilir. Eski yaklaşım daha popülerdir. Ancak bu ölümcül mutasyona viral parçacıkların yanı sıra sağlam kalır, ancak ana bilgisayar reseptörleri/co-faktörler bağlamak için yetenek eksikliği viral parçacıkların için hesaba katmaz RNase Önarıtma viral genomik RNA, çıkarma önce yaygın olarak kullanılan bir yöntem olduğunu veya kesilmiş ya da marjinal bozuk genleri7. Kapsid bütünlük de değerlendirildi virüs insan norovirus co-receptor/co-karbonhidrat olan faktörler, bağlama yeteneği dayalı histo-kan grubu antijenleri (HBGAs) da bilinir. HBGAs glikoproteinlerin veya glikolipitler (arasında birden çok diğer dokulara) parçası olarak ana bağırsak epitel hücrelerinde bulunan ve vücut sıvıları gibi salya salgıladığı. Enterik bakteri onların yüzeylerde HBGA benzeri maddeler içeren aynı zamanda insan norovirus8,9,10bağlamak için gösterilmiştir ve bu tür etkileşimler norovirus enfeksiyon5teşvik edebilir. HBGA bağlama kullanan temel kavramı sadece viral parçacıkların sözde reseptör/co-factor bağlama yetenekli hücreleri bulaşmasını yeteneğine sahip olacak olan. Birden fazla çalışmalar boncuk tabanlı HBGA bağlama nükleik asit amplifikasyon önceki infektivite ayrımcılık11,12,13,14için umut verici bir yöntem olduğunu göstermektedir, 15,16. HBGAs ile ilgili büyük bir sorun olduğunu hiçbir HBGA türü tüm insan norovirus genotip bağlayabilirsiniz. Bu sorunu çözmek için HBGAs içerir, domuz Gastrik müsin arıtılmış HBGA karbonhidrat sentezi, tutarlılık ve düşük maliyet kolaylığı çıkarına yerine kullanılmıştır.
Son yayın tarafından Moore vd. 17 insan norovirus kapsid bütünlük tahmin etmek için yeni teknikleri bir dizi tanıttı. HBGAs yerine, Moore vd. 17 geniş reaktif nükleik asit aptamer (M6-2)18 ve geniş reaktif Monoklonal antikor (NS14)19 ısıl GII.4 Sydney norovirus capsids (virüs gibi parçacıkların veya VIP) için bağlama incelenmiş ve bu karşılaştırıldığında sentetik HBGAs için bağlanma. Nükleik asit aptamers kısa (~ 20-80 nt) tek telli nükleik sırasına bir sonucu olarak benzersiz üç boyutlu yapılar içine kat ve bir hedef bağlamak asitler (ssDNA veya RNA) vardır. Nükleik asitler olduklarından daha az masraflı olduklarını; kolayca kimyasal sentez, saflaştırılmış ve değiştirilmiş; ve ısı için kararlı. Aptamers noroviruses karşı oluşturulan çeşitli raporlar var, bazıları ile suşları18,20,21,22çeşitli geniş reaktivite gösterilen. Örnek yoluyla, Moore vd. 17 o aptamer M6-2 arıtılmış, birleştirilmiş insan norovirus capsids (VIP) bağlanmış ve benzer şekilde yüksek sipariş (Örneğin, ikincil ve üçüncül) protein yapısı için korumak için viral kapsid üzerine güven içinde HBGA için davrandım gösterdi gerçekleşmesi için bağlayıcı. Öte yandan, capsids tamamen denatüre sonra norovirus VIP bağlama antikor için önemli bir bölümünü NS14 kaldı. Moore ve ark. çalışmayla bağlamasında norovirus değerlendirilmesi 17 yapıldı aptamers antikorlar yerine kullanılır istisna ile ELISA için benzer bir basit, plaka tabanlı yöntemi kullanarak (dolayısıyla yöntem ELASA çağrıldı). Bu yüksek işlem hacmi deneysel yöntem farklı tedaviler norovirus kapsid, fiziksel veya kimyasal stres maruz üzerine viral inactivation mekanizmasının anlamak için değerli iş üzerinde etkilerini değerlendirmek için kullanıldı. Ancak, bu yöntemin bir dezavantajı düşük duyarlılık ve matris ilişkili kirletici non-spesifik bağlama tarafından aptamers neden yüksek düzeyde için hoşgörü eksikliği var.
Moore vd. 17 başka bir yöntem, dinamik ışık (DL), saçılma toplama ısıl işlem yanıt olarak viral parçacıkların izlemek için kullanılır. DLS nanopartikül süspansiyonlar boyutunu değerlendirmek için yaygın olarak kullanılır ve proteinler23,24 ve virüsleri25,26,27için genişletilmiş. Çözüm parçacıklar tarafından dağınık ışığın şiddetini partikül büyüklüğü, difüzyon katsayısı ve köklü formülleri kullanarak parçacık çapı hesaplanması için izin veren bir fonksiyonu olarak değişiklik gösterir. DLS tekniği dağınık virüsler, bireysel kapsid protein veya dimer ve virüs toplam boyutu27tarihinde dayalı olarak algılanmasını sağlar Nano aşağı dağınık parçacıkların hidrodinamik çapı ayırt edebilirsiniz. Virüs toplama, parçacık boyutu, bir artış gösterdiği kapsid bütünlüğü kaybı göstergesidir. Kapsid denatüre ve yapısını bozdu, hidrofobik kalıntıları maruz olur ve parçacıklar birlikte hareket ve toplamları oluşturmak neden. DLS den sonra belirtilen bir tedavi ya da gerçek zamanlı17,28toplamada Kinetik partikül büyüklüğü ölçmek için kullanılabilir. Bu yöntem gözlem kapsid davranışının çözümde izin avantajı vardır ama hangi-ebilmek değil var olmak tamamen doğal haliyle virüs temsilcisi arıtılmış kapsid, yüksek konsantrasyonda gerektirir.
Moore ve ark. tarafından kullanılan son yöntem 17 transmisyon elektron mikroskobu (TEM) yapıldı. Her ne kadar bu yöntemi duyarlılık yoksun ve nicel veri üretmek değildir viral kapsid yapısı üzerinde farklı tedavilerin etkileri görselleştirme için sağlar. Henüz ideal değil her ne kadar klinik/çevre ayarları için bu yöntemleri birlikte insan norovirus inactivation anlamakta değerlidir. Bu makalenin amacı, plaka tabanlı bağlama tahlil için (ELASA), DL, derinlemesine protokolleri sağlamaktır ve TEM hazırlama yöntemleri için kullanılan tedaviler etkileri kapsid bağlamında norovirus kapsid ısı tedavi etkilerini araştırmak Moore ve ark. içinde sunulan bütünlüğü 17.

