이 연구는 중국 국립 자연 과학 재단 (82160550)의 지원을 받았습니다.

TMEM200A: 위암에서 EMT 및 PI3K/AKT를 조절하는 새로운 종양유전자

<ol>
	<li>Torre, L. A., Siegel, R. L., Ward, E. M., Jemal, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+cancer+incidence+and+mortality+rates+and+trends--an+update.">Global cancer incidence and mortality rates and trends--an update.</a> Cancer Epidemiol Biomarkers Prev. 25 (1), 16-27 (2016).</li><li>Long, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Economic+burden+of+malignant+tumors+-+Yichang+City,+Hubei+Province,+China,+2019.">Economic burden of malignant tumors - Yichang City, Hubei Province, China, 2019.</a> China CDC Wkly. 4 (15), 312-316 (2022).</li><li>Harbeck, N., Gnant, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Breast+cancer.">Breast cancer.</a> Lancet. 389 (10074), 1134-1150 (2017).</li><li>Bagchi, S., Yuan, R., Engleman, E. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+checkpoint+inhibitors+for+the+treatment+of+cancer:+clinical+impact+and+mechanisms+of+response+and+resistance.">Immune checkpoint inhibitors for the treatment of cancer: clinical impact and mechanisms of response and resistance.</a> Annu Rev Pathol. 16, 223-249 (2021).</li><li>Lam, G. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pitfalls+in+cutaneous+melanoma+diagnosis+and+the+need+for+new+reliable+markers.">Pitfalls in cutaneous melanoma diagnosis and the need for new reliable markers.</a> Mol Diagn Ther. 27 (1), 49-60 (2023).</li><li>Gromiha, M. M., Ou, Y. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bioinformatics+approaches+for+functional+annotation+of+membrane+proteins.">Bioinformatics approaches for functional annotation of membrane proteins.</a> Brief Bioinform. 15 (2), 155-168 (2014).</li><li>Schmit, K., Michiels, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TMEM+proteins+in+cancer:+a+review.">TMEM proteins in cancer: a review.</a> Front Pharmacol. 9, 1345 (2018).</li><li>Marx, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transmembrane+(TMEM)+protein+family+members:+Poorly+characterized+even+if+essential+for+the+metastatic+process.">Transmembrane (TMEM) protein family members: Poorly characterized even if essential for the metastatic process.</a> Semin Cancer Biol. 60, 96-106 (2020).</li><li>Fu, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overexpression+of+transmembrane+protein+168+in+the+mouse+nucleus+accumbens+induces+anxiety+and+sensorimotor+gating+deficit.">Overexpression of transmembrane protein 168 in the mouse nucleus accumbens induces anxiety and sensorimotor gating deficit.</a> PLoS One. 12 (12), e0189006 (2017).</li><li>Cuajungco, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Abnormal+accumulation+of+human+transmembrane+(TMEM)-176A+and+176B+proteins+is+associated+with+cancer+pathology.">Abnormal accumulation of human transmembrane (TMEM)-176A and 176B proteins is associated with cancer pathology.</a> Acta Histochem. 114 (7), 705-712 (2012).</li><li>Zhang, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TMEM116+is+required+for+lung+cancer+cell+motility+and+metastasis+through+PDK1+signaling+pathway.">TMEM116 is required for lung cancer cell motility and metastasis through PDK1 signaling pathway.</a> Cell Death Dis. 12 (12), 1086 (2021).</li><li>Zhang, N., Pan, H., Liang, X., Xie, J., Han, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+roles+of+transmembrane+family+proteins+in+the+regulation+of+store-operated+Ca(2+)+entry.">The roles of transmembrane family proteins in the regulation of store-operated Ca(2+) entry.</a> Cell Mol Life Sci. 79 (2), 118 (2022).</li><li>Zhang, X., Zheng, P., Li, Z., Gao, S., Liu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+somatic+mutation+landscape+and+RNA+prognostic+markers+in+stomach+adenocarcinoma.">The somatic mutation landscape and RNA prognostic markers in stomach adenocarcinoma.</a> Onco Targets Ther. 13, 7735-7746 (2020).</li><li>Jia, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mining+TCGA+database+for+genes+of+prognostic+value+in+glioblastoma+microenvironment.">Mining TCGA database for genes of prognostic value in glioblastoma microenvironment.</a> Aging (Albany NY). 10 (4), 592-605 (2018).</li><li>Wang, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=UCSCXenaShiny:+an+R/CRAN+package+for+interactive+analysis+of+UCSC+Xena+data.">UCSCXenaShiny: an R/CRAN package for interactive analysis of UCSC Xena data.</a> Bioinformatics. 38 (2), 527-529 (2022).</li><li>Li, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TIMER2.0+for+analysis+of+tumor-infiltrating+immune+cells.">TIMER2.0 for analysis of tumor-infiltrating immune cells.</a> Nucleic Acids Res. 48 (W1), W509-W514 (2020).</li><li>Thul, P. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+subcellular+map+of+the+human+proteome.">A subcellular map of the human proteome.</a> Science. 356 (6340), eaal3321 (2017).</li><li>Li, Y., Ge, D., Lu, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+SMART+App:+an+interactive+web+application+for+comprehensive+DNA+methylation+analysis+and+visualization.">The SMART App: an interactive web application for comprehensive DNA methylation analysis and visualization.</a> Epigenetics Chromatin. 12 (1), 71 (2019).</li><li>Chandrashekar, D. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=UALCAN:+An+update+to+the+integrated+cancer+data+analysis+platform.">UALCAN: An update to the integrated cancer data analysis platform.</a> Neoplasia. 25, 18-27 (2022).</li><li>Tate, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=COSMIC:+the+Catalogue+Of+Somatic+Mutations+In+Cancer.">COSMIC: the Catalogue Of Somatic Mutations In Cancer.</a> Nucleic Acids Res. 47 (D1), D941-D947 (2019).</li><li>Gao, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+analysis+of+complex+cancer+genomics+and+clinical+profiles+using+the+cBioPortal.">Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal.</a> Sci Signal. 6 (269), pl1 (2013).