This work was supported by the Agriculture and Food Research Initiative Competitive Grant no. 2011-68003-30395 from the United States Department of Agriculture, National Institute of Food and Agriculture through the NoroCORE project. Funding for open access charge was provided by the United States Department of Agriculture. We would like to thank Robert Atmar (Baylor College of Medicine, Houston, TX) for kindly providing us the purified capsids and Valerie Lapham for her assistance with the TEM images. We would also like to thank Frank N. Barry for helping us start the experiments presented.

1. Plate-based Binding Assay for Evaluating Loss of Higher Order Norovirus Capsid Structure
NOTE: A very similar ELASA protocol to the one presented here has been published29, and similar ELASA assays have previously been reported as part of research articles elsewhere17,18,22.
<ol>
	<li>Heat treatment of human norovirus GII.4 Sydney capsids
	<ol>
		<li>Obtai...

<ol>
	<li>Kirk, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=World+Health+Organization+estimates+of+the+global+and+regional+disease+burden+of+11+foodborne+bacterial,+protozoal,+and+viral+diseases,+2010:+A+data+synthesis.">World Health Organization estimates of the global and regional disease burden of 11 foodborne bacterial, protozoal, and viral diseases, 2010: A data synthesis.</a> PLOS Med. 12 (12), e1001920 (2015).</li><li>Scharff, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Economic+burden+from+health+losses+due+to+foodborne+illness+in+the+United+States.">Economic burden from health losses due to foodborne illness in the United States.</a> J. Food Prot. 75 (1), 123-131 (2012).</li><li>Lee, B. Y., Mcglone, S. M., Bailey, R. R., Zachary, S., Umscheid, C. A., Muder, R. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Economic+impact+of+outbreaks+of+norovirus+infection+in+hospitals.">Economic impact of outbreaks of norovirus infection in hospitals.</a> Infect. Control Hosp. Epidemiol. 32 (2), 191-193 (2011).</li><li>Law, J. W. -. F., Ab Mutalib, N. -. S., Chan, K. -. G., Lee, L. -. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+methods+for+the+detection+of+foodborne+bacterial+pathogens:+principles,+applications,+advantages+and+limitations.">Rapid methods for the detection of foodborne bacterial pathogens: principles, applications, advantages and limitations.</a> Front. Microbiol. 5, 770 (2015).</li><li>Jones, M. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enteric+bacteria+promote+human+and+mouse+norovirus+infection+of+B+cells.">Enteric bacteria promote human and mouse norovirus infection of B cells.</a> Science. 346 (6210), 755-759 (2014).</li><li>Ettayebi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication+of+human+noroviruses+in+stem+cell+-+derived+human+enteroids.">Replication of human noroviruses in stem cell - derived human enteroids.</a> Science. 5211, (2016).</li><li>Moore, M. D., Goulter, R. M., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+as+a+foodborne+pathogen:+challenges+and+developments.">Human norovirus as a foodborne pathogen: challenges and developments.</a> Annu. Rev. Food Sci. Technol. 6 (1), 411-433 (2015).</li><li>Miura, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histo-blood+group+antigen-like+substances+of+human+enteric+bacteria+as+specific+adsorbents+for+human+noroviruses.">Histo-blood group antigen-like substances of human enteric bacteria as specific adsorbents for human noroviruses.</a> J. Virol. 87 (17), 9441-9451 (2013).</li><li>Almand, E. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+binding+to+select+bacteria+representative+of+the+human+gut+microbiota.">Human norovirus binding to select bacteria representative of the human gut microbiota.</a> Plos One. 12 (3), e0173124 (2017).</li><li>Rubio-del-Campo, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Noroviral+P-Particles+as+an+in+vitro+model+to+assess+the+interactions+of+noroviruses+with+probiotics.">Noroviral P-Particles as an in vitro model to assess the interactions of noroviruses with probiotics.</a> PLoS ONE. 9 (2), e89586 (2014).</li><li>Hirneisen, K. A., Kniel, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+ELISA+attachment+and+infectivity+assays+for+murine+norovirus.">Comparison of ELISA attachment and infectivity assays for murine norovirus.</a> J. Virol. Methods. 