<table><tbody><tr><td>&lt;strong&gt;Plate-Based Binding Assay for Evaluating Loss of Higher Order Norovirus Capsid Structure&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>96-well, medium-binding polystyrene EIA plate</td><td>Fisher (Costar)</td><td>07-200-36</td><td></td></tr><tr><td>Lid for 96-well plate</td><td>Thermo Fisher</td><td>3098</td><td></td></tr><tr><td>Paraffin film (Parafilm)</td><td>Thermo Fisher</td><td>PM999</td><td></td></tr><tr><td>1x PBS (pH 7.2)</td><td>Life Technologies</td><td>20012-050</td><td></td></tr><tr><td>Polysorbate 20</td><td>Sigma-Aldrich</td><td>P9416</td><td></td></tr><tr><td>1x PBS (pH 7.2) + 0.05% Polysorbate 20</td><td>N/A</td><td>N/A</td><td></td></tr><tr><td>Purified, assembled human norovirus GII.4 capsids</td><td>N/A</td><td>N/A</td><td></td></tr><tr><td>Individual 0.2 ml PCR tubes</td><td>Genesee Scientific</td><td>22-154G</td><td></td></tr><tr><td>2 thermocyclers</td><td>Bio-Rad</td><td>1861096</td><td></td></tr><tr><td>Tabletop mini centrifuge</td><td>Fisher Scientific</td><td>12-006-901</td><td></td></tr><tr><td>Skim milk solids</td><td>Thermo Fisher</td><td>LP0031B</td><td></td></tr><tr><td>Synthetic histo-blood group type A disaccharide, biotinylated</td><td>Glycotech</td><td>01-017</td><td></td></tr><tr><td>Biotinylated aptamer M6-2 (stock concentration 100 &amp;micro;M in nuclease-free water): 5&#039;-/5Biosg/AGTATACGTATTACCTGCAGCTGGGAAGAGGTCCGGTAAATGCAGGGTCAGCCCGGAGAGCGATATCTCGGAGATCTTGC -3&amp;rsquo;</td><td>Integrated DNA Technologies</td><td>N/A</td><td></td></tr><tr><td>Streptavidin-horseradish peroxidase conjugate (ELISA grade), We use Life Technologies SNN2004</td><td>Life Technologies</td><td>SNN2004</td><td></td></tr><tr><td>3,3&amp;rsquo;,5,5&amp;rsquo;-tetramethylbenzidine (TMB) substrate, room temperature</td><td>Thermo Fisher</td><td>50-76-00</td><td></td></tr><tr><td>1 M phosphoric acid</td><td>N/A</td><td>N/A</td><td></td></tr><tr><td>Microplate reader capable of reading 450 nm</td><td>Tecan</td><td>Infinite m200 Pro</td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;Analysis of Plate-Based Assay Results&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Microsoft Excel or similar program</td><td>N/A</td><td>N/A</td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;Dynamic Light Scattering Experiments&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Zetasizer ZSP, or similar particle size analysis instrument</td><td>Malvern Instruments</td><td>N/A</td><td></td></tr><tr><td>Vortex</td><td>Fisher Scientifc</td><td>02-215-365</td><td></td></tr><tr><td>Quartz cuvette</td><td>Hellma</td><td>104-002-10-40</td><td></td></tr><tr><td>Small volume disposable cuvette (to reduce VLP use)</td><td>Malvern Instruments</td><td>ZEN0040</td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;Transmission Electron Microscopy Sample Preparation&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Nickel electron microscopy grids with carbon support film</td><td>Ladd Research</td><td>10880-100</td><td></td></tr><tr><td>Self-closing reverse electron microscopy tweezers</td><td>Ted Pella</td><td>5372-NM</td><td></td></tr><tr><td>Qualitative filter paper</td><td>Sigma-Aldrich (Whatman)</td><td>WHA1002055</td><td></td></tr><tr><td>Glass petri dishes</td><td>Sigma-Aldrich</td><td>BR455743</td><td></td></tr><tr><td>100 mM stock HEPES solution (pH 7.2)</td><td>N/A</td><td>N/A</td><td></td></tr><tr><td>2% uranyl acetate</td><td>N/A</td><td>N/A</td><td></td></tr></tbody></table>