</li><li>Shen, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sangerbox:+A+comprehensive,+interaction-friendly+clinical+bioinformatics+analysis+platform.">Sangerbox: A comprehensive, interaction-friendly clinical bioinformatics analysis platform.</a> iMeta. 1 (3), e36 (2022).</li><li>Ru, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TISIDB:+an+integrated+repository+portal+for+tumor-immune+system+interactions.">TISIDB: an integrated repository portal for tumor-immune system interactions.</a> Bioinformatics. 35 (20), 4200-4202 (2019).</li><li>Yuan, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CancerSEA:+a+cancer+single-cell+state+atlas.">CancerSEA: a cancer single-cell state atlas.</a> Nucleic Acids Res. 47 (D1), D900-D908 (2019).</li><li>Sun, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TISCH:+a+comprehensive+web+resource+enabling+interactive+single-cell+transcriptome+visualization+of+tumor+microenvironment.">TISCH: a comprehensive web resource enabling interactive single-cell transcriptome visualization of tumor microenvironment.</a> Nucleic Acids Res. 49 (D1), D1420-D1430 (2021).</li><li>Warde-Farley, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+GeneMANIA+prediction+server:+biological+network+integration+for+gene+prioritization+and+predicting+gene+function.">The GeneMANIA prediction server: biological network integration for gene prioritization and predicting gene function.</a> Nucleic Acids Res. 38, W214-W220 (2010).</li><li>Zhu, Y., Feng, S., Song, Z., Wang, Z., Chen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+immunological+characteristics+and+immune+subtypes+based+on+single-sample+gene+set+enrichment+analysis+algorithm+in+lower-grade+glioma.">Identification of immunological characteristics and immune subtypes based on single-sample gene set enrichment analysis algorithm in lower-grade glioma.</a> Front Genet. 13, 894865 (2022).</li><li>Mueller Bustin, S. A., R, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+reverse+transcription+PCR+(qRT-PCR)+and+its+potential+use+in+clinical+diagnosis.">Real-time reverse transcription PCR (qRT-PCR) and its potential use in clinical diagnosis.</a> Clin Sci (Lond). 109 (4), 365-379 (2005).</li><li>Sun, L., Zhang, H., Gao, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metabolic+reprogramming+and+epigenetic+modifications+on+the+path+to+cancer.">Metabolic reprogramming and epigenetic modifications on the path to cancer.</a> Protein Cell. 13 (12), 877-919 (2022).</li><li>Ntontsi, P., Photiades, A., Zervas, E., Xanthou, G., Samitas, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetics+and+epigenetics+in+asthma.">Genetics and epigenetics in asthma.</a> Int J Mol Sci. 22 (5), 2412 (2021).</li><li>Mart&#237;nez-Reyes, I., Chandel, N. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+metabolism:+looking+forward.">Cancer metabolism: looking forward.</a> Nat Rev Cancer. 21 (10), 669-680 (2021).</li><li>Chen, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PremPS:+Predicting+the+impact+of+missense+mutations+on+protein+stability.">PremPS: Predicting the impact of missense mutations on protein stability.</a> PLoS Comput Biol. 16 (12), e1008543 (2020).</li><li>Li, M., Petukh, M., Alexov, E., Panchenko, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Predicting+the+impact+of+missense+mutations+on+protein-protein+binding+affinity.">Predicting the impact of missense mutations on protein-protein binding affinity.</a> J Chem Theory Comput. 10 (4), 1770-1780 (2014).</li><li>Hirsch, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+responses+to+PD-1+inhibition+and+their+molecular+characterization+in+six+patients+with+mismatch+repair-deficient+metastatic+cancer+of+the+digestive+system.">Clinical responses to PD-1 inhibition and their molecular characterization in six patients with mismatch repair-deficient metastatic cancer of the digestive system.</a> J Cancer Res Clin Oncol. 147 (1), 263-273 (2021).</li><li>Poulogiannis, G., Frayling, I. M., Arends, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+mismatch+repair+deficiency+in+sporadic+colorectal+cancer+and+Lynch+syndrome.">DNA mismatch repair deficiency in sporadic colorectal cancer and Lynch syndrome.</a> Histopathology. 56 (2), 167-179 (2010).</li><li>Chintamani, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+expression+of+mismatched+repair+genes+and+their+correlation+with+clinicopathological+parameters+and+response+to+neo-adjuvant+chemotherapy+in+breast+cancer.">The expression of mismatched repair genes and their correlation with clinicopathological parameters and response to neo-adjuvant chemotherapy in breast cancer.</a> Int Semin Surg Oncol. 4, 5 (2007).</li><li>Deng, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+expression+of+TMEM200A+is+associated+with+a+poor+prognosis+and+immune+infiltration+in+gastric+cancer.">High expression of TMEM200A is associated with a poor prognosis and immune infiltration in gastric cancer.</a> Pathol Oncol Res. 29, 1610893 (2023).</li><li>Stemmler, M. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cadherins+in+development+and+cancer.">Cadherins in development and cancer.</a> Mol Biosyst. 4 (8), 835-850 (2008).</li><li>Bill, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ANO1/TMEM16A+interacts+with+EGFR+and+correlates+with+sensitivity+to+EGFR-targeting+therapy+in+head+and+neck+cancer.">ANO1/TMEM16A interacts with EGFR and correlates with sensitivity to EGFR-targeting therapy in head and neck cancer.</a> Oncotarget. 6 (11), 9173-9188 (2015).</li><li>De Las Rivas, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+drug+resistance+induced+by+EMT:+novel+therapeutic+strategies.">Cancer drug resistance induced by EMT: novel therapeutic strategies.</a> Arch Toxicol. 95 (7), 2279-2297 (2021).</li><li>Tian, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SERPINH1+regulates+EMT+and+gastric+cancer+metastasis+via+the+Wnt/&#946;-catenin+signaling+pathway.">SERPINH1 regulates EMT and gastric cancer metastasis via the Wnt/&#946;-catenin signaling pathway.</a> Aging (Albany NY). 12 (4), 3574-3593 (2020).</li></ol>