186 (1-2), 14-20 (2012).</li><li>Dancho, B. A., Chen, H., Kingsley, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discrimination+between+infectious+and+non-infectious+human+norovirus+using+porcine+gastric+mucin.">Discrimination between infectious and non-infectious human norovirus using porcine gastric mucin.</a> Int. J. Food Microbiol. 155 (3), 222-226 (2012).</li><li>Li, X., Chen, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+the+porcine+gastric+mucin+binding+assay+for+high-pressure-inactivation+studies+using+murine+norovirus+and+Tulane+virus.">Evaluation of the porcine gastric mucin binding assay for high-pressure-inactivation studies using murine norovirus and Tulane virus.</a> Appl. Environ. Microbiol. 81 (2), 515-521 (2015).</li><li>Lou, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-pressure+inactivation+of+human+norovirus+virus-like+particles+provides+evidence+that+the+capsid+of+human+norovirus+is+highly+pressure+resistant.">High-pressure inactivation of human norovirus virus-like particles provides evidence that the capsid of human norovirus is highly pressure resistant.</a> Appl. Environ. Microbiol. 78 (15), 5320-5327 (2012).</li><li>Wang, D., Tian, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+conditions+for+human+norovirus+measured+by+an+in+situ+capture-qRT-PCR+method.">Inactivation conditions for human norovirus measured by an in situ capture-qRT-PCR method.</a> Int. J. Food Microbiol. 172, 76-82 (2014).</li><li>Wang, D., Xu, S., Yang, D., Young, G. M., Tian, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+in+situ+capture+quantitative+(real-time)+reverse+transcription-PCR+method+as+an+alternative+approach+for+determining+inactivation+of+Tulane+virus.">New in situ capture quantitative (real-time) reverse transcription-PCR method as an alternative approach for determining inactivation of Tulane virus.</a> Appl. Environ. Microbiol. 80 (7), 2120-2124 (2014).</li><li>Moore, M. D., Bobay, B. G., Mertens, B., Jaykus, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+aptamer+exhibits+high+degree+of+target+conformation-dependent+binding+similar+to+that+of+receptors+and+discriminates+particle+functionality.">Human norovirus aptamer exhibits high degree of target conformation-dependent binding similar to that of receptors and discriminates particle functionality.</a> mSphere. 1 (6), e00298-e00216 (2016).</li><li>Moore, M. D., Escudero-Abarca, B. I., Suh, S. H., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+and+characterization+of+nucleic+acid+aptamers+targeting+the+capsid+P+domain+of+a+human+norovirus+GII.4+strain.">Generation and characterization of nucleic acid aptamers targeting the capsid P domain of a human norovirus GII.4 strain.</a> J. Biotechnol. 209, 41-49 (2015).</li><li>Kitamoto, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cross-Reactivity+among+Several+Recombinant+Calicivirus+Virus-Like+Particles+(VLPs)+with+Monoclonal+Antibodies+Obtained+from+Mice+Immunized+Orally+with+One+Type+of+VLP.">Cross-Reactivity among Several Recombinant Calicivirus Virus-Like Particles (VLPs) with Monoclonal Antibodies Obtained from Mice Immunized Orally with One Type of VLP.</a> J. Clin. Microbiol. 40 (7), 2459-2465 (2002).</li><li>Giamberardino, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrasensitive+norovirus+detection+using+DNA+aptasensor+technology.">Ultrasensitive norovirus detection using DNA aptasensor technology.</a> PloS one. 8 (11), e79087 (2013).</li><li>Beier, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+of+a+DNA+aptamer+against+norovirus+capsid+protein+VP1.">Selection of a DNA aptamer against norovirus capsid protein VP1.</a> FEMS Microbiol. Lett. 351 (2), 162-169 (2014).</li><li>Escudero-Abarca, B. I., Suh, S. H., Moore, M. D., Dwivedi, H. P., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection,+characterization+and+application+of+nucleic+acid+aptamers+for+the+capture+and+detection+of+human+norovirus+strains.">Selection, characterization and application of nucleic acid aptamers for the capture and detection of human norovirus strains.</a> PloS one. 9 (9), e106805 (2014).</li><li>Bhattacharjee, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DLS+and+zeta+potential+-+What+they+are+and+what+they+are+not?.">DLS and zeta potential - What they are and what they are not?.</a> Journal Control. Release. 