Yazarlar Universiti Putra Malezya destek kabul etmek istiyorum.

Not: kullanılan tüm kimyasal ve biyokimyasal reaktifleri analitik nitelikte olmalıdır ve daha fazla arıtma kullanılır. Tüm çözümler steril deiyonize su kullanarak hazırlayın. Otoklav sterilizasyon öncesinde tüm cam.
Dikkat: Lütfen denetimleri (duman hood, torpidoda) mühendislik kullanımı da dahil olmak üzere laboratuvar faaliyetleri gerçekleştirirken tüm uygun güvenlik yöntemleri kullanın ve kişisel koruyucu donanımları (koruyucu gözlük, eldiven, önlük, tam uzunlukta pantolon, Kapalı-ayak parmağı Ayakkabı).
1. imalat ve karakterizasyonu, değişikliğin PLA-AuNPs kullanarak elektrot
<ol><li>
Hazırlanması ve karakterizasyonu PLA-AuNPs
	<ol>
<li>Hızlı bir şekilde 10 mL sodyum nitrat çözeltisi (38.8 mM) kaynar sulu chloroauric asit solüsyonu (1 mM) 100 mL için eklemek ve aşağı ortam sıcaklığına kadar sakin ol. Renk olan sarı, siyahımsı değişiklikler olarak başlar ve sonunda biter koyu yakut kırmızı hazırlanan AuNPs çözümünde değişiklikleri gözlemlemek.</li>
		<li>PLA granül eritme işleminin bir paslanmaz çelik kalıp yerleştirin ve onları acil yordamını izleyin 10 dakika süreyle 190 ° C sıcaklıkta onceden: PLA sayfası hazırlık kapsamında 1 dk. için 2,2 MPa basınç altında koymak onları. PLA sayfası 3 h için soğutma sonra kullanıma hazır olacak.</li>
		<li>Şiddetle karıştırma, kloroform, oda sıcaklığında 5 ml PLA sayfaların 0,68 mg geçiyoruz. Çözünmüş PLA 10 mL önceden hazırlanmış AuNPs çözeltisi ile karıştırın ve homojen oda sıcaklığında karıştırın. Homojen karışımlar ve UV-Vis, XRD, TEM ve FESEM ile EDX ile karakterize sonra PLA-AuNPs gösterilir olabilir.</li>
	</ol>
</li>
	<li>
Hazırlık ve değiştirilmiş Serigrafi karbon elektrot karakterizasyonu Not: Bu çalışmada kullanılan SPCE üç elektrot sistemi oluşur: bir sayaç elektrot, karbon çalışma elektrot ve bir Ag/AgCl referans elektrot.<ol>
<li>Hızlı bir şekilde pipet 25 µL PLA-AuNPs SPCE ve daha sonra hava üzerine homojen çözüm kuru 24 kullanılmadan önce s.</li>
		<li>Mamüllerinin değiştirilmiş elektrotlar karakterize içinde potasyum ferro siyanür, SPCE/PLA-AuNPs (K3[Fe(CN)6]3 -/4 -) aktif yüzey alanı, elektrokimyasal empedans spektroskopisi, tekrarlanabilirlik, ölçmek için tekrarlanabilirlik ve istikrar30.</li>
	</ol>
</li>
</ol>2. elektrokimyasal DNA biyoalgılayıcı gelişimi
<ol><li>
Sonda hazırlık Not: SsDNA sonda ve tamamlayıcı DNA dizileri dayalı bilgi biyoteknoloji bilgi (NCBI) veritabanı için Milli Merkezi olarak seçilmiştir.<ol>
<li>Sentetik oligonucleotides (20-mer ssDNA sonda, 20-mer tamamlayıcı DNA, 20-mer eşleşmeyen DNA ve 21-mer tamamlayıcı DNA) liyofilize toz ticari laboratuvarları, aşağıdaki dizileri dayalı olarak satın alın: thiolated ssDNA sonda: 5 ' - / 5ThioMC6-D/CGGATTATGCAGAAGCACTG - 3 ' tamamlayıcı DNA: 5 ' - CAGTGCTTCTGCATAATCCG - 3 ' bir Bankası eşleşmeyen DNA: 5 ' - CAGTGCTTCTGC ṪTAATCCG - 3 ' Üç-base eşleşmeyen DNA: 5 ' - CAGTGCTTCT Ċ ṪṪTAATCCG - 3 ' tamamlayıcı DNA: 5 ' - CGCACAAGGCTCGACGGCTGA - 3 '</li>
		<li>Tüm oligonucleotides (100 µM) hisse senedi çözümler analitik bölümlerini içine bölünmüş bir steril TE çözüm (10 mM Tris-HCl, 1 mM EDTA, pH 7.5) kullanarak hazırlayın. Bu-4 ° C'de tutmak ve uygun dilutions kullanmak için sadece önceden yapın.</li>
	</ol>
</li>
	<li>
İmmobilizasyon ve hibridizasyon duruma getirilmesi Not: Bu çalışma için kullanılan PLA-AuNPs SPCE/PLA-AuNPs gösterilir, modifiye bir SPCE ve bir damla döküm yöntemi DNA immobilizasyon ve hibridizasyon için kullanıldı.<ol>
<li>İlk olarak, thiolated ssDNA sonda SPCE/PLA-AuNPs üzerinde 25 µL hareketsiz ve sonra hava kuru bu oda sıcaklığında 24 h için sonra bu sonunda SPCE/PLA-AuNPs/ssDNA gösterilir. Üç faktör kullanarak optimizasyon immobilizasyon durumun belirleyin: ssDNA (0.2 1.4 µM arasında), saat (210 dakika 30 arasında) ve sıcaklık (75 ° C-25 arasında değişen) konsantrasyon.</li>
		<li>SPCE/PLA-AuNPs/ssDNA-sonra o nihayet SPCE/PLA-AuNPs/dsDNA gösterilir hibridizasyon olay gerçekleştirmek için yüzey için tamamlayıcı DNA'ın 25 µL pipet. En iyi duruma getirme (5 ila 30 dakika arasında) zaman ve sıcaklık (75 ° C-25 arasında değişen) iki faktör üzerinden hibridizasyon durumu belirlemek.</li>