저자는 이해 상충이 없다고 선언합니다.

TMEM200A 암세포가 증식하는 데 필수적인 TMEM 계열에 속합니다38. 다양한 악성 종양에서 TMEM200A 의 다양한 발현은 주목을 덜 받았고 범암 조사에 대한 철저한 조사가 부족합니다. 그러나, TMEM 막관통 단백질군이 여러 단백질과의 상호작용을 통해 암세포를 악성으로 유지하는 데 중요할 수 있다는 증거가 계속 축적되고 있는데, 예를 들어, ROCK1/moesin에 의한 TMEM16A Ca2+</...

암은 전 세계적으로 높은 이환율과 사망률로 인해 전세계적으로 인간의 건강을 위협하는 지속적인 공중 보건 문제로 부상하고 있으며1 사회에 막대한 재정적, 의료적 부담을 주고 있다2. 암 표지자(cancer marker)3의 발견 덕분에 최근 몇 년 동안 암 치료의 상당한 발전이 이루어졌으며, 연구자들은 암 치료를 위한 새로운 진단 방법과 신약을 개발했습니다. 그러나 일부 암 환자는 약물 내성, 약물 부작용, 화학적 민감성 등의 요인으로 인해 예후가 좋지 않다4. 따라서 초기 암의 스크리닝과 치료를 위한 새로운 바이오마커 식별이 시급하다5.
막 단백질은 세포와 세포소기관막에 결합하고 통합할 수 있는 단백질이다6. 이들은 막에 대한 결합 강도와 그 위치에 따라 지질 고정 단백질, 통합 단백질 및 말초 막 단백질의 세 가지 범주로 그룹화 할 수 있습니다 7,8. 막관통(TMEM) 단백질은 적어도 하나의 막관통 세그먼트(9)로 구성되는 일체형 막 단백질로서, 생체막을 완전히 또는 부분적으로 통과한다.
TMEM 계열에 속하는 단백질의 작용 기전은 잘 알려져 있지 않지만, 이러한 단백질은 여러 유형의 암에 관여하는 것으로 알려져 있다10. 몇몇 TMEM 단백질은 이동성, 증식성 및 침습성 표현형과 연관되어 있으며, 이들의 발현은 종종 환자의 예후와 관련이 있다11. 따라서 TMEM 가족 구성원이 연구 대상이 되었습니다. TMEM에 대한 기존 보고를 종합적으로 검토한 결과, TMEM은 대부분 세포간 및 세포내 신호전달12, 면역 관련 질환 및 종양형성10과 관련이 있는 것으로 나타났다. 많은 TMEM은 또한 중요한 생리학적 기능, 예를 들어 원형질막의 이온 채널, 신호 전달 경로의 활성화, 세포 화학주성의 중재, 접착, 세포자멸사 및 자가포식10을 가지고 있습니다. 따라서 TMEM 단백질이 종양의 발견 및 치료에 중요한 예후 표지자가 될 수 있다는 가설을 세웠습니다.
TMEM200A 발현은 위암(GC)에서 현저히 증가합니다. 6q23.1 염색체에 8개의 엑손이 있고 전체 길이가 77.536kb인 TMEM200A13의 더 높은 발현은 GC의 경우 전체 생존(OS)에 대한 나쁜 예후와 관련이 있습니다. 그러나 종양학 연구에서 발현의 변화는 거의 보고되지 않았습니다. 이 기사에서는 공개적으로 사용 가능한 다양한 데이터 세트를 사용하여 다양한 암 연구에서 치료 표적 및 종양 진단 마커로서의 TMEM200A 의 유용성을 비교하고 분석합니다. 우리는 UCSC Xena 및 TCGA 데이터베이스의 RNA-seq 데이터와 실시간 정량적 중합효소 연쇄 반응(qRT-PCR) 및 웨스턴 블로팅을 사용하여 다양한 인간 암 유형에서 발현 수준뿐만 아니라 범암 진단 및 예후 바이오마커로서의 TMEM200A 의 효과를 평가했습니다. 
TMEM200A 발현 수준이 돌연변이 비율, 조절 과정, 종양 진단 및 예후, 면역 침윤 및 면역 요법에 미치는 영향은 계산 도구와 데이터 세트 웹 사이트를 혼합하여 추가로 조사되었습니다. CBioPortal 및 COSMIC(Catalog of Somatic Mutations in Cancer Cells) 데이터베이스를 사용하여 TMEM200A의 돌연변이를 조사했습니다. Sangerbox와 TISIDB 웹사이트는 TMEM200A 면역 침윤에 어떤 영향을 미치는지 이해하기 위해 활용되었습니다. 종양 면역 단일 세포 센터(TISCH) 온라인 도구와 CancerSEA 데이터베이스를 사용하여 TMEM200A의 기능을 조사했습니다. 마지막으로, GC 세포의 악성 거동 및 종양 발달 기능에 대한 TMEM200A의 영향을 평가하기 위해 in vitro assay에서 기능 상실 실험을 수행했습니다. 또한 녹다운이 GC의 PI3K/AKT 신호 경로와 상피-중간엽 전이(EMT)에 어떤 영향을 미치는지 평가하기 위해 웨스턴 블로팅TMEM200A 수행했습니다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Anti-AKT antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>60203-2-Ig</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-E-cadherin antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>20874-1-AP</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>10494-1-AP</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-N-cadherin antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>22018-1-AP</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-P-AKT antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>66444-1-Ig</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-snail antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>13099-1-AP</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-Vimentin antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>10366-1-AP</td>