235, 337-351 (2016).</li><li>Khodabandehloo, A., Chen, D. D. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Particle+sizing+methods+for+the+detection+of+protein+aggregates+in+biopharmaceuticals.">Particle sizing methods for the detection of protein aggregates in biopharmaceuticals.</a> Bioanalysis. 9 (3), 313-326 (2017).</li><li>Mattle, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+virus+aggregation+on+inactivation+by+peracetic+acid+and+implications+for+other+disinfectants.">Impact of virus aggregation on inactivation by peracetic acid and implications for other disinfectants.</a> Environ. Sci. Technol. 45, 7710-7717 (2011).</li><li>Samandoulgou, I., Fliss, I., Jean, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zeta+potential+and+aggregation+of+virus-like+particle+of+human+norovirus+and+feline+calicivirus+under+different+physicochemical+conditions.">Zeta potential and aggregation of virus-like particle of human norovirus and feline calicivirus under different physicochemical conditions.</a> Food Environ. Virol. 7 (3), 249-260 (2015).</li><li>Mertens, B. S., Velev, O. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Soft+matter+norovirus+interactions.">Soft matter norovirus interactions.</a> Soft Matter. 11, 8621-8631 (2015).</li><li>Panyukov, Y., Yudin, I., Drachev, V., Dobrov, E., Kurganov, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+study+of+amorphous+aggregation+of+tobacco+mosaic+virus+coat+protein+by+dynamic+light+scattering.">The study of amorphous aggregation of tobacco mosaic virus coat protein by dynamic light scattering.</a> Biophys. Chem. 127 (1-2), 9-18 (2007).</li><li>Moore, M. D., Escudero-Abarca, B. I., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Enzyme-Linked+Aptamer+Sorbent+Assay+to+Evaluate+Aptamer+Binding.">An Enzyme-Linked Aptamer Sorbent Assay to Evaluate Aptamer Binding.</a> Methods in Molecular Biology. 1575, 291-302 (2017).</li><li>Langlet, J., Gaboriaud, F., Gantzer, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+pH+on+plaque+forming+unit+counts+and+aggregation+of+MS2+bacteriophage.">Effects of pH on plaque forming unit counts and aggregation of MS2 bacteriophage.</a> J. Appl. Microbiol. 103, 1632-1638 (2007).</li><li>Manuel, C. S., Moore, M. D., Jaykus, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Destruction+of+the+Capsid+and+Genome+of+GII.4+Human+Norovirus+Occurs+during+Exposure+to+Metal+Alloys+Containing+Copper.">Destruction of the Capsid and Genome of GII.4 Human Norovirus Occurs during Exposure to Metal Alloys Containing Copper.</a> Appl. Environ. Microbiol. 81 (15), 4940-4946 (2015).</li><li>Warnes, S. L., Summersgill, E. N., Keevil, C. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+murine+norovirus+on+a+range+of+copper+alloy+surfaces+is+accompanied+by+loss+of+capsid+integrity.">Inactivation of murine norovirus on a range of copper alloy surfaces is accompanied by loss of capsid integrity.</a> Appl. Environ. Microbiol. , (2014).</li><li>Manuel, C., Moore, M. D., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficacy+of+a+disinfectant+containing+silver+dihydrogen+citrate+against+GI.6+and+GII.4+human+norovirus.">Efficacy of a disinfectant containing silver dihydrogen citrate against GI.6 and GII.4 human norovirus.</a> J. Appl. Microbiol. 122 (1), 78-86 (2017).</li><li>Green, N. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avidin+and+streptavidin.">Avidin and streptavidin.</a> Methods Enzymol. 184, 51-67 (1990).</li><li>Kingsley, D. H., Vincent, E. M., Meade, G. K., Watson, C. L., Fan, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+human+norovirus+using+chemical+sanitizers.">Inactivation of human norovirus using chemical sanitizers.</a> Int. J. Food Microbiol. 171, 94-99 (2014).</li><li>Tian, P., Yang, D., Quigley, C., Chou, M., Jiang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+the+Tulane+virus,+a+novel+surrogate+for+the+human+norovirus.">Inactivation of the Tulane virus, a novel surrogate for the human norovirus.</a> J. Food Prot. 76 (4), 712-718 (2013).</li><li>Li, D., Baert, L., Van Coillie, E., Uyttendaele, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Critical+studies+on+binding-based+RT-PCR+detection+of+infectious+noroviruses.">Critical studies on binding-based RT-PCR detection of infectious noroviruses.</a> J. Virol. Methods. 177 (2), 153-159 (2011).</li></ol>