		<li>İmmobilize bırakın ve 20 µM MB 30 dakika süreyle melezleşmiştir elektrotlar 0,5 M ABS ile yıkayarak olmayan özellikle adsorbe DNA ve aşırı MB kaldırmak/deiyonize su ile durulama ve 20 mM NaCl (pH 4.5). MB azaltma DPV tekniği kullanarak en yüksek akım ölçüsü. 0.1 M PBS (pH 7) kullanarak DPV ölçüm yürütmek hiçbir gösterge içeren.</li>
	</ol>
</li>
	<li>
Fabrikasyon DNA biyoalgılayıcı karakterizasyonu
	<ol>
<li>SPCE/PLA-AuNPs 20 µM MB 30 dk içinde bırakın, yıkama 0.5 M ABS/20 mM NaCl (pH 4.5) ve o zaman ölçme önce deiyonize su ile durulayın. Sonda DNA, tamamlayıcı DNA, eşleşmeyen DNA ve tamamlayıcı DNA örnekleri de dahil olmak üzere tüm etkileşimler için benzer bir yordamı izleyin.</li>
		<li>Elektrokimyasal azaltma ölçmek. Not: Ticari olarak imal edilmiş bir Autolab arabirimi yazılım programıyla DPV şiddetindeydi. 0,005 V, Modülasyon genlik 0,05 V ve 7.73 mVs-1 0.1 M PBS (pH 7), tarama hızı, potansiyel bir adımla V, 0,25 -0,5 V değişen bir potansiyel gerçekleştirilen MB elektrokimyasal azaltma DPV ölçümleri hiçbir gösterge içeren. Seçicilik, hassasiyet, tekrarlanabilirlik ve ısı dayanımı fabrikasyon DNA biyoalgılayıcı, daha da incelenmiştir. Bildirilen sonuçlar olarak ortalama değer ölçüleri içinde üç çoğaltır sunuldu.</li>
	</ol>
</li>
</ol>3. gerçek örnekleri kullanarak fabrikasyon DNA biyoalgılayıcı doğrulama
<ol><li>Bakteri suşları hazırlanması
	<ol>
<li>Deniz ürünleri31,32 onların önemli kirlilik dayalı bakteriyel örnekleri seçin. Not: V. parahaemolyticus olarak başvuru suşları ve 8 diğer bakteri suşları (Campylobacter jejuni, Listeria Monositogenez, Salmonella typhimurium, Salmonella enterit, Klebsiella pnömoni, Escherichia coli O157: H7, Bacillus cereusve Vibrio alginolyticus) ortak gıda kaynaklı patojen istihdam elektrokimyasal DNA biyoalgılayıcı doğrulama Bu çalışma için.</li>
		<li>Rutin bir alt kültür onların anılan sıraya göre agar bakteri suşlarının iki haftada canlılığı korumak, Tablo 1 kültür koşulları için başvurmak için kuralları.</li>
		<li>Onları dondurma işlemi sırasında zarar verebilir buz kristalleri oluşumunu engelleyerek bakteri gliserol korur gibi %20 (v/v) gliserol-80 ° C'de içeren onların anılan sıraya göre artan et suları içinde bakteri suşlarının uzun vadeli koruma korumak. Ardından, gliserol stokları korunmuş bakteriyel hücre kültüründe bir döngü ilgili broths aşılamak. Et suları ilgili büyüme zaman ve sıcaklık göre bakteri canlandırmak gerek zaman kuluçkaya.</li>
		<li>Dilutions bir dizi elde edilen mikroorganizmalar numaralandırmak için bir forma plaka tekniği33, bir standart ve iyi bilinen bir yöntemi kullanarak parahaemolyticus V. hücre sayısını belirle.<ol>
<li>Kültür parahaemolyticus V. Trypticase soya suyu (TSB + % 3 NaCl) 140-rpm sallayarak koşuldaki 37 ° C'de. O zaman, bakteri hücre kültürü 1 mL TSB + % 3 9 mL transferi NaCl 10-1 seyreltme faktörü elde etmek için.</li>
		</ol>
</li>
		<li>Bu dokuz kez en çok 10-10 seyreltme faktörü tam bir dizi elde etmek için tekrarlayın. Ardından, her seyreltme faktörü (10-10için 10-1 ' den başlayarak) 0.1 mL bir Vibrio'nın seçici agar plaka sayma, sırasıyla koloni için yayıldı. Plakayı 24 h 37 ° C'de inkübe kuluçkaya.</li>
		<li>Bir koloni sayaç bireysel kolonileri saymak ve sonra geri-(sayısı x seyreltme faktörü CFU/pipetted tutar) mililitre yoğunluğu (CFU mL-1) koloni oluşturan birim almak için hesaplamak için kullanın. Bakteri hücre süspansiyonlar CFU mL-1 absorbans karşı kalibrasyon komplo birimleri (CFUs) oluşturan colony konsantrasyonu türetmek.</li>
	</ol></li>
	<li>PCR tahlil hazırlanması
	<ol>
<li>Genomik DNA değiştirilmiş bir takip lizis yordamı34haşlanmış ayıklayın. Bireysel bir bakteriyel agar medyada süzün ve suyu medya, kendi göreli büyüme durumunu 140 bir koşul sallayarak rpm kuluçka tarafından takip aşılamak ilk, çizgi.</li>
		<li>Et suyu 1 mL kültürünün bir mikro santrifüj tüpüne pipette. Bu 4830 x g ve granül elde etmek için 1 dakika için 4 ° C, santrifüj kapasitesi. Steril TE arabelleği yaklaşık 500 µL re-süspansiyon ile Pelet için kullanın. Elde edilen süspansiyon için 10 dak hold 98 ± 2 ° C Isıtma blok ve hemen hücreleri parçalayıcı ve DNA'yı serbest bırakmak 10 min için-18 ° C'de chill.</li>