alternative in vitro methods for the determination of viral capsid structural integrity

İnsan norovirus önemli halk sağlığı ve ekonomik kayıplar dünya çapında önyargısı. Vitro ortaya çıkan ekimi gelişmeler henüz rutin virüs tespiti için geçerli değildir. Geçerli algılama ve öncelikle nükleik asit amplifikasyon güveniyor, miktar teknikleri bulaşıcı olmayan bulaşıcı viral saçılan ayırımcılık değil. Bu makalenin amacı birlikte daha da viral parçacıkların infektivite durumu hakkında bilgi almak için kullanılan teknikleri son gelişmeler üzerine belirli ayrıntıları sunmaktır. Bir tekniği norovirus ssDNA aptamer capsids için bağlama değerlendirme içerir. Aptamers kolayca sentezlenmiş ve avantajına sahip ve are ucuz ve istikrarlı. Başka bir tekniği, ışık saçılma (DL), dinamik kapsid davranış çözümde gözlemleyerek avantajına sahiptir. Elektron mikroskobu viral capsids yapısal bütünlüğünü görselleştirme için sağlar. Umut verici olsa da, bazı dezavantajları vardır her tekniği, non-spesifik aptamer bağlama olumlu tahsil moleküllere örnek matrisler, gelen arıtılmış kapsid DLS için gerekliliğini ve zavallı duyarlılık için elektron mikroskobu gibi için. Bu tekniklerin birlikte kullanıldığında, yine de, üretilen veri gövdesi daha kapsamlı bilgi infektivite, doğru değerlendirilmesi için gerekli olan bilgileri çıkarmak için kullanılan norovirus kapsid bütünlük sağlar inactivation yöntemleri veya virüs algılama yorumlanması. Bu makalede, bulaşıcı insan norovirus parçacıklar ayırımcılık için bu yöntemleri kullanarak iletişim kurallarını sağlar.