			<td></td>
		</tr>
		<tr>
			<td>AxyPrepMultisourceTotalRNAMini- 
			prep Kit</td>
			<td>Suzhou Youyi Landi Biotechnology Co., Ltd</td>
			<td>UEL-UE-MN-MS-RNA-50G</td>
			<td></td>
		</tr>
		<tr>
			<td>BCA Protein Assay Kit</td>
			<td>Epizyme Biotech</td>
			<td>ZJ101L</td>
			<td></td>
		</tr>
		<tr>
			<td>CCK-8 reagent</td>
			<td>MedChemExpress</td>
			<td>HY-K0301-500T</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal bovine serum (FBS)</td>
			<td>CYAGEN BIOSCIENCES (GUANGZHOU) INC</td>
			<td>FBSSR-01021</td>
			<td></td>
		</tr>
		<tr>
			<td>GAPDH primer</td>
			<td>Sangon Biotech (Shanghai) Co., Ltd.</td>
			<td></td>
			<td>Forward primer (5&#8217;-3&#8217;): TGACATCAAGAAGGTG 
			GTGAAGCAG; Reverse primer (5&#8217;-3&#8217;): GTGTCGCTGTTGAAG 
			TCAGAGGAG</td>
		</tr>
		<tr>
			<td>HighGene plus Transfection reagent</td>
			<td>ABclonal</td>
			<td>RM09014P</td>
			<td></td>
		</tr>
		<tr>
			<td>HRP-conjugated Affinipure Goat Anti-Mouse lgG (H+L)</td>
			<td>Proteintech Group, Inc</td>
			<td>SA00001-1</td>
			<td></td>
		</tr>
		<tr>
			<td>HRP-conjugated Affinipure Goat Anti-Rabbit lgG (H+L)</td>
			<td>Proteintech Group, Inc</td>
			<td>SA00001-2</td>
			<td></td>
		</tr>
		<tr>
			<td>Human gastric mucosal epithelial GES-1 cells</td>
			<td>Guangzhou Cellcook Biotech Co.,Ltd.</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Human STAD HGC-27 cells</td>
			<td>Procell Life Science&#38;Technology Co.,Ltd</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Human STAD SGC-7901 cells</td>
			<td>Procell Life Science&#38;Technology Co.,Ltd</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>MonAmp SYBR Green qPCR Mix (None ROX)</td>
			<td>Mona (Suzhou) Biotechnology Co., Ltd</td>
			<td>MQ10101S</td>
			<td></td>
		</tr>
		<tr>
			<td>MonScript RTIII All-in-One Mix with dsDNase&#160;&#160;</td>
			<td>Mona (Suzhou) Biotechnology Co., Ltd</td>
			<td>MR05101M</td>
			<td></td>
		</tr>
		<tr>
			<td>Omni-ECL Femto Light Chemiluminescence Kit</td>
			<td>Epizyme Biotech</td>
			<td>SQ201</td>
			<td></td>
		</tr>
		<tr>
			<td>PAGE Gel Fast Preparationb Kit&#160;</td>
			<td>Epizyme Biotech</td>
			<td>PG111</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin-streptomycin (Pen-Strep)</td>
			<td>Beijing Solarbio Science &#38; Technology Co.,Ltd</td>