		<li>Genomik DNA 4830 x g ve açık bir süspansiyon elde etmek ve daha fazla kullanmak için-20 ° C'de süpernatant tutmak için 3 dakika için 4 ° C, santrifüj kapasitesi. Biophotometer ölçüm 260 bir dalga boyu, UV emme ile kullanmak nm (nükleik asitler dalgaboyu ışık emici) olarak ve aynı zamanda bir dalga boyu 280 nm (ışığın dalga boyu emici proteinler) olarak konsantrasyon ve ayıklanan saflığı belirlemek için genomik DNA ve standart biyokimyasal deneyleri35 kullanarak ve onları 16S rRNA gen sıralama36tarafından doğrulama tüm suşların tanımlamak. Son olarak, 92 ° c için 2 dk genomik DNA tabiatını ve hızla buz su biyoalgılayıcı için uygulamadan önce sakin ol.</li>
		<li>Daha fazla varlığı parahaemolyticus onaylamak toxR gen hedeflemek için PCR kullanarak. Bir thermocycler bir astar çift (5'-GTCTTCTGACGCAATCGTTG-3' ve 5'-ATACGAGTGGTTGCTGTCATG-3') kullanarak bu yordamı gerçekleştirin. PCR güçlendirme 25 µL steril su (15,5 µL), arabellek (5 µL), astar (1 µL, 10 µM), dNTP mix (1 µL), DNA şablonu (2 µL) ve Taq DNA polimeraz (0.2 µL, 10 x) oluşan toplam reaksiyon hacmi içinde en iyi duruma getirme.</li>
		<li>Bileşenleri karıştırın ve amplifikasyon 30 döngüleri için programlanmış bir thermocycler hedef sırada PCR amplifikasyon düzenlemek. Bizim çalışmada, her döngüsü üç adım reaksiyonlar i.eoluşuyordu., ilk denatürasyon (94 ° C, 3 dk) denatürasyon (94 ° C, 1 dk.), tavlama (63 ° C, 1,5 dk) ve son uzantısı (72 ° C, 7 dk) tarafından takip uzantısı (72 ° C, 1,5 dk), 30 döngüleri izledi.</li>
		<li>Güçlendirilmiş ürünler ve % 1.5 özel jel elektroforez ile boyutlarını belirleyin. Ticari olarak üretilen jel dokümantasyon sistemi ile jel çekim.</li>
	</ol></li>
	<li>Cockle örnekleri hazırlanması
	<ol>
<li>Taze örneklerini almak. Not: Bizim taze istiridye (Anadara granosa) Serdang, İstanbul, ıslak pazarda elde edilen ve hızlı bir şekilde bir buz soğutucusu kutusunda analiz için laboratuvara getirdi. Örnekleri 2 Grup, yani tedavi ve tedavi edilmezse grup daraltan düzgün soğuk hava deposu yerleştirerek kadar hasat başından itibaren hasat edildi varsayarak bölün.</li>
		<li>Tarak tedavi grubunda 24 h, 4 h önce DNA ekstraksiyon için 20 ° C'de UV ışığa maruz kalma ardından için-20 ° C'de depolayarak önceden tedavi. Not: Donma sıcaklığı ve kontrollü için kullanılan UV Işınlarına maruz kalma grup öldürür ya da en azından daraltan içinde doğal olarak biriken parahaemolyticus V. sınırlar. Taze daraltan gerçek durumunu taklit etmek için bu çalışmada kontrollü durumda amacı olduğu gibi 70 ° C daha yüksek bir pastörizasyon rejim geçerli değildir. Bu arada, laboratuvarda geldikleri gibi öncesi herhangi bir tedavi tedavi edilmezse grubundan doğrudan örnekleri analiz.</li>
		<li>Alt kültür parahaemolyticus V. ATCC 17802 TSB içinde bir tür (% 3 NaCl). Tekerlekli sandalye basketbolu uygun dilutions kaplama ile inoculum içinde hücrelerin düzeyini belirlemek (% 3 NaCl) 104 CFU mL-1 V. parahaemolyticus, bir inoculum elde etmek için CA'da. Her cockle distile suda yıkayın ve steril forseps laminar akış kabine dokular kabuğu'kaldırmak için kullanmadan önce kir ücretsiz fırçalayın.</li>
		<li>Bir homogenizer 90 ml steril TSB ile yaklaşık 10 g cockle doku örnekleri homojenize (% 3 NaCl) için 60 s. Ekle parahaemolyticus V. bilinen bir miktar homojenize örnek suyu için çivili örnekleri 9 ml. Unspiked örnekleri bir negatif kontrol kullanır. Cockle örnekleri için CA'da örneklerinin 0.1 mL kaplama tarafından çivili parahaemolyticus V. hücre sayısı tahmin etmek ve daha sonra emme biyoalgılayıcı ve PCR tahlil kullanılmak üzere, örnek 1 mL örnek microcentrifuge tüp içine DNA örneği almak için pipetting.</li>
		<li>Parahaemolyticus genomik DNA değiştirilmiş bir takip çivili ve unspiked örnekleri lizis yordamı36haşlanmış ayıklayın. Son olarak, DNA konsantrasyon ve UV emilimini 260 ile bir dalga boyu, biyo fotometre ölçüm kullanarak saflık belirlemek nm (nükleik asitler dalgaboyu ışık emici) olarak ve aynı zamanda bir dalga boyu 280 nm (olarak ışığın dalga boyu emici proteinler).</li>
	</ol></li>
</ol>