İnsan norovirus GII.4 Sydney capsids (VIP) yapısal bütünlüğünü birkaç roman Moore ve ark. tarafından sunulan gibi yöntemlerle değerlendirildi 17. ilk, bir deney yapıldı capsids bütünlüğünü yeteneklerini bir sözde reseptör/co-factor (HBGA) veya ssDNA aptamer (M6-2) bağlamak için bir fonksiyonu olarak edildi (Resim 1) karşılaştırıldığında. Görüntülenen sonuçları daha önce Moore ve ark.</...

Watch this Scientific Journal Video about Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity at JoVE.com

Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity

Viral genom amplifikasyon kullanan rutin algılama yöntemleri bulaşıcı olmayan parçacıklar bulaşıcı ayırımcılık için kendi yetersizlik tarafından sınırlıdır. Bu makalenin amacı, aptamer bağlama, dinamik ışık saçılma ve transmisyon elektron mikroskobu kullanılarak bulaşıcı norovirus parçacıkların ayrımcılık yardım etmek alternatif yöntemler detaylı protokollerde sağlamaktır.

Viral kapsid yapısal bütünlük belirlenmesi için alternatif Vitro yöntemleri

Human norovirus exacts considerable public health and economic losses worldwide. Emerging in vitro cultivation advances are not yet applicable for routine ...

alternative-vitro-methods-for-determination-viral-capsid-structural

Research

JoVE Journal

Immunology and Infection

Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity

8.0K Görüntüleme.  North Carolina State University. Viral genom amplifikasyon kullanan rutin algılama yöntemleri bulaşıcı olmayan parçacıklar bulaşıcı ayırımcılık için kendi yetersizlik tarafından sınırlıdır. Bu makalenin amacı, aptamer bağlama, dinamik ışık saçılma ve transmisyon elektron mikroskobu kullanılarak bulaşıcı norovirus parçacıkların ayrımcılık yardım etmek alternatif yöntemler detaylı protokollerde sağlamaktır.

Video: Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity

Preparation of Viral DNA from Nucleocapsids

Viruses are obligate cellular parasites, and thus the study of their DNA requires isolating viral material away from host cell contaminants and DNA. Several downstream applications require large quantities of pure viral DNA, which is provided by this protocol. These applications include viral genome sequencing, where the removal of host DNA is crucial to optimize data output for viral sequences, and the production of new viral recombinant strains, where co-transfection of purified plasmid and linear viral DNA facilitates recombination.1,2,3 
This procedure utilizes a combination of extractions and density-based centrifugation to isolate purified linear herpesvirus nucleocapsid DNA from infected cells.4,5 The initial purification steps aim to isolate purified viral capsids, which contain and protect the viral DNA during the extractions and centrifugation steps that remove cellular proteins and DNA. Lysis of nucleocapsids then releases viral DNA, and two final phenol-chloroform steps remove remaining proteins. The final DNA captured from solution is highly concentrated and pure, with an average OD260/280 of 1.90. Depending on the quantity of infected cells used, yields of viral DNA range from 150-800 &mu;g or more. The purity of this DNA makes it stable during long-term storage at 4C. This DNA is thus ideally suited for high-throughput sequencing, high fidelity PCR reactions, and transfections. 
Prior to beginning the protocol, it is important to know the average number of cells per dish (e.g. an average of 8 x 106 PK-15 cells in a confluent 15 cm dish), and the titer of the viral stock to be used (e.g. 1 x 108 plaque-forming units per ml). These are necessary to calculate the appropriate multiplicity of infection (MOI) for the protocol.6 For instance, to infect one 15 cm dish of PK-15 cells with the above viral stock, at an MOI of 5, you would use 400 &mu;l of viral stock and dilute it with 3.6 ml of medium (total inoculation volume of 4 ml for one 15 cm plate).
Multiple viral DNA preparations can be prepared at the same time. The number of simultaneous preparations is limited only by the number of tubes held by the ultracentrifuge rotor (one per virus; see step 3.9 below). Here we describe the procedure as though being done for one virus.