The authors have nothing to disclose.

The protocol and techniques described here provide a means of assessing human norovirus capsid integrity/functionality. These methods can be used for obtaining mechanistic insight into the effects of inactivation treatments against the virus, and can potentially supplement more traditional inactivation evaluation methods such as RT-qPCR or plaque assay. For instance, the evaluation of chemical or physical inactivation by plaque assay alone provides a measure of degree of virus inactivation but not the underlying mechanis...

Human norovirus is responsible for a considerable public health burden globally, causing about 685 million illnesses and 212,000 deaths annually1, at a cost in the billions of dollars2,3. Today, norovirus detection and quantification involves genome amplification and/or ligand-based platforms. The former is generally preferred as it is more sensitive, provides quantitative information, and has generally lower risk of false positive results4. The most common norovirus detection and quantification genome amplification technique is reverse transcriptase quantitative polymerase chain reaction (RT-qPCR). Because it targets and amplifies a small segment of the human norovirus genome, RT-qPCR alone is not capable of discriminating between infectious and non-infectious particles, as free genomic RNA, damaged capsids containing genomes, and capsids with fatally mutated/truncated genomes can still be amplified by RT-qPCR. While two new in vitro cultivation techniques for human norovirus5,6 have been reported recently, both still rely on RT-qPCR for virus quantification and are not yet feasible methods for routine clinical/environmental testing for human noroviruses. Thus, RT-qPCR remains the gold standard for clinical/environmental testing.
Other in vitro methods have been developed in an effort to better estimate the infectivity status of norovirus particles. These methods can be generally categorized as those that address the integrity of the norovirus capsid and those evaluating genome integrity. The former approach is more popular. A commonly used method is RNase pretreatment prior to extraction of viral genomic RNA, however this does not account for viral particles that remain intact but lack the ability to bind host receptors/co-factors, as well as viral particles that have fatally mutated or have truncated or marginally damaged genomes7. Capsid integrity can also be evaluated based on the ability of the virus to bind to human norovirus co-receptor/co-factors, which are carbohydrates known as histo-blood group antigens (HBGAs). HBGAs are present in host intestinal epithelial cells as part of glycoproteins or glycolipids (among multiple other tissues) and may be secreted in bodily fluids like saliva. Enteric bacteria containing HBGA-like substances on their surfaces have also been shown to bind human norovirus8,9,10, and such interactions may promote norovirus infection5. The basic concept of utilizing HBGA binding is that only viral particles capable of binding the putative receptor/co-factor would be capable of infecting cells. Multiple studies suggest that bead-based HBGA binding preceding nucleic acid amplification is a promising method for infectivity discrimination11,12,13,14,15,16. A major challenge regarding HBGAs is that no single HBGA type can bind all human norovirus genotypes. To address this, porcine gastric mucin, which contains HBGAs, has been used in place of purified HBGA carbohydrates in the interest of ease of synthesis, consistency, and reduced cost.
A recent publication by Moore et al.17 introduced a set of new techniques for estimating human norovirus capsid integrity. In place of HBGAs, Moore et al.17 investigated binding of a broadly reactive nucleic acid aptamer (M6-2)18 and broadly reactive monoclonal antibody (NS14)19 to heat-treated GII.4 Sydney norovirus capsids (virus-like particles or VLPs) and compared this to the binding to synthetic HBGAs. Nucleic acid aptamers are short (~20 - 80 nt) single stranded nucleic acids (ssDNA or RNA) that fold into unique three-dimensional structures as a consequence of their sequence and bind a target. Because they are nucleic acids, they are less costly; easily chemically synthesized, purified, and modified; and stable to heat. Several reports of aptamers generated against noroviruses exist, with some of them showing broad reactivity to a variety of strains18,20,21,22. By way of example, Moore et al.17 demonstrated that aptamer M6-2 bound to purified, assembled human norovirus capsids (VLPs) and behaved similarly to HBGA in the reliance on the viral capsid to maintain higher order (e.g., secondary and tertiary) protein structure for binding to occur. On the other hand, a significant proportion of norovirus VLP binding to antibody NS14 remained after capsids were completely denatured. Evaluation of norovirus binding in the study by Moore et al.17 was done using a simple, plate-based method similar to ELISA, with the exception that aptamers are used in place of antibodies (hence the method was called ELASA). This high throughput experimental method was used to evaluate the effects of different treatments on the norovirus capsid, work that is valuable for understanding the mechanism of viral inactivation upon exposure to physical or chemical stressors. However, one drawback to this method is the lower sensitivity and lack of tolerance for matrix-associated contaminants at higher levels that cause non-specific binding by aptamers.
Moore et al.17 used another method, dynamic light scattering (DLS), to monitor aggregation of viral particles in response to heat treatment. DLS is commonly used to evaluate the size of nanoparticle suspensions and has been extended to proteins23,24 and viruses25,26,27. The intensity of light scattered by particles in solution fluctuates as a function of particle size, allowing for the calculation of diffusion coefficient and then particle diameter using well-established formulae. The DLS technique can distinguish the hydrodynamic diameter of dispersed particles down to the nanoscale, which allows detection of dispersed viruses, individual capsid proteins or dimers, and virus aggregates based on size27. Virus aggregation, represented by an increase in particle size, is indicative of loss of capsid integrity. As the capsid is denatured and its structure disrupted, hydrophobic residues become exposed and cause the particles to stick together and form aggregates. DLS can be used to measure particle size after a specified treatment or the kinetics of aggregation in real time17,28. This method has the advantage of allowing observation of capsid behavior in solution but requires high concentrations of purified capsid, which may not be entirely representative of the virus in its natural state.
The final method utilized by Moore et al.17 was transmission electron microscopy (TEM). Although this method lacks sensitivity and does not produce quantitative data, it allows for visualization of the effects of different treatments on the viral capsid structure. Although not yet ideal for clinical/environmental settings, the use of these methods in combination is valuable in understanding human norovirus inactivation. The purpose of this article is to provide in-depth protocols for the plate-based binding assay (ELASA), DLS, and TEM preparation methods used to investigate the effects of heat treatments on the norovirus capsid in the context of the treatments&#39; effects on capsid integrity as presented in Moore et al.17.