Yazarlar ifşa gerek yok.

Bir dönüştürücü (nükleik asit veya DNA burada) için uygun biyolojik tanıma öğeler seçimi, elektrokimyasal biyoalgılayıcı bu tip başarılı geliştirme için bir çerçeve içinde önemli adımlardır dönüştürücü algılama tabakası oluşturmak için kimyasal bir yaklaşım; iletim malzeme; DNA immobilizasyon ve hibridizasyon duruma getirilmesi; ve gerçek numuneleri kullanılarak geliştirilen biyoalgılayıcı doğrulama.
Hassas ve seçici elektrokimyasal DNA biyoalgıla...

Son yıllarda genel ve bilimsel tartışmaların önemli bir konu, gıda zehirlenmesi 3 aracıları ile ilişkili: mikroorganizmaların1, kimyasal madde2ve parazitler3. Kontamine gıda ciddi sağlık sonuçları insanlar, özellikle zayıf bağışıklık sistemi, yaşlı, hamile kadınlar, bebekler ve küçük çocuklar4olanların daha yüksek risk grubundaki neden olabilir. İle daha--dan bir milyon yılda Afrika, Asya ve Latin Amerika 5 yaşın altındaki çocuklarda meydana gelen akut ishal durumlarında, gıda zehirlenmesi büyük küresel hastalık5,6 ve Dünya Sağlık Örgütü kurdu mikroorganizmaların en önemli katkıda bulunan7olarak. Vibrio parahaemolyticus en çok tanınan öldürücü suşları arasında öne çıkmaktadır. Genellikle, nehir ağzı, kıyı ve deniz ortamlarının8' bulundu, hangi yüksek tuz ortamlarda aktif hale gelir ve yetersiz mishandled pişmiş veya çiğ deniz yenen ciddi bir insan gastroenterit tipine neden bir Ayagin Gram-negatif bakteri olduğunu ürünleri9. Ayrıca, mevcut tıbbi durumlar bazı kişilerde yara enfeksiyonu, septisemi veya kulak enfeksiyonu V. parahaemolyticus10' dan doğan eğilimli onları. Parahaemolyticus V. hemolysins virülans faktörleri hastalık patogenezinde katkıda iki türlere ayrılmıştır: tdh genler tarafından kodlanmış opsonins doğrudan hemolysin (TDH) ve trh genler11tarafından kodlanmış TDH ile ilgili hemolysin. V. parahaemolyticus virülans işaretleri (tdh ile trh gen) çoğunlukla Klinik numune yerine çevre örnekler bulunur.
Parahaemolyticus koşullar, geniş bir dizi altında hayatta yeteneği hızla yanıt çevresel değişiklikler12' ye sahip olur. Onun toksisite hücre kitle13ile paralel olarak arttıkça onun yayılmasını önleme mekanizması tehlike potansiyeli dozu artarken. Daha da kötüsü, iklim değişikliği onların hücre nüfus büyüme14hızlandırmak için yeterli koşulları ile bu bakterilerin sağlamaktadır. Yüksek frekansı nedeniyle, bilhassa ticaret ve bu ürünler büyük miktarlarda15,16 ' nerede bulunurlar olduğundan deniz ürünleri imalatı gıda tedarik zinciri boyunca izlenmesi V. parahaemolyticus ihtiyacı Dünya çapında. Şu anda bakteri tespit ve izole bir dizi biyokimyasal testleri, zenginleştirme ve seçmeli medya17, immunomagnetic jelleştirici enzim bağlı gibi yöntemleri kullanarak assay (ELISA)18, darbe alan jel elektroforez (PFGE) 19, lateks aglutinasyon test ve polimeraz zincir reaksiyonu (PCR) testleri20. Bu yöntemler genellikle kalifiye personel, sofistike aletleri ve kirlenme hakkında bilgileri hemen vermeyin zahmetli teknikler gerektirir. Bu ciddi bir şekilde derhal zararlı kirlenmesine ve bünyesinde uygulamalar algılama olasılığını kısıtlar. Hızlı algılama araçları olağanüstü bir meydan kalır.
Bir zaman tasarrufu, düşük maliyetli, pratik ve gerçek zamanlı analiz yöntemi21,22,23,24 sunduğundan Biosensing gıda kaynaklı patojenler tespiti için umut verici bir seçenek olarak ortaya çıkıyor . Ancak, birçok olumlu sonuçlar analit algılama çivili örnekleri ve standart çözüm biyosensörler kullanarak rağmen hala var. sulu karışımları veya organik özler25gerçek örnekler için uygulanan araştırma eksikliği Son zamanlarda, elektrokimyasal biyosensörler doğrudan ve/veya dolaylı Deoksiribonükleik asit (DNA) algılama kullanarak tamamlayıcı hedef hibridizasyon olay26 üzerinden onların özel algılama nedeniyle bilim adamları arasında artan ilgi almış , 27 , 28 , 29. bu benzersiz yaklaşımları ile karşılaştırıldığında böylece küçültme ve ticari kullanım için gelecek vaat eden bir teknoloji sunan biyosensörler, enzim tabanlı daha stabildir. İşte parahaemolyticus V. yüksek seçicilik, duyarlılık ve pratiklik, hibridizasyon sırasında DNA dizisi özgüllük dayalı algılayabilir hızlı bir araç oluşturmak için hedef çalışma bildirdi. Kimlik stratejileri polylactic asit-sağlamlık altın nano tanecikleri (PLA-AuNPs)30 ve serigrafi karbon elektrotlar (SPCEs) ile birlikte hibridizasyon göstergesi varlığında, metilen mavisi (MB) içerir. Gelişmiş algılama yapı potansiyelini daha fazla bakteri DNA lysate ve taze cockle örnekleri kullanarak keşfedilmeden.

<table><tbody><tr><td>Acetic acid</td><td>Merck</td><td>100056</td><td></td></tr><tr><td>Chloroform</td><td>Merck</td><td>102445</td><td></td></tr><tr><td>Diaminoethane tetraacetic acid</td><td>Promega</td><td>E5134</td><td></td></tr><tr><td>Dibasic sodium phosphate&amp;nbsp;</td><td>Sigma-Aldrich</td><td>S9763</td><td></td></tr><tr><td>Disodium hydrogen phosphate</td><td>Sigma-Aldrich</td><td>255793</td><td></td></tr><tr><td>Ethanol&amp;nbsp;</td><td>Sigma-Aldrich</td><td>16368</td><td></td></tr><tr><td>Gold (III) chloride trihydrate</td><td>Sigma-Aldrich</td><td>520918</td><td></td></tr><tr><td>Hydrochloric acid</td><td>Merck</td><td>100317</td><td></td></tr><tr><td>Methylene blue</td><td>Sigma-Aldrich</td><td>M44907</td><td></td></tr><tr><td>Monobasic sodium phosphate, monohydrate</td><td>Sigma-Aldrich</td><td>S3522</td><td></td></tr><tr><td>Phosphate-buffered saline</td><td>Sigma-Aldrich</td><td>P5119</td><td></td></tr><tr><td>Poly(lactic acid) resin, commercial grade 4042D</td><td>NatureWorks</td><td>4042D</td><td></td></tr><tr><td>Potassium chloride</td><td>R&amp;amp;M Chemicals</td><td>59435</td><td></td></tr><tr><td>Potassium dihydrogen phosphate</td><td>Sigma-Aldrich</td><td>P9791</td><td></td></tr><tr><td>Potassium hexacyanoferrate III</td><td>R&amp;amp;M Chemicals</td><td>208019</td><td></td></tr><tr><td>Sodium acetate anhydrous salt</td><td>Sigma-Aldrich</td><td>S2889</td><td></td></tr><tr><td>Sodium chloride</td><td>Sigma-Aldrich</td><td>S9888</td><td></td></tr><tr><td>Trisodium citrate</td><td>Sigma-Aldrich</td><td>S1804</td><td></td></tr><tr><td>Tris(hydroxymethyl) aminomethane</td><td>Fisher Scientific</td><td>T395-100</td><td></td></tr><tr><td>Tris-Base</td><td>Fisher Scientific</td><td>BP152-500</td><td></td></tr><tr><td>2X PCR Master Mix with Dual-Dye</td><td>Norgen Biotek</td><td>28240</td><td></td></tr><tr><td>Agarose gel</td><td>Merck</td><td>101236</td><td></td></tr><tr><td>Bolton Agar</td><td>Merck</td><td>100079</td><td></td></tr><tr><td>Bolton Broth</td><td>Merck</td><td>100079</td><td></td></tr><tr><td>CHROMagar Vibrio</td><td>CHROMagar</td><td>VB910</td><td></td></tr><tr><td>dNTPs</td><td>Promega</td><td>U1511</td><td></td></tr><tr><td>Nuclease-free water</td><td>Thermo Scientific</td><td>R0581</td><td></td></tr><tr><td>Eosin methylene blue agar&amp;nbsp;</td><td>Merck</td><td>101347</td><td></td></tr><tr><td>GelRed</td><td>Biotium</td><td>41001</td><td></td></tr><tr><td>Glycerol</td><td>Merck</td><td>104092</td><td></td></tr><tr><td>Go Taq Buffer</td><td>Promega</td><td>M7911</td><td></td></tr><tr><td>Loading dye 100 bp DNA ladder</td><td>Promega</td><td>G2101</td><td></td></tr><tr><td>Loading dye 1kb DNA ladder</td><td>Promega</td><td>G5711</td><td></td></tr><tr><td>Magnesium chloride</td><td>Promega</td><td>91176</td><td></td></tr><tr><td>Mannitol egg yolk polymyxin agar</td><td>Merck</td><td>105267</td><td></td></tr><tr><td>McConkey Agar</td><td>Merck</td><td>105465</td><td></td></tr><tr><td>Nutrient Broth</td><td>Merck</td><td>105443</td><td></td></tr><tr><td>Taq polymerase</td><td>Merck</td><td>71003</td><td></td></tr><tr><td>Trypticase Soy Broth</td><td>Merck</td><td>105459</td><td></td></tr><tr><td>Trypticase Soy Agar</td><td>Merck</td><td>105458</td><td></td></tr></tbody></table>