			<td>P1400-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Polyvinylidene difluoride (PVDF) membrane</td>
			<td>Merck KGaA</td>
			<td>IPVH00010-1</td>
			<td></td>
		</tr>
		<tr>
			<td>Protein Free Rapid Blocking Buffer</td>
			<td>Epizyme Biotech</td>
			<td>PS108P</td>
			<td></td>
		</tr>
		<tr>
			<td>RIPA lysis solution</td>
			<td>Beijing Solarbio Science &#38; Technology Co., Ltd</td>
			<td>R0010</td>
			<td></td>
		</tr>
		<tr>
			<td>RPMI 1640 complete medium</td>
			<td>Thermo Fisher Scientific</td>
			<td>C11875500BT</td>
			<td></td>
		</tr>
		<tr>
			<td>Skimmed milk</td>
			<td>Campina: Elk</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>TBST buffer solution</td>
			<td>Beijing Solarbio Science &#38; Technology Co., Ltd</td>
			<td>T1082</td>
			<td></td>
		</tr>
		<tr>
			<td>The protein loading buffer</td>
			<td>Epizyme Biotech</td>
			<td>LT101S</td>
			<td></td>
		</tr>
		<tr>
			<td>TMEM200A knockdown plasmid</td>
			<td>MiaoLing Plasmid</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>TMEM200A primer</td>
			<td>Sangon Biotech (Shanghai) Co., Ltd.</td>
			<td></td>
			<td>Forward primer (5&#8217;-3&#8217;): AAGGCGGTGTGGTGGTTCG; Reverse primer (5&#8217;-3&#8217;): GATTTTGGTCTCTTTGTCACGGTT</td>
		</tr>
		<tr>
			<td>TMEM200A SiRNA1</td>
			<td>MiaoLing Plasmid</td>
			<td></td>
			<td>Forward primer (5&#8217;-3&#8217;): ACAACTGATGATAAGACCAG; Reverse primer (5&#8217;-3&#8217;): TGTTGACTACTATTCTGGTC</td>
		</tr>
		<tr>
			<td>TMEM200A SiRNA2</td>
			<td>MiaoLing Plasmid</td>
			<td></td>
			<td>Forward primer (5&#8217;-3&#8217;): CGTGTGAATGTCAATGACTG; Reverse primer (5&#8217;-3&#8217;): GCACACTTACAGTTACTGAC</td>
		</tr>
		<tr>
			<td>TMEM200A SiRNA3</td>
			<td>MiaoLing Plasmid</td>
			<td></td>
			<td>Forward primer (5&#8217;-3&#8217;): ACAACCACAACATCTGCCCG; Reverse primer (5&#8217;-3&#8217;): TGTTGGTGTTGTAGACGGGC</td>
		</tr>
		<tr>
			<td>Transmembrane protein 200A Antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>48081-1</td>
			<td></td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>CO2 cell culture incubator</td>
			<td>Haier Group</td>
			<td>PYXE-80IR</td>
			<td></td>
		</tr>
		<tr>
			<td>Electrophoresis instrument</td>
			<td>Bio-RAD</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Fluorescence quantitative PCR instrument</td>
			<td>Bio-RAD</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Gel Imaging System (Tanon 5200)</td>
			<td>Tanon Science &#38; Technology Co., Ltd</td>
			<td>LAB-0002-0007-SHTN</td>
			<td></td>
		</tr>
		<tr>
			<td>Multifunctional Enzyme Labeler</td>
			<td>Berthold</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