<table>
	<tbody>
		<tr>
			<td>Plate-Based Binding Assay for Evaluating Loss of Higher Order Norovirus Capsid Structure</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>96-well, medium-binding polystyrene EIA plate</td>
			<td>Fisher (Costar)</td>
			<td>07-200-36</td>
			<td></td>
		</tr>
		<tr>
			<td>Lid for 96-well plate</td>
			<td>Thermo Fisher</td>
			<td>3098</td>
			<td></td>
		</tr>
		<tr>
			<td>Paraffin film (Parafilm)</td>
			<td>Thermo Fisher</td>
			<td>PM999</td>
			<td></td>
		</tr>
		<tr>
			<td>1x PBS (pH 7.2)</td>
			<td>Life Technologies</td>
			<td>20012-050</td>
			<td></td>
		</tr>
		<tr>
			<td>Polysorbate 20</td>
			<td>Sigma-Aldrich</td>
			<td>P9416</td>
			<td></td>
		</tr>
		<tr>
			<td>1x PBS (pH 7.2) + 0.05% Polysorbate 20</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Purified, assembled human norovirus GII.4 capsids</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Individual 0.2 ml PCR tubes</td>
			<td>Genesee Scientific</td>
			<td>22-154G</td>
			<td></td>
		</tr>
		<tr>
			<td>2 thermocyclers</td>
			<td>Bio-Rad</td>
			<td>1861096</td>
			<td></td>
		</tr>
		<tr>
			<td>Tabletop mini centrifuge</td>
			<td>Fisher Scientific</td>
			<td>12-006-901</td>
			<td></td>
		</tr>
		<tr>
			<td>Skim milk solids</td>
			<td>Thermo Fisher</td>
			<td>LP0031B</td>
			<td></td>
		</tr>
		<tr>
			<td>Synthetic histo-blood group type A disaccharide, biotinylated</td>
			<td>Glycotech</td>
			<td>01-017</td>
			<td></td>
		</tr>
		<tr>
			<td>Biotinylated aptamer M6-2 (stock concentration 100 &#181;M in nuclease-free water): 5&#39;-/5Biosg/AGTATACGTATTACCTGCAGCTGGGAAGAGGTCCGGTAAATGCAGGGTCAGCCCGGAGAGCGATATCTCGGAGATCTTGC -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Streptavidin-horseradish peroxidase conjugate (ELISA grade), We use Life Technologies SNN2004</td>
			<td>Life Technologies</td>
			<td>SNN2004</td>
			<td></td>
		</tr>
		<tr>
			<td>3,3&#8217;,5,5&#8217;-tetramethylbenzidine (TMB) substrate, room temperature</td>
			<td>Thermo Fisher</td>
			<td>50-76-00</td>
			<td></td>
		</tr>
		<tr>
			<td>1 M phosphoric acid</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Microplate reader capable of reading 450 nm</td>
			<td>Tecan</td>
			<td>Infinite m200 Pro</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Analysis of Plate-Based Assay Results</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Microsoft Excel or similar program</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Dynamic Light Scattering Experiments</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Zetasizer ZSP, or similar particle size analysis instrument</td>
			<td>Malvern Instruments</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Vortex</td>
			<td>Fisher Scientifc</td>
			<td>02-215-365</td>
			<td></td>
		</tr>
		<tr>
			<td>Quartz cuvette</td>
			<td>Hellma</td>
			<td>104-002-10-40</td>
			<td></td>
		</tr>
		<tr>
			<td>Small volume disposable cuvette (to reduce VLP use)</td>
			<td>Malvern Instruments</td>
			<td>ZEN0040</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Transmission Electron Microscopy Sample Preparation</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Nickel electron microscopy grids with carbon support film</td>
			<td>Ladd Research</td>
			<td>10880-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Self-closing reverse electron microscopy tweezers</td>
			<td>Ted Pella</td>
			<td>5372-NM</td>
			<td></td>
		</tr>
		<tr>
			<td>Qualitative filter paper</td>
			<td>Sigma-Aldrich (Whatman)</td>
			<td>WHA1002055</td>
			<td></td>
		</tr>
		<tr>
			<td>Glass petri dishes</td>
			<td>Sigma-Aldrich</td>
			<td>BR455743</td>
			<td></td>
		</tr>
		<tr>
			<td>100 mM stock HEPES solution (pH 7.2)</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>2% uranyl acetate</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
	</tbody>
</table>