development of an electrochemical dna biosensor to detect a foodborne pathogen

Vibrio parahaemolyticus (V. parahaemolyticus) insan mortalite ve morbidite oranı önemli ölçüde etkileyen küresel olarak, halk sağlığı sorunları büyük bir oranda katkıda ortak bir gıda kaynaklı patojen var. Parahaemolyticus tespiti kültür tabanlı yöntemleri, immünolojik deneyleri ve moleküler tabanlı yöntemleri gibi geleneksel yöntemlerle karmaşık örnek işlem gerektirir ve zaman alıcı, sıkıcı ve pahalı. Son zamanlarda, biyosensörler umut verici ve kapsamlı algılama yöntemi ile hızlı algılama, maliyet-etkililik ve pratiklik avantajları olduğu kanıtlanmıştır. Bu araştırma parahaemolyticus V. yüksek seçicilik ve DNA hibridizasyon kullanılmasının duyarlılık ile algılama hızlı bir yöntem geliştirmeye odaklanmaktadır. Çalışma, sentezlenmiş polylactic asit-sağlamlık altın nano tanecikleri (PLA-AuNPs) karakterizasyonu kullanarak x-ışını kırınım (XRD), ultraviyole görünür spektroskopisi (UV-VIS), transmisyon elektron mikroskobu (TEM), alan emisyon elde edildi Elektron mikroskobu (FESEM) ve çevrimsel Voltammetry (CV) tarama. Biz de daha fazla istikrar, hassasiyet ve tekrarlanabilirlik PLA-AuNPs in test dışarı taşıdı. PLA AuNPs sulu çözüm ses yapısını stabilize nano tanecikleri kurdu bulduk. Biz de duyarlılık daha küçük bir ücret transferi direnç (Rct) değer ve aktif yüzey alanı (0,41 cm2) artış sonucunda geliştirilmiş gözlenen. Bizim DNA biyoalgılayıcı gelişimi PLA-AuNPs ve redoks göstergesi olarak metilen mavisi (MB) kullanarak bir Serigrafi karbon elektrot (SPCE) değişiklik dayanıyordu. İmmobilizasyon ve hibridizasyon olayları fark nabız voltammetry (DPV) tarafından değerlendirildi. Tamamlayıcı, tamamlayıcı bulduk ve uyumsuz oligonucleotides özellikle tarafından uydurma biyoalgılayıcı ayırt edildi. Ayrıca çeşitli gıda kaynaklı patojenlere karşı olan çalışmalar ve parahaemolyticus V. kimlik taze istiridye içinde güvenilir bir şekilde duyarlı algılama gösterdi.

AuNPs oluşumu ile sodyum sitrat mevcut sulu çözüm renk değişikliği ile ortaya çıktı. Bu rengi açık sarı bir derin yakut kırmızı değiştirmek için neden oldu. PLA-AuNPs nesil yüzey plasmon rezonans (SPR) en yüksek büyüme bulunduğu yaklaşık 540 UV-vis spectra (Şekil 1) üzerinden teyit edildi nm. Oluşumu ve PLA-AuNPs varlığını parçacık boyutu37bağlı olarak 500-600 nm dalga boyu aralıkları belirtilen. ...

Watch this Scientific Journal Video about Development of an Electrochemical DNA Biosensor to Detect a Foodborne Pathogen at JoVE.com

Development of an Electrochemical DNA Biosensor to Detect a Foodborne Pathogen

Gıda kaynaklı patojen tespit etmek için bir elektrokimyasal DNA biyoalgılayıcı gelişimi

Vibrio parahaemolyticus algılamak için polylactic asit-sağlamlık, altın nano tanecikleri değiştirilme tarihi, Serigrafi karbon elektrot oluşan bir elektrokimyasal DNA biyoalgılayıcı geliştirilmesi için bir protokol sunulmuştur.

Vibrio parahaemolyticus (V. parahaemolyticus) is a common foodborne pathogen that contributes to a large proportion of public health problems globally, ...

development-an-electrochemical-dna-biosensor-to-detect-foodborne

Research

JoVE Journal

Bioengineering

13.0K Görüntüleme.  Universiti Putra Malaysia. Vibrio parahaemolyticus algılamak için polylactic asit-sağlamlık, altın nano tanecikleri değiştirilme tarihi, Serigrafi karbon elektrot oluşan bir elektrokimyasal DNA biyoalgılayıcı geliştirilmesi için bir protokol sunulmuştur.