multiomics analysis of tmem200a as a pan-cancer biomarker

막관통 단백질인 TMEM200A는 인간의 암 및 면역 침윤과 관련이 있는 것으로 알려져 있습니다. 여기서는 멀티오믹스 분석을 통해 일반 암에서 TMEM200A 의 기능을 평가하고, 그 결과를 확인하기 위해 위세포의 시험관 내 세포 배양을 이용하였다. 여러 인간 암 유형에서 TMEM200A 의 발현은 UCSC Xena 데이터베이스의 RNA-seq 데이터를 사용하여 평가되었습니다. 생물정보학 분석은 진단 및 예후 바이오마커로서 TMEM200A 의 잠재적인 역할을 밝혀냈습니다. 
정상 위 및 암 세포주의 배양액을 배양하고 TMEM200A 녹다운했습니다. TMEM200A 의 발현 수준은 정량적 실시간 중합효소 연쇄 반응 및 웨스턴 블로팅을 사용하여 측정되었습니다. 그런 다음 체외 기능 상실 연구를 사용하여 위암(GC) 세포의 악성 행동 및 종양 형성에서 TMEM200A 의 역할을 결정했습니다. 웨스턴 블롯은 GC의 상피-중간엽 전이(EMT) 및 PI3K/AKT 신호 전달 경로에 대한 녹다운의 효과를 평가하는 데 사용되었습니다. 생물정보학 분석은 TMEM200A 가 GC에서 높은 수준으로 발현되었음을 보여주었습니다. 
GC 세포의 증식은 TMEM200A 녹다운(knockdown)에 의해 억제되었으며, 이는 또한 비멘틴, N-cadherin 및 Snai 단백질을 감소시키고 AKT 인산화를 억제했습니다. PI3K/AKT 신호전달 경로는 GC 발달의 TMEM200A 매개 조절에도 관여하는 것으로 나타났다. 여기에 제시된 결과는 TMEM200A 가 EMT에 영향을 미쳐 종양 미세환경을 조절한다는 것을 시사합니다. TMEM200A 는 또한 PI3K/AKT 신호전달을 통해 EMT에 영향을 미쳐 종양 미세환경에 영향을 미칠 수 있습니다. 따라서 범암, 특히 GC에서 TMEM200A 는 잠재적인 바이오마커 및 종양유전자가 될 수 있습니다.