We describe the process of isolating high purity herpesvirus nucleocapsid DNA from infected cells. The final DNA captured from solution is of high concentration and purity, making it ideally suited for high-throughput sequencing, high fidelity PCR reactions, and transfections to produce new viral recombinants.

Nucleocapsids gelen Viral DNA hazırlanması

Viruses are obligate cellular parasites, and thus the study of their DNA requires isolating viral material away from host cell contaminants and DNA. ...

İmmünoloji ve Enfeksiyon

In vitro Uncoating of HIV-1 Cores

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is composed of CA protein arranged as a lattice of hexagon. The capsid is closed by 7 pentamers at the broad end and 5 at the narrow end of the cone1, 2. Encased in this capsid shell is the viral ribonucleoprotein complex, and together they comprise the core.
Following fusion of the viral membrane with the target cell membrane, the HIV-1 is released into the cytoplasm. The capsid then disassembles releasing free CA in the soluble form3 in a process referred to as uncoating. The intracellular location and timing of HIV-1 uncoating are poorly understood. Single amino-acid substitutions in CA that alter the stability of the capsid also impair the ability of HIV-1 to infect cells4. This indicates that the stability of the capsid is critical for HIV-1 infection.
HIV-1 uncoating has been difficult to study due to lack of availability of sensitive and reliable assays for this process. Here we describe a quantitative method for studying uncoating in vitro using cores isolated from infectious HIV-1 particles. The approach involves isolation of cores by sedimentation of concentrated virions through a layer of detergent and into a linear sucrose gradient, in the cold. To quantify uncoating, the isolated cores are incubated at 37&deg;C for various timed intervals and subsequently pelleted by ultracentrifugation. The extent of uncoating is analyzed by quantifying the fraction of CA in the supernatant. This approach has been employed to analyze effects of viral mutations on HIV-1 capsid stability4, 5, 6. It should also be useful for studying the role of cellular factors in HIV-1 uncoating.

In vitro Uncoating of HIV-1 Cores

Uncoating is an essential step in the early phase of the HIV-1 life cycle and is defined as the disassembly of the capsid shell and the release of the viral ribonucleoprotein complex (vRNP). Here, we demonstrate techniques for isolating intact cores from HIV-1 virions and for quantifying their uncoating in vitro.

HIV-1 Çekirdek in vitro Uncoating

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is ...

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal phase during establishment of infection in a given host. Consequently, study of encapsidation deciphers the information regarding the know-how of the mechanism regulating virus assembly to form infectious virions. Such information is vital in formulating novel methods of curbing virus spread and disease control. Virus encapsidation can be studied in vivo and in vitro. Genome encapsidation in vivo is a highly regulated selective process involving macromolecular interactions and subcellular compartmentalization. Therefore, study leading to dissect events encompassing virus encapsidation in vivo would provide basic knowledge to understand how viruses proliferate and assemble. Recently in vitro encapsidation has been exploited for the research in the area of biomedical imaging and therapeutic applications. Non-enveloped plant viruses stand far ahead in the venture of in vitro encapsidation of the negatively charged foreign material. Brome mosaic virus (BMV), a non-enveloped multicomponent RNA virus pathogenic to plants, has been used as a model system for studying genome packaging in vivo and in vitro. For encapsidation assays in Nicotiana benthamiana plants, Agrobacterium -mediated transient expression, refer to as agroinfiltration, is an efficient and robust technique for the synchronized delivery and expression of multiple components to the same cell. In this approach, a suspension of Agrobacterium tumefaciens cells carrying binary plasmid vectors carrying cDNAs of desiredviral mRNAs is infiltrated into the intercellular space withina leaf using nothing more sophisticated than a 1 ml disposable syringe (without needle). This process results in the transfer of DNA insert into plant cells; the T-DNA insert remains transiently in the nucleus and is then transcribed by the host polymerase II, leading to the transient expression. The resulting mRNA transcript (capped and polyadenylated) is then exported to the cytoplasm for translation. After approximately 24 to 48 hours of incubation,sections of infiltrated leaves can be sampled for microscopyor biochemical analyses. Agroinfiltration permits large numbers (hundreds to thousands) of cells to be transfected simultaneously. For in vitro encapsidation, purified virions of BMV are dissociated into capsid protein by dialyzing against dissociation buffer containing calcium chloride followed by removal of RNA and un-dissociated virions by centrifugation. Genome depleted capsid protein subunits are then reassembled with desired viral genome components or non-viral components such as indocyanine dye.