Video: Development of an Electrochemical DNA Biosensor to Detect a Foodborne Pathogen

Fabrication of Electrochemical-DNA Biosensors for the Reagentless Detection of Nucleic Acids, Proteins and Small Molecules

As medicine is currently practiced, doctors send specimens to a central laboratory for testing and thus must wait hours or days to 
receive the results. Many patients would be better served by rapid, bedside tests. To this end our laboratory and others have developed a versatile, reagentless 
biosensor platform that supports the quantitative, reagentless, electrochemical detection of nucleic acids (DNA, RNA), proteins (including antibodies) and small 
molecules analytes directly in unprocessed clinical and environmental samples. In this video, we demonstrate the preparation and use of several biosensors in this 
"E-DNA" class. In particular, we fabricate and demonstrate sensors for the detection of a target DNA sequence in a polymerase chain reaction mixture, an HIV-specific antibody and the drug cocaine. The preparation procedure requires only three hours of hands-on effort followed by an overnight incubation, and their use requires only minutes.

"E-DNA" sensors, reagentless, electrochemical biosensors that perform well even when challenged directly in blood and other complex matrices, have been adapted to the detection of a wide range of nucleic acid, protein and small molecule analytes. Here we present a general procedure for the fabrication and use of such sensors.

Nükleik Asitler, Proteinler ve Küçük Moleküller Reagentless Algılama Elektrokimyasal DNA Biyosensörler Fabrikasyon

As medicine is currently practiced, doctors send specimens to a central laboratory for testing and thus must wait hours or days to 
receive the results. ...

Biyomühendislik

Bacterial Detection &amp; Identification Using Electrochemical Sensors

Electrochemical sensors are widely used for rapid and accurate measurement of blood glucose and can be adapted for detection of a wide variety of analytes. Electrochemical sensors operate by transducing a biological recognition event into a useful electrical signal. Signal transduction occurs by coupling the activity of a redox enzyme to an amperometric electrode. Sensor specificity is either an inherent characteristic of the enzyme, glucose oxidase in the case of a glucose sensor, or a product of linkage between the enzyme and an antibody or probe.
Here, we describe an electrochemical sensor assay method to directly detect and identify bacteria. In every case, the probes described here are DNA oligonucleotides. This method is based on sandwich hybridization of capture and detector probes with target ribosomal RNA (rRNA). The capture probe is anchored to the sensor surface, while the detector probe is linked to horseradish peroxidase (HRP). When a substrate such as 3,3',5,5'-tetramethylbenzidine (TMB) is added to an electrode with capture-target-detector complexes bound to its surface, the substrate is oxidized by HRP and reduced by the working electrode. This redox cycle results in shuttling of electrons by the substrate from the electrode to HRP, producing current flow in the electrode.

Bacterial Detection & Identification Using Electrochemical Sensors

We describe an electrochemical sensor assay method for rapid bacterial detection and identification. The assay involves a sensor array functionalized with DNA oligonucleotide capture probes for ribosomal RNA (rRNA) species-specific sequences. Sandwich hybridization of target rRNA with the capture probe and a horseradish peroxidase-linked DNA oligonucleotide detector probe produces a measurable amperometric current.

Elektrokimyasal Sensörler kullanarak Bakteriyel Algılama ve Tanıma

Electrochemical  sensors are widely used for rapid and accurate measurement of blood glucose and  can be adapted for detection of a wide variety of ...

Detection of Bacteria Using Fluorogenic DNAzymes

Outbreaks linked to food-borne and hospital-acquired pathogens account for millions of deaths and hospitalizations as well as colossal economic losses each and every year. Prevention of such outbreaks and minimization of the impact of an ongoing epidemic place an ever-increasing demand for analytical methods that can accurately identify culprit pathogens at the earliest stage. Although there is a large array of effective methods for pathogen detection, none of them can satisfy all the following five premier requirements embodied for an ideal detection method: high specificity (detecting only the bacterium of interest), high sensitivity (capable of detecting as low as a single live bacterial cell), short time-to-results (minutes to hours), great operational simplicity (no need for lengthy sampling procedures and the use of specialized equipment), and cost effectiveness. For example, classical microbiological methods are highly specific but require a long time (days to weeks) to acquire a definitive result.1 PCR- and antibody-based techniques offer shorter waiting times (hours to days), but they require the use of expensive reagents and/or sophisticated equipment.2-4 Consequently, there is still a great demand for scientific research towards developing innovative bacterial detection methods that offer improved characteristics in one or more of the aforementioned requirements. Our laboratory is interested in examining the potential of DNAzymes as a novel class of molecular probes for biosensing applications including bacterial detection.5
DNAzymes (also known as deoxyribozymes or DNA enzymes) are man-made single-stranded DNA molecules with the capability of catalyzing chemical reactions.6-8 These molecules can be isolated from a vast random-sequence DNA pool (which contains as many as 1016 individual sequences) by a process known as "in vitro selection" or "SELEX" (systematic evolution of ligands by exponential enrichment).9-16 These special DNA molecules have been widely examined in recent years as molecular tools for biosensing applications.6-8
Our laboratory has established in vitro selection procedures for isolating RNA-cleaving fluorescent DNAzymes (RFDs; Fig. 1) and investigated the use of RFDs as analytical tools.17-29 RFDs catalyze the cleavage of a DNA-RNA chimeric substrate at a single ribonucleotide junction (R) that is flanked by a fluorophore (F) and a quencher (Q). The close proximity of F and Q renders the uncleaved substrate minimal fluorescence. However, the cleavage event leads to the separation of F and Q, which is accompanied by significant increase of fluorescence intensity.
More recently, we developed a method of isolating RFDs for bacterial detection.5 These special RFDs were isolated to "light up" in the presence of the crude extracellular mixture (CEM) left behind by a specific type of bacteria in their environment or in the media they are cultured (Fig. 1). The use of crude mixture circumvents the tedious process of purifying and identifying a suitable target from the microbe of interest for biosensor development (which could take months or years to complete). The use of extracellular targets means the assaying procedure is simple because there is no need for steps to obtain intracellular targets.
Using the above approach, we derived an RFD that cleaves its substrate (FS1; Fig. 2A) only in the presence of the CEM produced by E. coli (CEM-EC).5 This E. coli-sensing RFD, named RFD-EC1 (Fig. 2A), was found to be strictly responsive to CEM-EC but nonresponsive to CEMs from a host of other bacteria (Fig. 3).
Here we present the key experimental procedures for setting up E. coli detection assays using RFD-EC1 and representative results.