Cancer has emerged as a persistent public health issue endangering human health globally1due to its high morbidity and mortality rates worldwide, posing a heavy financial and medical burden to society2. Significant advancements in cancer therapy have been achieved in recent years thanks to the discovery of cancer markers3, and researchers have developed novel diagnostic methods and new drugs to treat cancer. However, some patients with cancer still have poor prognoses because of factors such as medication resistance, side effects of drugs, and chemical sensitivity4. Therefore, there is an urgent need for identifying new biomarkers for screening and treating early-stage cancers5.
Membrane proteins are proteins that can bind and integrate into cells and organelle membranes6. These can be grouped into three categories depending on the strength of binding to the membrane and their location: lipid-anchored proteins, integral proteins, and peripheral membrane proteins7,8. A transmembrane (TMEM) protein is an integral membrane protein that consists of at least one transmembrane segment9, which passes either completely or partially through the biological membrane. 
Although the mechanisms of action of proteins belonging to the TMEM family are not well understood, these proteins are known to be involved in several types of cancers10. Several TMEM proteins are associated with migratory, proliferative, and invasive phenotypes, and their expression is often associated with a patient's prognosis11. Therefore, TMEM family members have become the target of research. A comprehensive review of existing reports on TMEM revealed that they are mostly associated with inter- and intracellular signaling12, immune-related diseases, and tumorigenesis10. Many TMEMs also possess important physiological functions, for example, ion channels in the plasma membrane, activation of signal transduction pathways, as well as the mediation of cell chemotaxis, adhesion, apoptosis, and autophagy10. Therefore, we hypothesized that TMEM proteins may be important prognostic markers in the detection and treatment of tumors.
TMEM200A expression is significantly elevated in gastric cancer (GC). Higher expression of TMEM200A13, which has eight exons and a full length of 77.536 kb on chromosome 6q23.1, has been linked to a poor prognosis for overall survival (OS) in cases of GC. Yet the changes in its expression have rarely been reported in oncology studies. This article compares and analyzes the usefulness of TMEM200A as a therapeutic target and tumor diagnostic marker in various cancer studies using different publicly available datasets. We assessed the effectiveness of TMEM200A as a pan-cancer diagnostic and prognostic biomarker as well as its expression levels in various human cancer types using RNA-seq data from the UCSC Xena and TCGA databases, as well as by real-time quantitative polymerase chain reaction (qRT-PCR) and western blotting. 
The effect of TMEM200A expression levels on mutation rates, regulatory processes, tumor diagnosis and prognosis, immune infiltration, and immunotherapy was further investigated using a mix of computational tools and dataset websites. CBioPortal and the Catalog of Somatic Mutations in Cancer Cells (COSMIC) databases were used to examine mutations in TMEM200A. Sangerbox and TISIDB websites were utilized to understand how TMEM200A influences immune infiltration. The Tumor Immune Single Cell Center (TISCH) online tool and CancerSEA database were used to investigate the function of TMEM200A. Finally, to assess the impact of TMEM200A on the malignant behavior and tumor development function of GC cells, a loss-of-function experiment was conducted in an in vitro assay. Additionally, western blotting was performed to assess how TMEM200A knockdown affected the PI3K/AKT signaling pathway and the epithelial-mesenchymal transition (EMT) in GC.

저자 스포트라이트: Unveiling Transmembrane Protein Family-Related Markers in Gastric Cancer and Implications for Targeted Therapies (위암에서 막관통 단백질군-관련 마커 발표 및 표적 치료에 대한 시사점) 

범암 바이오마커로서의 TMEM200A 의 멀티오믹스 분석

다양한 암에서의 TMEM200A 발현 그림 1에서 볼 수 있듯이 먼저 다양한 데이터베이스를 통해 다양한 암에서 TMEM200A의 차등 발현 수준을 분석했습니다. 담관암(CHOL), 두경부 편평세포암(HNSC), 신투명세포암(KIRC), 신유두세포암(KIRP), 간세포암(LIHC), STAD, 갑상선암(THCA)에서 TMEM200A 발현이 인접 정상 조직과 비교하여 상승하였다. 그러나 ...