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

A simple, efficient and robust way to synchronize the delivery of multiple viral components to plant cells via Agrobacterium-mediated transient expression is described. This approach is amenable for studying replication, encapsidation followed by in vitro reassembly of non-viral components into genome depleted optical viral ghosts suitable for biomedical applications.

Basit ve Sağlam In vivo Ve In vitro</emVirüs Meclisi Öğrenmenin> Yaklaşım

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal ...

Isolation and Genome Analysis of Single Virions using 'Single Virus Genomics'

Whole genome amplification and sequencing of single microbial cells enables genomic characterization without the need of cultivation 1-3. Viruses, which are ubiquitous and the most numerous entities on our planet 4 and important in all environments 5, have yet to be revealed via similar approaches. Here we describe an approach for isolating and characterizing the genomes of single virions called 'Single Virus Genomics' (SVG). SVG utilizes flow cytometry to isolate individual viruses and whole genome amplification to obtain high molecular weight genomic DNA (gDNA) that can be used in subsequent sequencing reactions.

Single Virus Genomics (SVG) is a method to isolate and amplify the genomes of single virons. Viral suspensions of a mixed assemblage are sorted using flow cytometry onto a microscope slide with discrete wells containing agarose, thereby capturing the virion and reducing genome shearing during downstream processing. Whole genome amplification is achieved using multiple displacement amplification (MDA) resulting in genomic material that is suitable for sequencing.

&#39;Tek Virüs Genomik&#39; kullanarak Tek viryonlar İzolasyonu ve Genom Analizi

Whole genome amplification and sequencing of single microbial cells enables genomic characterization without the need of cultivation 1-3. Viruses, which ...

Method for Measurement of Viral Fusion Kinetics at the Single Particle Level

Membrane fusion is an essential step during entry of enveloped viruses into cells. Conventional fusion assays typically report on a large number of fusion events, making it difficult to quantitatively analyze the sequence of the molecular steps involved. We have developed an in vitro, two-color fluorescence assay to monitor kinetics of single virus particles fusing with a target bilayer on an essentially fluid support.
Influenza viral particles are incubated with a green lipophilic fluorophore to stain the membrane and a red hydrophilic fluorophore to stain the viral interior. We deposit a ganglioside-containing lipid bilayer on the dextran-functionilized glass surface of a flow cell, incubate the viral particles on the planar bilayer and image the fluorescence of a 100 x 100 &mu;m2 area, containing several hundreds of particles, on a CCD camera. By imaging both the red and green fluorescence, we can simultaneously monitor the behavior of the membrane dye (green) and the aqueous content (red) of the particles.
Upon lowering the pH to a value below the fusion pH, the particles will fuse with the membrane. Hemifusion, the merging of the outer leaflet of the viral membrane with the outer leaflet of the target membrane, will be visible as a sudden change in the green fluorescence of a particle. Upon the subsequent fusion of the two remaining distal leaflets a pore will be formed and the red-emitting fluorophore in the viral particle will be released under the target membrane. This event will give rise to a decrease of the red fluorescence of individual particles. Finally, the integrated fluorescence from a pH-sensitive fluorophore that is embedded in the target membrane reports on the exact time of the pH drop.
From the three fluorescence-time traces, all the important events (pH drop, lipid mixing upon hemifusion, content mixing upon pore formation) can now be extracted in a straightforward manner and for every particle individually. By collecting the elapsed times for the various transitions for many individual particles in histograms, we can determine the lifetimes of the corresponding intermediates. Even hidden intermediates that do not have a direct fluorescent observable can be visualized directly from these histograms.

We present an in vitro, two-color fluorescence assay to visualize the fusion of single virus particles with a fluid target bilayer. By labeling viral particles with fluorophores that differentially stain the viral membrane and its interior, we are able to monitor the kinetics of hemifusion and pore formation.

Tek Parçacık Düzeyinde Viral Fusion Kinetik Ölçüm yöntemi

Membrane fusion is an essential step during entry of enveloped viruses into cells. Conventional fusion assays typically report on a large number of fusion ...