We have recently reported a novel approach for generating fluorogenic DNAzyme probes that can be applied to set up a simple, "mix-and-read" fluorescent assay for bacterial detection. These special DNA probes catalyze the cleavage of a chromophore-modified DNA-RNA chimeric substrate in the presence of crude extracellular mixture (CEM) produced by a specific bacterium, thereby translating bacterial detection into fluorescence signal generation. In this report we will describe key experimental procedures where a specific DNAzyme probe denoted "RFD-EC1" is employed for the detection of the model bacterium, Escherichia coli (E. coli).

Flourogenik DNAzymes kullanarak Bakterilerin Tespiti

Outbreaks linked to food-borne and hospital-acquired pathogens account for millions of deaths and hospitalizations as well as colossal economic losses ...

İmmünoloji ve Enfeksiyon

Optical Detection of E. coli Bacteria by Mesoporous Silicon Biosensors

A label-free optical biosensor based on a nanostructured porous Si is designed for rapid capture and detection of Escherichia coli K12 bacteria, as a model microorganism. The biosensor relies on direct binding of the target bacteria cells onto its surface, while no pretreatment (e.g.&#160;by cell lysis) of the studied sample is required. A mesoporous Si thin film is used as the optical transducer element of the biosensor. Under white light illumination, the porous layer displays well-resolved Fabry-P&#233;rot fringe patterns in its reflectivity spectrum. Applying a fast Fourier transform (FFT) to reflectivity data results in a single peak. Changes in the intensity of the FFT peak are monitored. Thus, target bacteria capture onto the biosensor surface, through antibody-antigen interactions, induces measurable changes in the intensity of the FFT peaks, allowing for a &#39;real time&#39; observation of bacteria attachment.
The mesoporous Si film, fabricated by an electrochemical anodization process, is conjugated with monoclonal antibodies, specific to the target bacteria. The immobilization, immunoactivity and specificity of the antibodies are confirmed by fluorescent labeling experiments. Once the biosensor is exposed to the target bacteria, the cells are directly captured onto the antibody-modified porous Si surface. These specific capturing events result in intensity changes in the thin-film optical interference spectrum of the biosensor. We demonstrate that these biosensors can detect relatively low bacteria concentrations (detection limit of 104 cells/ml) in less than an hour.

Optical Detection of E. coli Bacteria by Mesoporous Silicon Biosensors

A label-free optical biosensor for rapid bacteria detection is introduced. The biosensor is based on a nanostructured porous Si, which is designed to directly capture the target bacteria cells onto its surface. We use monoclonal antibodies, immobilized onto the porous transducer, as the capture probes. Our studies demonstrate the applicability of these biosensors for the detection of low bacterial concentrations within minutes with no prior sample processing (such as cell lysis).

Optik Algılama<em&gt; E. coli</emMezopor Silikon Biyosensörlerin tarafından&gt; Bakteri

A label-free optical biosensor based on a nanostructured porous Si is designed for rapid capture and detection of Escherichia coli K12 bacteria, as a ...

A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis

Miniaturization of analytical benchtop procedures into the micro-scale provides significant advantages in regards to reaction time, cost, and integration of pre-processing steps. Utilizing these devices towards the analysis of DNA hybridization events is important because it offers a technology for real time assessment of biomarkers at the point-of-care for various diseases. However, when the device footprint decreases the dominance of various physical phenomena increases. These phenomena influence the fabrication precision and operation reliability of the device. Therefore, there is a great need to accurately fabricate and operate these devices in a reproducible manner in order to improve the overall performance. Here, we describe the protocols and the methods used for the fabrication and the operation of a microfluidic-based electrochemical biochip for accurate analysis of DNA hybridization events. The biochip is composed of two parts: a microfluidic chip with three parallel micro-channels made of polydimethylsiloxane (PDMS), and a 3 x 3 arrayed electrochemical micro-chip. The DNA hybridization events are detected using electrochemical impedance spectroscopy (EIS) analysis. The EIS analysis enables monitoring variations of the properties of the electrochemical system that are dominant at these length scales. With the ability to monitor changes of both charge transfer and diffusional resistance with the biosensor, we demonstrate the selectivity to complementary ssDNA targets, a calculated detection limit of 3.8 nM, and a 13% cross-reactivity with other non-complementary ssDNA following 20 min&#160;of incubation. This methodology can improve the performance of miniaturized devices by elucidating on the behavior of diffusion at the micro-scale regime and by enabling the study of DNA hybridization events.

We present a microfluidic-based electrochemical biochip for DNA hybridization detection. Following ssDNA probe functionalization, the specificity, sensitivity, and detection limit are studied with complementary and non-complementary ssDNA targets. Results illustrate the influence of the DNA hybridization events on the electrochemical system, with a detection limit of 3.8 nM.

Etiket-serbest DNA Hibridizasyon Analiz için mikroakışkan tabanlı Elektrokimyasal Biochip

Miniaturization of analytical benchtop procedures into the micro-scale provides significant advantages in regards to reaction time, cost, and integration ...

ELIME (Enzyme Linked Immuno Magnetic Electrochemical) Method for Mycotoxin Detection

Immunoassays are a valid alternative to the more expensive and time consuming quantitative HPLC or GC1, 2 methods for the screening detection of hazardous mycotoxins in food commodities. In this protocol we show how to fabricate and interrogate an electrochemical competitive Enzyme linked immunomagnetic assay based on the use of magnetic beads as solid support for the immunochemical chain3 and screen printed electrodes as sensing platform.
Our method aims to determine the total amount of HT-2 and T-2 toxins, mycotoxins belonging to the trichothecenes family and of great concern for human health4. The use of an antibody clone with a cross reactivity of 100% towards HT-2 and T-2 allows to simultaneously detect both toxins with similar sensitivity5.
The first step of our assay is the coating step where we immobilize HT2-KLH conjugate toxin on the surface of magnetic beads. After a blocking step, necessary to avoid non-specific absorptions, the addition of a monoclonal antibody allows the competition between immobilized HT-2 and free HT-2 or T-2 present in the sample or dissolved in a standard solution.
At the end of the competition step, the amount of monoclonal antibody linked to the immobilized HT-2 will be inversely proportional to the amount of toxin in the sample solution.
A secondary antibody labeled with alkaline phosphatase (AP) is used to reveal the binding between the specific antibody and the immobilized HT-2. The final measurement step is performed by dropping an aliquot of magnetic bead suspension, corresponding to a specific sample/standard solution, on the surface of a screen-printed working electrode; magnetic beads are immobilized and concentrated by means of a magnet placed precisely under the screen-printed electrode. After two minutes of incubation between magnetic beads and a substrate for AP, the enzymatic product is detected by Differential Pulse Voltammetry (DPV) using a portable instrument (PalmSens) also able to initiate automatically eight measurements within an interval of few seconds.