Watch this Scientific Journal Video about Unveiling Transmembrane Protein Family-Related Markers in Gastric Cancer and Implications for Targeted Therapies at JoVE.com

여기에서는 암에서 TMEM200A 의 생물학적 기능을 연구하기 위해 여러 생물 정보학 도구를 결합한 프로토콜을 제시합니다. 또한 생물정보학 예측을 실험적으로 검증합니다.

The transmembrane protein, TMEM200A, is known to be associated with human cancers and immune infiltration. Here, we assessed the function of TMEM200A in ...

암 바이오마커 연구에서 상당한 진전이 이루어졌습니다. 그럼에도 불구하고, 막관통 단백질군과 관련된 종양 관련 물질의 추출물 기능은 아직 밝혀지지 않았습니다. 그 결과, 위암의 TMEM200A에 대한 연구는 관련 세포에 대한 새로운 연구 방향을 제시했습니다.본 연구에서는 온라인 데이터베이스 예측과 실험기법 검증을 병행하여 관련 분야의 연구단계와 줄기세포 실험비용을 단순화하였다. 앞으로 본 연구실은 위암에서 종양의 특이적 기전을 규명하고, 당화변형과 대사기록의 연관성을 규명하며, 위암 치료를 위한 새로운 표적을 발굴하는 데 주력할 것입니다.

multiomics-analysis-of-tmem200a-as-a-pan-cancer-biomarker

Research

JoVE Journal

Cancer Research

Multiomics Analysis of TMEM200A as a Pan-Cancer Biomarker

921 조회수.  Youjiang Medical University for Nationalities. 암 바이오마커 연구에서 상당한 진전이 이루어졌습니다. 그럼에도 불구하고, 막관통 단백질군과 관련된 종양 관련 물질의 추출물 기능은 아직 밝혀지지 않았습니다. 그 결과, 위암의 TMEM200A에 대한 연구는 관련 세포에 대한 새로운 연구 방향을 제시했습니다.본 연구에서는 온라인 데이터베이스 예측과 실험기법 검증을 병행하여 관련 분야의 연구단계와 줄기세포 실험?...

비디오: 저자 스포트라이트: Unveiling Transmembrane Protein Family-Related Markers in Gastric Cancer and Implications for Targeted Therapies (위암에서 막관통 단백질군-관련 마커 발표 및 표적 치료에 대한 시사점) 

The transmembrane protein, TMEM200A, is known to be associated with human cancers and immune infiltration. Here, we assessed the function of TMEM200A in common cancers by multiomics analysis and used in vitro cell cultures of gastric cells to verify the results. The expression of TMEM200A in several human cancer types was assessed using the RNA-seq data from the UCSC Xena database. Bioinformatic analysis revealed a potential role of TMEM200A as a diagnostic and prognostic biomarker. 
Cultures of normal gastric and cancer cell lines were grown and TMEM200A was knocked down. The expression levels of TMEM200A were measured by using quantitative real-time polymerase chain reaction and western blotting. In vitro loss-of-function studies were then used to determine the roles of TMEM200A in the malignant behavior and tumor formation of gastric cancer (GC) cells. Western blots were used to assess the effect of the knockdown on epithelial-mesenchymal transition (EMT) and PI3K/AKT signaling pathway in GC. Bioinformatic analysis showed that TMEM200A was expressed at high levels in GC. 
The proliferation of GC cells was inhibited by TMEM200A knockdown, which also decreased vimentin, N-cadherin, and Snai proteins, and inhibited AKT phosphorylation. The PI3K/AKT signaling pathway also appeared to be involved in TMEM200A-mediated regulation of GC development. The results presented here suggest that TMEM200A regulates the tumor microenvironment by affecting the EMT. TMEM200A may also affect EMT through PI3K/AKT signaling, thus influencing the tumor microenvironment. Therefore, in pan-cancers, especially GC, TMEM200A may be a potential biomarker and oncogene.

Here, a protocol is presented in which multiple bioinformatic tools are combined to study the biological functions of TMEM200A in cancer. In addition, we also experimentally validate the bioinformatics predictions.