alternative in vitro methods for the determination of viral capsid structural integrity

Human norovirus exacts considerable public health and economic losses worldwide. Emerging in vitro cultivation advances are not yet applicable for routine detection of the virus. The current detection and quantification techniques, which rely primarily on nucleic acid amplification, do not discriminate infectious from non-infectious viral particles. The purpose of this article is to present specific details on recent advances in techniques used together in order to acquire further information on the infectivity status of viral particles. One technique involves assessing binding of a norovirus ssDNA aptamer to capsids. Aptamers have the advantage of being easily synthesized and modified, and are inexpensive and stable. Another technique, dynamic light scattering (DLS), has the advantage of observing capsid behavior in solution. Electron microscopy allows for visualization of the structural integrity of the viral capsids. Although promising, there are some drawbacks to each technique, such as non-specific aptamer binding to positively-charged molecules from sample matrices, requirement of purified capsid for DLS, and poor sensitivity for electron microscopy. Nonetheless, when these techniques are used in combination, the body of data produced provides more comprehensive information on norovirus capsid integrity that can be used to infer infectivity, information which is essential for accurate evaluation of inactivation methods or interpretation of virus detection. This article provides protocols for using these methods to discriminate infectious human norovirus particles.

The structural integrity of human norovirus GII.4 Sydney capsids (VLPs) was assessed using several novel methods as presented by Moore et al.17. First, an experiment was done in which the integrity of the capsids as a function of their ability to bind a putative receptor/co-factor (HBGA) or ssDNA aptamer (M6-2) were compared (Figure 1). The results displayed have been previously presented by Moore et al.<sup class="xr...

Watch this Scientific Journal Video about Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity at JoVE.com

Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity

Routine detection methods utilizing viral genome amplification are limited by their inability to discriminate infectious from non-infectious particles. The purpose of this article is to provide detailed protocols for alternative methods to aid in discrimination of infectious norovirus particles using aptamer binding, dynamic light scattering, and transmission electron microscopy.

Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity

Human norovirus exacts considerable public health and economic losses worldwide. Emerging in vitro cultivation advances are not yet applicable for routine ...

The overall goal of these methods is to gain further insight into the effects of a treatment on the infectivity or integrity of the human norovirus capsid. This method can help answer key questions in the field of non-enveloped viral inactivation. Such as what is happening to the viral capsid's ability to infect a cell after a given treatment.The main advantage of these methods is that they can provide additional mechanistic insight into the action of any given treatment on the virus. Though this method can provide the insight into human norovirus inactivation strategies, it also has potential to be applied to other non-enveloped viruses such as rhinovirus or hepatitis A.To begin, dilute purified human norovirus major capsid protein, assembled in capsids to 50 micrograms per milliliter in 1X phosphate buffered saline. Use a maximum volume of 15 microliters in the individual capped PCR tubes.Ensure that the tube contains at least 600 nanograms of capsid and that there is 600 nanograms of capsid per treatment ligand combination. Next, preheat the thermocycler to the desired heat treatment. Then, preheat an additional thermocycler to four degrees celsius for immediate cooling.Add the tubes with capsid solution to the thermocycler for the desired time. After heating, immediately transfer the tubes to the precooled four degrees celsius cycler for five minutes. Briefly spin down the tubes in the centrifuge to get all the droplets to the bottom of the tube.Dilute the treated capsid solutions and PBS to three micrograms per milliliter. Ensure that there is at least 200 microliters of diluted treated capsid. Next, apply 100 microliters of capsid solution to each well ensure that there are at least two wells per treatment.Additionally, include two control wells with 100 microliters of PBS for each ligand. This provides the background absorbance of the assay. Cover the plate with a lid and seal the edges with paraffin film to reduce evaporation.Leave the plate overnight on a shaking incubator at four degrees celsius or for two hours at room temperature. Following incubation, remove the treated capsid solutions from the plate. Then, add 200 microliters per well of blocking buffer.Incubate for two hours at room temperature or sealed at four degrees celsius overnight. Meanwhile, dilute the biotinylated aptamer to one micromolar in nuclease-free water. Ensure that there is enough solution for 200 microliters total for each treatment.Also, dilute the chosen biotinylated HPGA to 30 microliters per milliliter in the blocking buffer. Again, ensure that there is enough solution for 200 microliters total volume for each treatment. Following incubation, remove the blocking buffer and wash the plate three times with 200 microliters per well of PBST.Pat the plate upside down on sterile paper towels to dry the residual moisture. Next, at 100 microliters per well of the ligand binding solutions ensuring that there are two wells per heat treatment ligand combination, incubate the covered plate on an orbital shaker at about 60 RPM for one hour at room temperature. After washing the wells as described in the text protocol add 100 microliters per well of 0.2 micrograms per milliliter of streptavidin horseradish peroxidase and PBS.Incubate for 15 minutes at room temperature with gentle shaking on an orbital shaker before washing the wells again. Then, after another wash, add 100 microliters per well of TMB substrate and allow the color to develop for five to 15 minutes. Observe the wells for color.Be sure to consistently develop for the same time between replicate plates and be aware of the absorbance range of the plate reader used. Stop the development of the reaction with 100 microliters per well of one molar phosphoric acid. Immediately read the plate at 450 nanometers.Create a new size standard operating procedure in the DLS instrument software as detailed in the text protocol. Then, select the green run arrow within the software and name the sample. Dilute the heat-treated virus-like particles or VLPs one to 10 in 1X PBS for final concentration of five micrograms per milliliter.Then, filter the sample with a one micron pore size to remove dust particles. DLS is very sensitive to dust, as large particles scattered much more light than small particles. Transfer 50 microliters of the diluted VLPs into a small volume disposable cuvette.Insert the cuvette into the sample chamber of the instrument. Start the run and use the correlogram cumulant fit and expert advice tabs to evaluate the data quality. During the run, check that the poly disperse of the index value is less than 0.3 representing a quality measurement.In the multiview tab, make sure the correlation coefficient is constant and close to but not more than one at a short time and drops off sharply at zero at a later time, characteristic of particle size. Use the expert advice tab for feedback on the data quality during the measurements. After the measurement is complete, check again at the poly disperse of the index value is less than 0.3.Make sure that the cumulant fit line follows the data points closely in the cumulants fit tab. Create a new size standard operating procedure in the DLS instrument software as detailed in the text protocol. Select the run arrow within the software to open and name a new sample and allow the instrument to reach the temperature equilibrium.Transfer the VLP suspension to a small volume quartz cuvette