ELIME Enzyme Linked Immuno Magnetic Electrochemical Method for Mycotoxin Detection

A protocol to detect trichothecenes (mycotoxins of concern for human health) using a newly developed screening method based on a competitive immunochemical method and a final electrochemical detection is demonstrated.

Mikotoksin Algılama ELIME (Enzim İmmüno Manyetik Elektrokimyasal Bağlantılı) Yöntem

Immunoassays are a valid alternative to the more expensive and time consuming quantitative HPLC or GC1, 2 methods for the screening detection of hazardous ...

Biyoloji

Foodborne Pathogen Screening Using Magneto-fluorescent Nanosensor: Rapid Detection of E. Coli O157:H7

Enterohemorrhagic Escherichia coli O157:H7 has been linked to both waterborne and foodborne illnesses, and remains a threat despite the food- and water-screening methods used currently. While conventional bacterial detection methods, such as polymerase chain reaction (PCR) and enzyme-linked immunosorbent assays (ELISA) can specifically detect pathogenic contaminants, they require extensive sample preparation and lengthy waiting periods. In addition, these practices demand sophisticated laboratory instruments and settings, and must be executed by trained professionals. Herein, a protocol is proposed for a simpler diagnostic technique that features the unique combination of magnetic and fluorescent parameters in a nanoparticle-based platform. The proposed multiparametric magneto-fluorescent nanosensors (MFnS) can detect E. coli O157:H7 contamination with as little as 1 colony-forming unit present in solution within less than 1 h. Furthermore, the ability of MFnS to remain highly functional in complex media such as milk and lake water has been verified. Additional specificity assays were also used to demonstrate the ability of MFnS to only detect the specific target bacteria, even in the presence of similar bacterial species. The pairing of magnetic and fluorescent modalities allows for the detection and quantification of pathogen contamination in a wide range of concentrations, exhibiting its high performance in both early- and late-stage contamination detection. The effectiveness, affordability, and portability of the MFnS make them an ideal candidate for point-of-care screening for bacterial contaminants in a wide range of settings, from aquatic reservoirs to commercially packaged foods.

Foodborne Pathogen Screening Using Magneto-fluorescent Nanosensor: Rapid Detection of E. Coli O157:H7

The overall goal of this protocol is to synthesize functional nanosensors for the portable, cost-effective, and rapid detection of specifically targeted pathogenic bacteria through a combination of magnetic relaxation and fluorescence emission modalities.

Gıda kaynaklı patojen tarama kullanarak Manyeto-floresan Nanosensor: E. Coli O157: H7 hızlı tespiti

Enterohemorrhagic Escherichia coli O157:H7 has been linked to both waterborne and foodborne illnesses, and remains a threat despite the food- and ...

Electrowetting-based Digital Microfluidics Platform for Automated Enzyme-linked Immunosorbent Assay

Electrowetting is the effect by which the contact angle of a droplet exposed to a surface charge is modified. Electrowetting-on-dielectric (EWOD) exploits the dielectric properties of thin insulator films to enhance the charge density and hence boost the electrowetting effect. The presence of charges results in an electrically induced spreading of the droplet which permits purposeful manipulation across a hydrophobic surface. Here, we demonstrate EWOD-based protocol for sample processing and detection of four categories of antigens, using an automated surface actuation platform, via two variations of an Enzyme-Linked Immunosorbent Assay (ELISA) methods. The ELISA is performed on magnetic beads with immobilized primary antibodies which can be selected to target a specific antigen. An antibody conjugated to HRP binds to the antigen and is mixed with H2O2/Luminol for quantification of the captured pathogens. Assay completion times of between 6 and 10 min were achieved, whilst minuscule volumes of reagents were utilized.

Electrowetting-based digital microfluidic is a technique that utilizes a voltage-driven change in the apparent contact angle of a microliter-volume droplet to facilitate its manipulation. Combining this with functionalized magnetic beads enables the integration of multiple laboratory unit operations for sample preparation and identification of pathogens using Enzyme-linked Immunosorbent Assay (ELISA).

Otomatik Enzimbağlantılı İmmünosorbent Assay için Elektrowetting tabanlı Dijital Mikroakışkanplatformu

Electrowetting is the effect by which the contact angle of a droplet exposed to a surface charge is modified. Electrowetting-on-dielectric (EWOD) exploits ...

Colorimetric Detection of Bacteria Using Litmus Test

There are increasing demands for simple but still effective methods that can be used to detect specific pathogens for point-of-care or field applications. Such methods need to be user-friendly and produce reliable results that can be easily interpreted by both specialists and non-professionals. The litmus test for pH is simple, quick, and effective as it reports the pH of a test sample via a simple color change. We have developed an approach to take advantage of the litmus test for bacterial detection. The method exploits a bacterium-specific RNA-cleaving DNAzyme to achieve two functions: recognizing a bacterium of interest and providing a mechanism to control the activity of urease. Through the use of magnetic beads immobilized with a DNAzyme-urease conjugate, the presence of bacteria in a test sample is relayed to the release of urease from beads to solution. The released urease is transferred to a test solution to hydrolyze urea into ammonia, resulting in an increase of pH that can be visualized using the classic litmus test.

We describe a protocol for colorimetric detection of E. coli using a modified litmus test that takes advantage of an RNA-cleaving DNAzyme, urease, and magnetic beads.

Turnusol Testi kullanarak Bakterilerin Kolorimetrik Tespiti

There are increasing demands for simple but still effective methods that can be used to detect specific pathogens for point-of-care or field applications. ...

Electrochemical Biosensing

Electrochemical biosensors detect the binding of a target molecule by sensing an oxidation-reduction event. These sensors paved the way for modern biosensing after the invention of the glucose biosensor. This video will introduce electrochemical biosensing, show the workings of the glucose biosensor, and discuss how electrochemical biosensors are used in cancer detection.

Glucose Biosensor: an Electrochemical Biosensor

Electrochemical biosensors detect the binding of a target molecule by sensing an oxidation-reduction event.  These sensors paved the way for modern ...