Biyoloji

Highly Sensitive Assay for Measurement of Arenavirus-cell Attachment

Arenaviruses are a family of enveloped RNA viruses that cause severe human disease. The first step in the arenavirus life cycle is attachment of viral particles to host cells. While virus-cell attachment can be measured through the use of virions labeled with biotin, radioactive isotopes, or fluorescent dyes, these approaches typically require high multiplicities of infection (MOI) to enable detection of bound virus. We describe a quantitative (q)RT-PCR-based assay that measures Junin virus strain Candid 1 attachment via quantitation of virion-packaged viral genomic RNA. This assay has several advantages including its extreme sensitivity and ability to measure attachment over a large dynamic range of MOIs without the need to purify or label input virus. Importantly, this approach can be easily tailored for use with other viruses through the use of virus-specific qRT-PCR reagents. Further, this assay can be modified to permit measurement of particle endocytosis and genome uncoating. In conclusion, we describe a simple, yet robust assay for highly sensitive measurement of arenavirus-cell attachment.

The first step in the arenavirus life cycle is attachment of viral particles to host cells. We report a quantitative (q)RT-PCR-based assay for ultrasensitive detection and quantitation of arenavirus attachment events.

Arenavirüs hücre Ek Ölçümü için son derece hassas Deneyi

Arenaviruses are a family of enveloped RNA viruses that cause severe human disease. The first step in the arenavirus life cycle is attachment of viral ...

In Vitro Disassembly of Influenza A Virus Capsids by Gradient Centrifugation

Acid-triggered molecular processes closely control cell entry of many viruses that enter through the endocytic system. In the case of influenza A virus (IAV), virus fusion with the endosomal membrane as well as the subsequent disassembly of the viral capsid, called uncoating, is governed by the ionic conditions inside endocytic vesicles. The early steps in the virus life cycle are hard to study because endosomes cannot be directly accessed experimentally, creating the need for an in vitro approach. Here, we describe a method based on velocity gradient centrifugation of purified virions through a two-layer glycerol gradient, which enables analysis of the IAV core and its stability. The gradient contains a non-ionic detergent (NP-40) in its lower layer to remove the viral membrane by solubilization as the virus sediments toward the bottom. At neutral pH, viral cores are pelleted as stable structures. The major core components, matrix protein (M1) and the viral ribonucleoproteins (vRNPs), can be clearly identified in the pellet fraction by SDS-PAGE. Decreasing the pH to 6.0 or lower in the bottom layer selectively removes M1 from the pellet followed by release of vRNPs at more acidic conditions. Viral protein bands on Coomassie-stained gels can be subjected to densitometric quantification to monitor intermediate states of IAV disassembly. Besides pH, other factors that influence viral core stability can be assessed, such as salt concentration and putative viral uncoating factors, simply by modifying the detergent-containing glycerol layer accordingly. Taken together, the presented technique allows highly reproducible and quantitative analysis of viral uncoating in vitro. It can be applied to other enveloped viruses that undergo complex uncoating processes.

In Vitro Disassembly of Influenza A Virus Capsids by Gradient Centrifugation

Disassembly of influenza A virus cores during virus entry into host cells is a multistep process. We describe an in vitro method to analyze the early stages of viral uncoating. In this approach, velocity gradient centrifugation is used to biochemically dissect the steps that initiate uncoating under defined conditions.

Gradient Santrifüj tarafından İnfluenza A Virüsü Kapsidlerin Vitro Demontaj içinde

Acid-triggered molecular processes closely control cell entry of many viruses that enter through the endocytic system. In the case of influenza A virus ...

Correlative Light Electron Microscopy (CLEM) for Tracking and Imaging Viral Protein Associated Structures in Cryo-immobilized Cells

Due to its high resolution, electron microscopy (EM) is an indispensable tool for virologists. However, one of the main difficulties when analyzing virus-infected or transfected cells via EM are the low efficiencies of infection or transfection, hindering the examination of these cells. In order to overcome this difficulty, light microscopy (LM) can be performed first to allocate the subpopulation of infected or transfected cells. Thus, taking advantage of the use of fluorescent proteins (FPs) fused to viral proteins, LM is used here to record the positions of the "positive-transfected" cells, expressing a FP and growing on a support with an alphanumeric pattern. Subsequently, cells are further processed for EM via high pressure freezing (HPF), freeze substitution (FS) and resin embedding. The ultra-rapid freezing step ensures excellent membrane preservation of the selected cells that can then be analyzed at the ultrastructural level by transmission electron microscopy (TEM). Here, a step-by-step correlative light electron microscopy (CLEM) workflow is provided, describing sample preparation, imaging and correlation in detail. The experimental design can be also applied to address many cell biology questions.