avoid bubbles and pipette slowly against the wall of the cuvette. After the instrument has reached temperature equilibrium, insert the cuvette into the sample chamber. After waiting 10 seconds for the sample temperature to equilibrate, start the run and simultaneously start a timer.Stop the timer at the end of the first measurement. Take this time as the first time point. Obtain subsequent time points from the measurement times recorded by the software.Perform heat treatment as before except substitute PBS for 10 millimolar heaps, pH 7.4 and do not further dilute capsids after treatment. Next, pipette the entire 15 microliter drop of treated capsid solution onto paraffin film. Grab the grid edge with tweezers allowing them to close on the edge to hold the grid and place grid carbon side down on top of the drop of treated solution.Let the grid incubated for 10 minutes to allow the capsid to attach to the grid. Depending on the purity of the capsid preparation, add washes of the heap solution in the form of 10 to 15 microliter droplets placed in line after the treated capsid droplet. After 10 minutes, pick up the grid with the droplet.Place the grid nearly perpendicular to a piece of filter paper to wick away the droplet. Then, use the grid to pick up the droplet of 10 to 15 microliter heaps buffer and hold it for 30 seconds. After 30 seconds of wash time wick away with another piece of filter paper.Next, place a 15 microliter droplet of two percent uranyl acetate solution on the paraffin film in an empty area. Pick up the droplet of uranyl acetate with the grid and hold it for 45 seconds. Then, wick away the uranyl acetate being sure to remove most of the solution.Place the grid carbon side up on a piece of filter paper being careful that the grid does not stick to the moisture on the tweezers. Then, place the filter paper with the grid on it in an open glass petri dish. After repeating this process for all treatments, place the petri dish halves with the grids in a desiccator overnight to dry prior to observing with TEM.The following graph displays reduction of the binding ability of human norovirus capsids over time when treated at 68 degrees celsius. As can be seen, HPGA binding is the first signal to completely disappear. At this point, it is assumed that the large majority of capsids in the solution have lost the ability to bind host cell HPGAs and thus cannot be internalized into the cell.Aptamer binding mirrors that of HBGA, though slightly more heat treatment is required to remove the signal. Shown here is a DLS correlation coefficient curve representative of good quality data. At time close to zero, the correlogram is constant at a value close to, but below one.It then drops off sharply to zero at a time characteristic of the particle size. Size results from this experiment can likely be trusted. Conversely, this correlation coefficient curve is representative of poor quality data.The correlogram starts at a value above one and gradually drops off to zero. Results from this experiment should not be used. Here, particle size data shows a clear aggregation profile for capsids treated at 68 degrees celsius with super aggregates forming after about 20 minutes.The time at which the super aggregation occurs is characteristic of the susceptibility of the VLPs to that treatment. This figure visualizes the TEM results for heat treatment of human norovirus capsids. Here, the capsids were being treated at 60 to 80 degrees celsius from left to right.As can be seen, capsid morphology clearly changes with treatment as capsids aggregate and denature. A similar phenomenon is noted for capsids treated at 68 degrees celsius for zero to 25 minutes. Once mastered, these techniques can be done in one to 24 hours if they are performed properly.After its development, this technique provided an additional avenue for researchers in the field of food virology to explore the mechanisms and effects of inactivation on the capsid of human noroviruses. Following this procedure, other methods like a real-time RT-PCR with and without RNase pretreatment, STS page of viral capsids, and plaque assays with cultivable surrogate viruses can be performed to get a more complete overall view of viral reduction after a given treatment. After watching this video, you should have a good understanding of how to utilize ligand binding, dynamic light scattering, and transmission electron microscopy to gain further mechanistic insights into the effects of inactivation treatment on the human norovirus capsid.Don't forget that working with some of the reagents used can be hazardous and precautions such as wearing personal protective equipment and following laboratory safety best practices should always be taken while performing this procedure.

alternative-vitro-methods-for-determination-viral-capsid-structural

Research

JoVE Journal

Immunology and Infection

8.0K visualizações.  North Carolina State University. The overall goal of these methods is to gain further insight into the effects of a treatment on the infectivity or integrity of the human norovirus capsid. This method can help answer key questions in the field of non-enveloped viral inactivation. Such as what is happening to the viral capsid's ability to infect a cell after a given treatment.The main advantage of these methods is that they can provide additional mechanistic insight into the action of any given treatment on the virus. ...