Correlative Light Electron Microscopy CLEM for Tracking and Imaging Viral Protein Associated Structures in Cryo-immobilized Cells

A correlative light electron microscopy (CLEM) method is applied to image virus-induced intracellular structures via electron microscopy (EM) in cells that are previously selected by light microscopy (LM). LM and EM are combined as a hybrid imaging approach to achieve an integrated view of virus-host interactions.

Cryo-immobilize hücreler yapılarda bağdaşık ışık elektron izleme ve Viral Protein Imaging mikroskobu (CLEM) ilişkili

Due to its high resolution, electron microscopy (EM) is an indispensable tool for virologists. However, one of the main difficulties when analyzing ...

Biyomühendislik

Assembly and Purification of Prototype Foamy Virus Intasomes

A defining feature and necessary step of the retrovirus life cycle is the integration of the viral genome into the host genome. All retroviruses encode an integrase (IN) enzyme that catalyzes the covalent joining of viral to host DNA, which is known as strand transfer. Integration may be modeled in vitro with recombinant retroviral IN and DNA oligomers mimicking the ends of the viral genome. In order to more closely recapitulate the integration reaction that occurs in vivo, integration complexes are assembled from recombinant IN and synthetic oligomers by dialysis in a reduced salt concentration buffer. The integration complex, called an intasome, may be purified by size exclusion chromatography. In the case of prototype foamy virus (PFV), the intasome is a tetramer of IN and two DNA oligomers and is readily separated from monomeric IN and free oligomer DNA. The integration efficiency of PFV intasomes may be assayed under a variety of experimental conditions to better understand the dynamics and mechanics of retroviral integration.

Recombinant retroviral integrase and DNA oligomers mimicking viral DNA ends can form an enzymatically active complex known as an intasome. Intasomes may be used for biochemical, structural, and kinetic studies. This protocol details how to assemble and purify prototype foamy virus intasomes.

Derleme ve prototip köpüklü virüs Intasomes arıtma

A defining feature and necessary step of the retrovirus life cycle is the integration of the viral genome into the host genome. All retroviruses encode an ...

Production of Adeno-Associated Virus Vectors in Cell Stacks for Preclinical Studies in Large Animal Models

Adeno-associated virus (AAV) vectors are among the most clinically advanced gene therapy vectors, with three AAV gene therapies approved for humans. Clinical advancement of novel applications for AAV involves transitioning from small animal models, such as mice, to larger animal models, including dogs, sheep, and nonhuman primates. One of the limitations of administering AAV to larger animals is the requirement for large quantities of high-titer virus. While suspension cell culture is a scalable method for AAV vector production, few research labs have the equipment (e.g., bioreactors) or know how to produce AAV in this manner. Moreover, AAV titers are often significantly lower when produced in suspension HEK 293 cells as compared to adherent HEK293 cells. Described here is a method for producing large quantities of high-titer AAV using cell stacks. A detailed protocol for titering AAV as well as methods for validating vector purity are also described. Finally, representative results of AAV-mediated transgene expression in a sheep model are presented. This optimized protocol for large-scale production of AAV vectors in adherent cells will enable molecular biology laboratories to advance the testing of their novel AAV therapies in larger animal models.

Here we provide a detailed procedure for large-scale production of research-grade AAV vectors using adherent HEK 293 cells grown in cell stacks and affinity chromatography purification. This protocol consistently yields &#62;1 x 1013 vector genomes/mL, providing vector quantities appropriate for large animal studies.

Büyük Hayvan Modellerinde Preklinik Çalışmalar İçin Hücre Yığınlarında Adeno İlişkili Virüs Vektörlerinin Üretimi

Adeno-associated virus (AAV) vectors are among the most clinically advanced gene therapy vectors, with three AAV gene therapies approved for humans. ...

Viral kapsid yapısal bütünlük belirlenmesi için alternatif Vitro yöntemleri

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler